Sex Plant Reprod (2000) 13:29–35
© Springer-Verlag 2000
O R I G I N A L PA P E R
Jan Drouaud · Katia Marrocco · Céline Ridel Georges Pelletier · Philippe Guerche
A Brassica napus skp1-like gene promoter drives GUS expression in Arabidopsis thaliana male and female gametophytes
Received: 5 October 1999 / Revision accepted: 28 March 2000
Abstract We isolated a gene, BnSKP1γ1, expressed in rapeseed (Brassica napus) microspores, which encodes a protein closely related to the Saccharomyces cerevisiae Skp1p protein previously shown to play a role in cell cycle regulation. Twelve SKP1-related genes have already been identified in the Arabidopsis thaliana genome. Using a PCR-based strategy, we isolated three other genes. To date, most data available concerning the function of the SKP1-related genes in plants are indirect. Studies on transgenic A. thaliana plants show that a 1100-bp BnSKP1γ1 promoter fragment can direct GUS expression in female gametophytes soon after the first haploid mitosis and in male gametophytes from the tetrade stage. No GUS expression can be detected in sporophytic tissues. RT-PCR experiments suggest that this gene is expressed in a similar way in rapeseed. This is the first reported case of a gene exhibiting such an expression pattern in angiosperms. Key words Gene-specific expression · skp1-like gene · GUS staining · Gametophytic expression · Brassica napus · Arabidopsis thaliana
Introduction During the past 10 years, an increasing amount of work has been devoted to the isolation and characterization of genes involved in molecular processes underlying gametophyte development in angiosperms. Numerous pollenexpressed genes have been characterized, most of which are likely to be involved at a late developmental stage, which is in mature pollen or in growing pollen tubes (reviewed by Twell and Howden 1998). There are comparatively few genes known to be expressed at earlier stages J. Drouaud · K. Marrocco · C. Ridel · G. Pelletier · P. Guerche (✉) Station de Génétique et d'Amélioration des Plantes, Institut National de la Recherche Agronomique, Route de Saint Cyr, 78026 Versailles cedex, France e-mail:
[email protected] Tel.: +33-1-30 83 30 73, Fax: +33-1-30 83 33 19
(Oldenhof et al. 1996; Fourgoux-Nicol et al. 1999), and so far no gene product has ever been shown to play a key role in the mechanisms of cellular determination/differentiation that lead from microsporocytes to young bicellular pollen. In addition, no gene has ever been shown to be expressed specifically in ovules, nor to be essential for functional embryo sac differentiation. EMS and T-DNA insertional mutagenesis have been used to create and isolate A. thaliana plants affected in both male and female gametophyte development (Feldmann et al. 1997; Howden et al. 1998; Schneitz et al. 1998; Bonhomme et al. 1998). These mutants exhibit abnormalities at various stages of gametophyte development, but so far the function of the genes implicated has not yet been fully elucidated. Thus the molecular basis of both male and female gametophyte development is still almost completely unknown. We reported recently the isolation of four cDNAs corresponding to genes transcribed in rapeseed microspores (Fourgoux-Nicol et al. 1999). Among these, M4 and M25 exhibit strong sequence similarity to the SKP1 gene of Saccharomyces cerevisiae. Yeast Skp1p protein forms complexes together with CDC53, an "F-box" containing protein and the RING-H2 finger protein Hrt1 (Bai et al. 1996; Seol 1999). These SCF (for SKP1, CDC53, F-box protein) complexes mediate targeting of proteins for degradation by the proteasome pathway through conjugation with polyubiquitin chains. They have been shown to exhibit an E3-type (ubiquitin-protein ligase) activity. These complexes are believed to exist in all eukaryotes since their constitutive members have representatives in all eukaryotic species analyzed so far. In yeast, Skp1p and Cdc53p are constant members of SCF complexes, while there are many different F-box proteins, each of which can bind specific substrates which are often involved in cell cycle regulation. For example, the S.cerevisiae F-box protein Cdc4 binds Sic1p, Far1p, Cdc6p, Gcn4p, and others (reviewed by Hershko and Ciechanover 1998). In contrast with lower eukaryotes (such as fungi and protists) and animals, plants have numerous SKP1-like
30
genes. In A. thaliana, which has been chosen as a model organism because of its low genetic complexity, 12 putative genes have already been found in the sequenced part of the genome, and the total number should even be higher. Yang et al. (1999) recently described the effect of a transposon insertion into the SKP1-like ASK1 gene of A. thaliana. The ask1.1 mutant is defective in male meiosis and is therefore male sterile while female fertility is not affected (Yang et al. 1999). Several F-box proteins have recently been characterized in plants by using a mutational approach. TIR1 is a component of the auxin response pathway (Gray et al. 1999), COI1 plays a role in the response to jasmonic acid (Xie et al. 1998), whereas UFO (Unusual Floral Organs) is involved in floral morphogenesis (Ingram et al. 1997). In addition, all these proteins have been shown to bind, in a "two-hybrid" assay, several A. thaliana SKP1like proteins (Samach et al. 1997; Gray et al. 1999). In this paper we report the isolation, using a modified TAIL-PCR procedure, of the Brassica napus BnSKP1γ1 gene, which corresponds to cDNA M25 (the gene corresponding to M4 was called BnSKP1γ2). An 1100-bp promoter fragment of this gene was fused to a GUS coding sequence and introduced into A. thaliana. GUS staining was observed in both male and female gametophytes at a very early stage, before the first haploid mitosis in microspores and at the two-nuclei stage in the embryo sac. Moreover, in B. napus, RT-PCR experiments allowed detection of BnSKP1γ1 transcripts in the pistil and microspores. To our knowledge, this is the first reported case of a gene exhibiting such an expression pattern in angiosperms. Indeed, no gene has ever been described which is expressed specifically in both gametophytes. In order to isolate the orthologous A. thaliana gene(s), we performed PCR with degenerate oligonucleotides designed from different alignments of Brassicaceae skp1related genes and thus discovered three new skp1-like genes in A. thaliana.
Materials and methods TAIL-PCR amplifications The protocol is adapted from Liu and Whittier (1995). A set of 12 decameric nucleotides (Operon, Alameda, Calif., USA) were used as arbitrary primers. All PCR amplifications were performed using 0.2 µM specific primer and 0.5 µM arbitrary primer. The B. napus genomic DNA concentration in the first PCR reaction was 2 ng/µl, whereas products from first and second PCR reactions were diluted 1:500 in the subsequent reactions. The cycling profile of the first PCR reaction was: (94°C; 2 min) [(94°C; 1 min) (60°C; 1 min) (72°C; 2 min)]×4, (94°C; 1 min) (35°C; 3 min) (72°C; 2 min) {[(94°C; 1 min) (60°C; 1 min) (72°C; 2 min)]×2, (94°C; 1 min) (38°C; 1 min) (72°C; 2 min)}×15. The cycling profile of the second and third PCR reactions was: (94°C; 2 min) {[(94°C; 1 min) (60°C; 1 min) (72°C; 2 min)]×2, (94°C; 1 min) (38°C; 1 min) (72°C; 2 min)}×15.
PCR amplification and cloning of A. thaliana skp1-related sequences PCR amplifications were performed using 0.2 µM each of the following primers: P2: 5' GCACATGCTCGARGAYGRNTG 3' P5: 5' CTTTWACGTTGARRTARTTNGC 3' P7: 5' TATGGATCCWGATHKTDTTGWYDAGYTCC 3' P10: 5' TTAGAATTCKMNCGDAYYTCYTCNGGNGT 3' The A. thaliana (Wassilevskija ecotype) genomic DNA concentration in PCR reactions was 2 ng/µl. The cycling profile of all PCR amplifications was: (94°C; 2 min) [(94°C; 1 min) (Θ; 1 min) (72°C; 2 min)]×30 with Θ equal to 5° below Tm for each primer pair. PCR products were bulk cloned in pGEM-T vector (Promega, Madison, Wis., USA) according to the manufacturer's recommendations. Construction of BnSKP1γ1 promoter-GUS gene fusion The PCR-amplified BnSKP1γ1 5'UTR/promoter fragment was blunt ended with T4 polymerase, then cloned into the EcoRV site of pBS SK– (Stratagene, La Jolla, Calif., USA). It was then subcloned as a SacII-SalI restriction fragment into SacII-XhoI digested pAF1 plasmid (Fourgoux-Nicol et al. 1999), which contains a GUS coding sequence and NOS gene 3'UTR. Finally the whole synthetic gene was excised with NotI, then subcloned into the NotI site of the pEC2 binary plasmid (Cartea et al. 1998), thus generating pJD121. A. thaliana transformation and histochemical analysis Three-week-old A. thaliana (Wassilevskija ecotype) plants were transformed by in planta transformation (Bechtold et al. 1993) with Agrobacterium tumefaciens strain C58, harboring the pJD121 plasmid. Seeds from these plants were sown on Basta-containing sand. Basta-resistant plants were then planted out, and grown in the greenhouse. Histochemical assays for GUS activity of plant tissues and organs were conducted as described previously (Fourgoux-Nicol et al. 1999). For confocal laser scanning microscopy, ovule nuclei were stained with propidium iodide (Abs: 535/ Em: 617) as described by Motamayor et al. (1999). The preparations were mounted in a drop of citifluor glycerol/PBS (Oxford Instruments, Orsay, France) and observed with a Leica TCS-NT laser scanning microscope (Leica microsystemes, Heidelberg, Germany) using an argon/krypton laser (Omnichrome, Chino Calif., USA), and an acousto-optical tunable filter system for excitation. The propidium iodide emission signal was collected with a long pass 590 barrier filter. The GUS signal was detected by reflection (Grandjean O and Trass I, unpublished data, Cheng and Kriete 1995). Developing male gametophytes were observed at different stages with differential contrast microscopy (DIC) after clearing treatment with Herr's buffer (Herr 1971). RT-PCR experiments Twenty milligrams of total RNA from Brassica napus leaves and microspores and 2 µg of polyA+ RNA from 6-mm pistils were first incubated with DnaseI (0.5U/µl) at 37°C for 30 min following the manufacturer's (Roche Diagnostics, Basel, Switzerland) recommendations. After phenol purification and ethanol precipitation, the RNA pellets were resuspended in 15 µl; 2 µl were kept to make the control PCR ("–RT") and 13 µl were used to make the first cDNA strand using the "Superscript" reverse transcriptase (Promega) and Oligo dT primer following the manufacturer's recommendations in a final volume of 25 µl ("+RT"). Primers M25 5' (TTATATCGATATGTCCGAGTCAAACAAG) and M25 3' (TTATATCGATCTAGAAAAAATTAGGGTTG) were then used
31 to make PCR reactions with a cycling profile of (94°C; 2 min) [(94°C; 1 min) (58°C; 1 min) (72°C; 2 min)]×25. The amplified fragment is 511 bp long. For the "–RT" experiments, 1 µl of a 1:38 dilution of the 2 µl was used to make the PCR reactions. For the "+RT", 1 µl of a 1:20 dilution of the RT reaction was used. As a positive control, 20 ng of B. napus DNA was used in the same PCR experiment. Five microlitres of the PCR product was loaded in a 1% agarose-TBE gel, except for the "Microspore +RT" and the "B.n DNA" lanes where 1 µl of the PCR reaction was loaded. The gel was then blotted and hybridized with a probe corresponding to the M25 coding sequence using standard procedures (Sambrook et al. 1989).
Results Isolation of the BnSKP1γ1 gene promoter Upstream regulatory regions of the BnSKP1γ1 gene were isolated using a TAIL-PCR technique (adapted from Liu and Whittier 1995). A set of 12 arbitrary primers was used, in order to select the longest possible PCR fragment. A 1200-bp DNA fragment was amplified, which corresponds to the beginning of the BnSKP1γ1 coding sequence and the region located upstream from the translation start site (Genbank accession number AF274864). Analysis of the sequence in this region revealed several short DNA elements whose presence has already been noted in the promoters of pollen-specific genes (Twell 1994) but whose functional significance is not well established. A 1100-bp promoter region was fused to a GUS coding sequence and NOS terminator using pAF1opt plasmid (Fourgoux-Nicol et al. 1999). The resulting chimeric gene was cloned in the binary plasmid pEC2 to generate pJD121. This gene was next introduced into A. thaliana, and approximately 50 independent transformed A. thaliana plants were selected. This species was chosen because it can be more easily transformed and has a shorter life cycle than B. napus. Moreover, it belongs to the same botanical family as B. napus, and it has already been observed in previous reports that the pattern of expression of Brassica genes is well conserved in transgenic A. thaliana plants (Xu et al. 1993; Broun and Somerville 1997; Fourgoux-Nicol et al. 1999). The promoter of the BnSKP1γ1 gene directs gametophytic expression in A. thaliana plants Histochemical GUS staining was performed on the inflorescences of 26 independent A. thaliana transformants (JD121 family) and their progeny. All the transgenic lines exhibited GUS activity in both male and female gametophytes at a very early developmental stage. Five lines also displayed GUS staining in the style under the papillar region, and one plant showed very high activity in all floral organs. For these six plants, the lack of spatial specificity could be explained by a position effect; indeed, this has already been noted for short promoter regions (Moore et al. 1997). Nevertheless, in most of the lines (20 out of 26), the reporter gene expression is re-
stricted to gametophytes. Their expression pattern is qualitatively similar to that of the JD121.1 plant shown in Fig. 1. Genetic analysis of JD121.1 progeny suggests that the genome of this plant contains a single insertion (114 phosphinotricine-resistant plants out of 155 seedlings, χ2=0.13, P
