Arch Virol (2008) 153:2215–2223 DOI 10.1007/s00705-008-0250-3
ORIGINAL ARTICLE
A DNA vaccine candidate expressing dengue-3 virus prM and E proteins elicits neutralizing antibodies and protects mice against lethal challenge Se´rgio Oliveira De Paula Æ Danielle Malta Lima Æ Rafael Freitas de Oliveira Franc¸a Æ Alessandra Cristina Gomes-Ruiz Æ Benedito Antoˆnio Lopes da Fonseca
Received: 29 May 2008 / Accepted: 17 October 2008 / Published online: 12 November 2008 Ó Springer-Verlag 2008
Abstract In an effort to develop a suitable DNA vaccine candidate for dengue, using dengue-3 virus (DENV-3) as a prototype, the genes coding for premembrane (prM) and envelope proteins (E) were inserted into an expression plasmid. After selecting recombinant clones containing prM/E genes, protein expression in the cell monolayer was detected by indirect immunofluorescence and immunoprecipitation assays. After selecting three vaccine candidates (pVAC1DEN3, pVAC2DEN3 and pVAC3DEN3), they were analyzed in vivo to determine their ability to induce a DENV-3-specific immune response. After three immunizations, the spleens of the immunized animals were isolated, and the cells were cultivated to measure cytokine levels by ELISA and used for lymphoproliferation assays. All of the animals inoculated with the recombinant clones induced neutralizing antibodies against DENV-3 and produced a T cell proliferation response after specific stimuli. Immunized and control mice were challenged with a lethal dose of DENV-3 and observed in order to assess their survival capability. The groups that presented the best survival rate after the challenge were the animals vaccinated with the pVAC3DEN3 clones, with an 80% survival rate. Thus, these data show that we have manufactured a vaccine candidate
S. O. De Paula (&) Laborato´rio de Imunovirologia Molecular, Departamento de Biologia Geral, Universidade Federal de Vic¸osa, Av PH Rolfs, s/n, Vic¸osa, Minas Gerais CEP 36570-000, Brazil e-mail:
[email protected] D. M. Lima R. F. de Oliveira Franc¸a A. C. Gomes-Ruiz B. A. L. da Fonseca Department of Internal Medicine, School of Medicine of Ribeira˜o Preto, University of Sa˜o Paulo, Ribeira˜o Preto, SP, Brazil
for DENV-3 that is able to induce a specific immune response and protects mice against a lethal challenge.
Introduction Dengue is a severe public health problem throughout the tropical and subtropical areas of the world. It is caused by one of the four serotypes of dengue virus (DENV 1, 2, 3, 4), and it is transmitted from human to human mainly by the Aedes aegypti mosquito [14]. DENV belongs to the family Flaviviridae, genus Flavivirus, is an enveloped virus and has a single-stranded RNA genome of approximately 11 kb in size, which encodes three structural and seven non-structural proteins [11]. Dengue virus infections cause a wide spectrum of symptoms ranging from asymptomatic infections to a severe disease called dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS) [14]. The World Health Organization estimates that there may be around 100 million cases of dengue virus infection worldwide every year, resulting in approximately 500,000 cases of DHF and 24,000 deaths each year [26]. Dengue vaccines are urgently needed because the only method currently available to prevent dengue virus infections is the control of A. aegypti, the main mosquito vector, but this approach is expensive and most often unfeasible [6, 13, 17]. The development of a dengue vaccine has been considered a high priority by the World Health Organization for decades because an effective vaccine could be used in the immunization of children in endemic areas such as Asia, Latin America and the Caribbean, in the protection of travelers and military forces, and in the control of epidemics [15].
123
2216
S. O. De Paula et al.
At present, there are no licensed vaccines for dengue viruses, but several vaccine candidates are in the late stage of development. Of these vaccines, some are chimeras generated by introducing premembrane (prM) and envelope (E) genes from dengue viruses into the full-length cDNA of attenuated yellow fever (YF) or dengue vaccine viruses. Also, two tetravalent vaccines have been made by passage of each of the four dengue viruses in non-human tissue cultures [2, 10, 16]. In spite of the fact that 80–90% of the volunteers developed neutralizing antibodies after two doses of the tetravalent vaccine, the appearance of a febrile illness similar to dengue, probably due to reversion to the wild phenotype, has been a frequent complication of some of these vaccine candidates. Also, the chimera vaccines have induced adverse effects such as fever, headache, myalgia, malaise and reactions at the inoculation site. Another important factor is the risk of inducing encephalitis in infants due to a residual neurotropism of the YF 17D strain [16]. Another problem associated with the use of live vaccines is the possibility of recombination between a vaccine strain and a wild-type virus, resulting in a new virus with undesirable properties [29, 32]. Due to this possibility, Seligman and Gould [29] encourage the development of non-live flavivirus vaccines. Thus, among the alternative strategies for immunization against dengue, the production of DNA recombinant vaccines is an approach to be tested. In an effort to develop a DNA vaccine candidate for DENV-3, we have constructed three DNA vaccine candidates and demonstrated that they elicit neutralizing antibodies and a Th1 immune response against DENV-3 in mice and that one of them may be a candidate to be included in a possible tetravalent vaccine.
Materials and methods Cell line, virus and plasmids C6/36, Vero and HeLa cells were purchased from the Cell Culture Section of Adolfo Lutz Institute, Sa˜o Paulo, Brazil. DENV-3, H-87 strain, was kindly donated by Dr. Robert E. Shope, University of Texas at Galveston, TX. The expression plasmid (pCI) was purchased from Promega Corporation, Madison, WI.
Construction of plasmids expressing prM/E proteins Dengue virus RNA was purified from 0.5 ml of a supernatant of the C6/36 cell culture infected with DENV-3 using a Trizol Reagent (Invitrogen, Gaithersburg, MD) according to manufacturer’s recommendations. The RNA was reverse transcribed in a standard reaction using a random hexamer primer and Superscript Mix (Invitrogen, Gaithersburg, MD). The resultant cDNA was used to amplify different segments of the virus genome, using primer pairs shown in Table 1. In order to express the DENV-3 prM/E proteins, two fragments of 1,393 and 651 bp were ligated to each other to give rise to a fragment of 2,044 bp containing these genes and the prM signal peptide. Both fragments were RT-PCR amplified and then cloned individually into the eukaryotic expression vector pCI (Promega, Madison, WI), where the 2,044-bp fragment was reassembled in the correct orientation. Nucleotide sequencing of plasmids expressing prM/E proteins Sequencing primers were designed using the DENV-3 H87 strain sequence (GenBank accession no. M93130) as the genome reference. For whole-region sequencing, PCR primer pairs were pCIs 50 CACTATAGGCTAGCCTCGAG30 and Den3AS1 50 CGCCACTGATCTATCGC30 , Den3S2 50 GGCGTTAGCTCCCCATGTCG30 and Den3AS2 50 GCC ATGGTAGTCACACACCC30 , Den3S3 50 CCATGGCTA AGAACAAGCCC30 and Den3AS3 50 GTTTCATTTCC CACCTGGTG30 , Den3S4 50 GAAACGCAGGGAGTTA CGGC30 and Den3AS4 50 CCTCCTGAGGTTTGGATC TC30 , Den3S5 50 GAGATCCAAACCTCAGGAGG30 and Den3AS5 50 CCCTTCCTGTACCAGTTGAT30 , Den3S6 50 ATCAACTGGTACAGGAAGGG30 and pCIas 50 ATCA TGTCTGCTCGAAGCGG30 . The selected clones were grown at 37°C in LB medium with ampicillin, and the plasmids were extracted using the GeneJET Plasmid Miniprep Kit (Fermentas Life Sciences, US). The plasmids were quantified by UV absorption (260 nm) and approximately 500 ng of each plasmid was employed in a reaction with the ABI Prism Big Dye Terminator Cycle Sequencing Ready Kit (Applied
Table 1 Construction of recombinant plasmids containing segments of the dengue virus 3 genome Primer
Sequence
Fragment
Specific nucleotide position
sDEN3Mlu
50 GGGACGCGTACATCGTGTCTCATG30
1,393 bp
364–1,757
cDEN3Acc
50 CCCGTCTACATTTTAAGTGCCCCG30
sDEN3Acc
50 GGGGTAGACTCAAGATGGACA30
cDEN3Not
50 CCCGCGGCCGCGATTCAGCTTGCACCACGACCC30
123
651 bp
1,758–2,409
Dengue-3 DNA vaccine protection against lethal challenge
Biosystems, CA, USA). For each sample to be sequenced, we worked with 5 lM of each primer with 2 ll of Big Dye, 2 ll of buffer (200 mM Tris-HCl, pH 9.0 and 5 mM magnesium chloride) and nuclease-free water in a final volume of 10 ll. The obtained sequences were aligned using CLUSTAL W, with a final manual adjustment completed with BioEdit software and then compared with the sequences available at the Genbank. prM and E protein expression by the recombinant plasmids prM and E expression by the recombinant plasmids was analyzed by transfecting HeLa cells, using cationic-lipidbased delivery. Briefly, 30 lg of plasmid DNA was mixed with Lipofectamine 2000 (Invitrogen, Gaithersburg, MD) at a lipid mass ratio of 2:1 in 1 ml of minimum essential medium without fetal bovine serum (FBS) and incubated for 45 min at room temperature. The mixture was added to cells grown to about 90% confluence in 35-mm cell culture dishes (Costar, Cambridge, MA) and incubated for 72 h at 37°C in a 5% CO2 incubator. After incubation, the cultures were processed for the detection of prM and E protein expression by indirect immunofluorescence (IFA) [30], immunoprecipitation and a sandwich ELISA of the culture supernatants. Immunoprecipitation and immunoblotting All extracts and supernatants of the transfected cells were subjected to immunoprecipitation using a mouse immune ascitic fluid specific for DENV-3 (MIAF-DENV-3) produced in our laboratory and Protein A Sepharose (Amersham Biosciences, NJ, USA). Briefly, 1 ml of the cellular extract and 2 ml of the culture supernatant was added to 0.1 volume of MIAF-DENV-3 and incubated at 4°C for 8 h with constant agitation. After incubation, 0.1 volume of Protein A Sepharose was added to precipitate the antigen-antibody complex, and the sample was incubated at 4°C for 16 h. After incubation, the complexes were recovered by centrifugation at 12,000 g for 30 sec at 4°C, washed three times with PBS, suspended in loading buffer and subjected to SDS-PAGE. After SDS-PAGE, the proteins were transferred to a nitrocellulose membrane; the nitrocellulose membrane was blocked for 4 h with 0.5% BSA, washed three times with PBS Tween-20, incubated for 2 h at room temperature with MIAF-DENV-3 (1:100), washed again, and incubated for 2 additional hours with an anti-mouse-IgG alkaline phosphatase conjugate (Sigma, St. Louis, Missouri). The membrane was then washed three times with PBS Tween-20, and stained with the Western Blue Substrate for Alkaline phosphatase kit (Promega, Madison, WI).
2217
Sandwich ELISA Expression of the prM and E proteins was detected using a sandwich ELISA. Briefly, 96-well plates were coated with a high-titer human antibody against dengue virus (1:200) and then blocked with 2% BSA. The plates were then incubated with supernatants of transfected cells that contained the expressed proteins, MIAF-DENV-3, alkaline phosphatase-conjugated anti-mouse IgG, and p-nitrophenyl phosphatase. The cutoff OD value for determining serum positivity was calculated as the mean OD of the negative control sera plus 2 standard deviations (SD). Immunization of mice with DENV-3 and candidate vaccines Ten 3-week-old female Balb/c mice per group were injected by syringe and needle three times into the quadriceps muscle with 100 lg of pVAC1DEN3, pVAC2DEN3, pVAC3DEN3 or pCI. The mice were primed on day 0 and boosted on days 10 and 30 with 100 lg of DNA in a 25% PBS-sucrose solution. In parallel, another group of 10 mice was injected three times in the quadriceps muscle with 1 9 105 plaque-forming units per ml (PFU/ml) of DENV-3. Prior to boosting, blood samples were obtained through the retro-orbital route. Blood samples were also obtained 10 days after the last inoculation. Sera from these mice were stored at -70°C until use. ELISA and plaque-reduction neutralization test DENV-3 antibody was detected using a solid-phase enzyme-linked immunosorbent assay (ELISA) in 96-well ELISA plates that had been coated with 100 ll of DENV-1 and DENV-2 antigens (8 hemagglutination units) and incubated overnight at 4°C. ELISA plates were then blocked, washed and incubated with murine serum samples at 1:10 dilution in PBS for 60 min. They were then washed three times with PBS containing 0.5% Tween-20 and then incubated for another 60 min with horseradish-peroxidaseconjugated goat anti-mouse IgG. Plates were washed three times and incubated with 0.1 M sodium citrate buffer (pH 5.0) containing 2.2 mM o-phenylenediamine and 0.045% H2O2 and read at 490 nm. The cutoff OD value for determining serum positivity was calculated as the mean OD of the negative control sera plus 2 SD. Pooled mouse sera were also assayed for DENV-3 neutralizing antibody in a plaque-reduction neutralization test (PRNT) as described previously by Russell and Nisalak [28]. The percentage of plaque reduction was calculated for each dilution of tested sera using the number of plaques obtained with normal mouse serum as the baseline, and the end-point of this assay was 1:4,096. The highest dilution of
123
2218
serum yielding a 50% or greater decrease in the number of plaques was considered to be the neutralization antibody titer. The values were expressed as an arithmetic mean. Analysis of variance (ANOVA) and Bonferroni’s multiple comparison test were used to determine whether the differences among the inoculated mice groups were statistically significant. Statistical analysis was performed by using GraphPad Prism for Windows, version 3.0 (GraphPad Software Inc., San Diego, CA). Quantification of Th1 immune response cytokine (IFN-c, IL-2) and Th2 immune response cytokine (IL-4, IL-10) production from virus-stimulated lymphoid cells by ELISA Lymphoid cells from spleens of immunized and control mice were washed twice in RPMI 1640 containing 10% heat-inactivated FBS. Cells were resuspended at a final concentration of 1 9 106 cells per ml in RPMI 1640, and 100-ll aliquots were plated into 96-well culture plates. Then, 1 9 105 PFU/ml of DENV-3 that had been inactivated by heat treatment was added to each well to a final volume of 200 ll; plates were covered and incubated at 37°C in a 5% CO2 atmosphere. Following stimulation, aliquots of supernatants were removed after 48 h and stored at -70°C for subsequent analysis. Sandwich-type ELISAs (DuoSetTM, R&D Systems, MN) were used to estimate the IFN-c, IL-2, -4 and -10 levels in the supernatants of virus-stimulated cells according to manufacturer’s instructions. Briefly, serial dilutions of cytokine standards, samples and controls were added to 96well microplates coated with specific monoclonal antibody and incubated for 2 h at room temperature. Plates were then washed five times with PBS/T (PBS/0.5% Tween), and 100 ll of a horseradish-peroxidase-linked polyclonal antibody specific for mouse cytokines was added. After a 2-h incubation at room temperature, the plates were washed five times and 100 ll of a substrate solution was added per well. After a 30-min incubation at room temperature, the plates were read at 450 nm. Levels of cytokines in the supernatants were calculated based on the comparison of their OD with the standard calibration curve. T cell proliferation assay The DENV-3-specific lymphoproliferative responses from DNA-immunized mice were determined by cell proliferation ELISA (BrdU Lymphoproliferation Kit, Roche, Mannheim, Germany). Spleens were prepared from five mice per group inoculated with recombinant pVAC1DEN3, pVAC2DEN3, pVAC3DEN3, DENV-3, and pCI. Cell suspensions were treated with Tris-buffered ammonium chloride to eliminate red blood cells, washed, and
123
S. O. De Paula et al.
resuspended in RPMI 1640 supplemented with 5% FBS, HEPES buffer, L-glutamine, penicillin and streptomycin. Cells were cultured in triplicate in 96-well microtiter plates (1 9 106 cells/200 ll per well) in the presence of heat-inactivated DENV-3 (1 9 104 PFU/ml and 1 9 106 PFU/ml), control RPMI medium, and ConA (0.1 lg/ml). After 72 h, cultures were pulsed with 10 lM BrdU and incubated for 24 h at 37°C. The labeling medium was then removed by suction, and the plate was dried at 60°C for 1 h. The cells were fixed with FixDenat solution and incubated with anti-BrdU POD antibody, and the antigen-antibody reaction was detected by the subsequent substrate reaction read at 450 nm. ANOVA and the Bonferroni’s multiple comparison test were used to determine whether the differences among the groups of inoculated mice were statistically significant. Statistical analysis was performed by using GraphPad Prism for Windows, version 3.0 (GraphPad Software Inc.). Challenge experiments in mice Groups of 10 3-week-old female Balb/c mice were immunized with 100 lg of recombinant pVAC1DEN3, pVAC2DEN3, pVAC3DEN3 and pCI DNA in 25% PBSsucrose. Recombinant clones were injected intramuscularly into the quadriceps of the mice and boosted with 100 lg DNA 10 and 20 days later. A group with 10 mice was also immunized intraperitoneally with 1 9 104 PFU/ml of DENV-3 and boosted on the same scheduled dates. Twenty-one days after the third inoculation, mice were challenged intracerebrally with 50 LD50 (1 9 105 PFU/ml) of DENV-3, prepared from brains of DENV-3-infected suckling mice, and mouse survival was monitored daily for 21 days.
Results Expression of recombinant DENV-3 prM and E proteins Three recombinant plasmids, pVAC1DEN3, pVAC2DEN3 e pVAC3DEN3, were selected to be evaluated. They all contained an ATG codon and a translation initiation site provided by the forward primers used in the PCR amplification. They were all designed to express prM and E proteins. Cells transfected with all three DNA constructs showed positive IFA with MIAF-DENV-3, while cells transfected with pCI were negative (data not shown). As shown in Fig. 1, a band with a molecular weight of 53– 54 kDa, which corresponds to the expected molecular weight of the E protein, was detected in cell lysates by immunoprecipitation followed by immunoblotting. When
5
4
3
2
1
M
← 220 kDa ← 96 kDa
← 71 kDa
← 53-54 kDa
2219
neutralising antibodies titer
Dengue-3 DNA vaccine protection against lethal challenge 1000
500
0 15
30
60
-500
-1000
DEN3 pCi ← 45 kDa
45
days
pVAC2DEN3 pVAC3DEN3
pVAC1DEN3
Fig. 3 Fifty percent virus neutralization titers (PRNT50)a 15, 30 and 45 days post-vaccination. aThe values are expressed as arithmetic mean
Fig. 1 Analysis of DENV-3 E protein expression in intracellular fractions by immunoprecipitation followed by immunoblotting. HeLa cells were transfected with 30 lg of pVAC1DEN3 (Lane 1), pVAC2DEN3 (Lane 2), pVAC3DEN3 (Lane 3), pCI (Lane 4) and DEN-3 (Lane 5), Lane M: Molecular weight markers are indicated on the right of the figure
Fig. 2 Analysis of DENV-3 E protein expression in extracellular fractions by immunoprecipitation followed by immunoblotting and sandwich ELISA. HeLa cells were transfected with 30 lg of pVAC1DEN3 (Lane 1), pVAC2DEN3 (Lane 2), pVAC3DEN3 (Lane 3), pCI (Lane 4). The culture fluid (Lanes 1, 2, 3, and 4) were immunoprecipitated with protein A Sepharose and subjected to immunoblotting and sandwich ELISA
the supernatant was analyzed by immunoblotting, only pVAC1DEN3 showed a distinct E protein band in the supernatant; however, examination of supernatants from transfected cells by sandwich ELISA revealed that the expressed proteins from all three clones were also secreted into the supernatant (Fig. 2). Nucleotide sequencing of plasmids expressing prM/E proteins When the amino acid sequence of the pVAC1DEN3 clone was compared to the published reference sequence, we found two mutations that generated substitutions in domain III of the E protein, resulting in amino acid changes from Y to S (position 478) and from V to A (position 485). Clone pVAC2DEN3 also demonstrated two mutations, once again in domain III of the E protein. These mutations resulted in changes from K to T (position 488) and from K
to R (position 501). The pVAC3DEN3 clone, which showed the best protection in immunized animals, demonstrated a single mutation in the region of the prM gene, changing F to C at position 39 of the amino acid sequence. Antibody response in immunized mice Ten mice per group were inoculated with 100 lg of each of the three DNA constructs, DENV-3 and pCI, as described in ‘‘Materials and methods’’. As shown in Fig. 3, 100% of the animals immunized after one, two and three injections seroconverted and produced specific neutralizing antibodies. In all groups, neutralizing antibody titers were detected, induced by candidate DNA vaccines at levels comparable to those observed in the DENV-3 inoculated mice, and no statistical difference was detected among the groups. Cytokine response in immunized mice ELISA results showed that IFN-c and IL-2 were synthesized by the lymphocyte cells of mice immunized with pVAC3DEN3, and IL-10 was synthesized by the lymphocyte cells of immunized mice with pVAC1DEN3, as shown in Table 2. On the other hand, the recombinant clone pVAC2DEN3 did not induce the production of any of the cytokines tested. Spleen cells of DENV-3-immunized mice produced all four cytokine tested, demonstrating the ability of a natural infection to induce a potent immune response. DEN-3-specific T cell proliferation in DNA-vaccinated mice To evaluate if the plasmid DNA immunization could induce a DEN-3-specific lymphoproliferative response,
123
2220
S. O. De Paula et al.
Table 2 Quantification of Th1 immune response cytokines (IFN-k, IL-2) and Th2 immune response cytokines (IL-4, IL-10) of mice receiving DNA vaccines Immunogen
Stimulus
IFN-k (pg/ml)
IL-2 (pg/ml)
IL-4 (pg/ml)
IL-10 (pg/ml)
pVAC1DEN3
DEN-3 (H87)
0.0
0.0
0.0
12.5 ± 0.4
pCi
DEN-3 (H87)
0.0
0.0
0.0
0.0
DEN3
DEN-3 (H87)
37.5 ± 0.2
78.25 ± 0.3
15.25 ± 0.6
102.36 ± 1.3
pVAC2DEN3
DEN-3 (H87)
0.0
0.0
0.0
0.0
pCi
DEN-3 (H87)
0.0
0.0
0.0
0.0
DEN3
DEN-3 (H87)
48.5 ± 1.25
13.25 ± 0.7
4.75 ± 1.1
82.25 ± 1.2
pVAC3DEN3 pCi
DEN-3 (H87) DEN-3 (H87)
77.5 ± 1.5 0.0
445.73 ± 3.2 0.0
0.0 0.0
0.0 0.0
DEN3
DEN-3 (H87)
125.42 ± 1.6
123.75 ± 1.5
10.32 ± 1.35
56.89 ± 0.8
splenocytes from Balb/c mice belonging to groups with five mice per group described in ‘‘Materials and methods’’ were prepared in order to examine proliferation in response to specific antigen stimulation. Splenic lymphocytes derived from pVAC1DEN3-, pVAC2DEN3- and pVAC3DEN3-inoculated animals demonstrated a dose-dependent proliferative response to inactivated DENV-3, as shown in Fig. 4. Proliferation responses were always higher than the negative control, and the response of all three vaccine candidates to a higher dose of antigen was comparable to that observed in DENV-3-immunized mice. Challenge of immunized mice pVAC1DEN3, pVAC2DEN3 and pVAC3DEN3 vaccine candidates were evaluated for their ability to induce protective immunity against lethal challenge with DENV-3. Groups of 10 three-week-old Balb/c mice were immunized with the DNA vaccines, and positive and negative control mice were immunized with 1 9 104 PFU/ml of DENV-3 and with 100 lg of pCI, respectively. As shown in Fig. 5, immunization with pVAC3DEN3 induced solid protection against DENV-3 challenge, comparable to that observed in DENV-3 inoculated mice, where 80% of the challenged mice survived. However, only 40% and 30% survival was observed after immunization with pVAC1DEN3 and pVAC2DEN3, respectively. The negative control group immunized with pCI presented only 20% survival, showing that, at this age, a small percentage of mice will survive challenge with a wild-type virus.
Discussion In an effort to develop optimal DNA vaccine candidates for DENV-3, we have compared three DNA constructs. These constructs express the prM and E proteins of the DENV-3 (strain H-87). E protein expression is an important asset to
123
any dengue vaccine candidate since it is the major structural protein of the dengue viruses and contains the main flavivirus neutralizing epitopes [20, 24, 31]. Neutralizing antibodies are thought to play an important role in the immunity against dengue viruses, based on observations that maternal antibodies are protective in humans and that the passive transfer of neutralizing monoclonal antibodies can confer protection in mice [12]. We included the gene coding for the prM protein in our constructions due to the fact that the neutralizing epitopes of the E protein against dengue viruses seem to be conformation dependent, and studies with other flavivirus and with the dengue viruses demonstrate that the correct conformation of E protein is dependent on the co-expression of prM protein [5, 25]. All three DENV-3 DNA vaccines (pVAC1DEN3, pVAC2DEN3 and pVAC3DEN3) expressed the specific recombinant protein as observed by IFA, sandwich ELISA and immunoprecipitation followed by immunoblotting. The supernatants and cell extracts of transfected HeLa cells with pVAC1DEN3, pVAC2DEN3 and pVAC3DEN3 were associated with both secretion and expression of the E protein in the transfected cells. In this study, E protein expression by transfected cells is in agreement with previous work demonstrating that the prM gene is necessary for the correct expression of the E protein gene [4, 5]. All animals inoculated with our DNA vaccine candidates produced neutralizing antibodies against DENV-3. The ability of a DNA vaccine to induce neutralizing antibodies has been demonstrated against dengue virus, tickborne encephalitis virus and Japanese encephalitis virus. Studies using tick-borne encephalitis virus demonstrated that the E protein, truncated or not, along with prM induced neutralizing antibodies and mouse protection [18, 21, 22]. Immune responses to DNA vaccines against Japanese encephalitis and DENV-2 viruses suggest that there is a correlation between the E protein production level and the induction of neutralizing antibodies in mice [22, 23].
Dengue-3 DNA vaccine protection against lethal challenge
2221
Fig. 4 Proliferation responses to dengue virus in mice receiving DNA vaccines. Splenocytes, obtained from each mouse 7 days after the final immunization, were tested by a BrdU incorporation assay. C-: negative control (RPMI Medium); 104: 1 3 104 pfu/ml of inactivated DENV-3; 106: 1 3 106 pfu/ml of inactivated DENV-3; ConA concanavalin A
150
pCi
pVAC2DEN3
DEN3
pVAC3DEN3
% Survival
pVAC1DEN3 100
50
0 0
5
10
15
20
25
Days
Fig. 5 Survival of DNA-immunized mice after challenge with a lethal dose of DENV-3. Groups of 3-week-old female BALB/c mice were immunized with DENV-3, pVAC1DEN3, pVAC2DEN3, pVAC3DEN3 or pCI, challenged intracerebrally with 50 LD50 of DENV-3, and monitored daily for survival up to 21 days postchallenge
The data on cytokine production by immunized mice suggesting that the immune response was predominantly a Th-1 response is similar to that observed in recipients of monovalent dengue virus vaccines [33]. To further investigate whether the protective efficacy of DNA vaccines can be improved by simultaneous expression of IL-2 and other cytokines, Wu et al. co-injected mice with DNA vaccines and plasmids expressing cytokines genes, and their results indicated that mice immunized with pD2NS1 and pIL-12 offered the strongest protection, indicating that IL-12 triggered the Th1 immune response and augmented the NS1-DNA-induced protection of mice challenged with a lethal dose of DENV-2 virus [9]. A proliferation response was observed with the splenic lymphocytes derived from pVAC1DEN3-, pVAC2DEN3and pVAC3DEN3-inoculated animals. Previous studies evaluated the proliferation response to dengue virus, and there were clear differences in the magnitude of the proliferation response [3, 27]. The low response observed with lymphoid cells of the mice immunized with DNA vaccines is possibly due to their own stimuli, because we only detected proliferation of splenic cells at a concentration of
123
2222
1 9 104 PFU/ml, and better results were obtained at a concentration of 1 9 106 PFU/ml, the highest viral titer we have obtained in C6/36 cell cultures infected with the DENV-3 strain H-87. Mice immunized with the DNA vaccines, DENV-3 and pCI plasmid were challenged by intracerebral injection of a lethal dose of DENV-3. The animals vaccinated with pVAC3DEN3 were the ones that obtained the highest survival rate after the challenge (80%). The control group inoculated with DENV-3 also showed an 80% protection rate, while the group inoculated with the pCI plasmid showed a 20% protection rate. The lower protection rates observed in the animals immunized with the other recombinant DNA clones were possibly due to the mutations that generated substitutions in domain III of the E region, this region being widely recognized as a critical target region for neutralizing antibodies. With participation in the events of receptor recognition, we believe that these mutations may have impaired the protection levels of these vaccine clones [7, 19]. In another study, a DENV-3 DNA vaccine expressing prM and E genes was tested for immunogenicity and protective efficacy in Aotus Monkeys. Five of the six vaccinated animals demonstrated moderate DENV-specific antibody responses as measured in vitro. The delay in onset of viremia after challenge in the animal that failed to develop anti-DENV-3 antibodies suggests that there may have been some sort of a non-antibody-related immune response to the vaccine. It is conceivable that a low-level cellular immune response may have occurred in this animal, but there are no data to support this [3]. These data showed the importance of measuring both Th1 and Th2 responses to evaluate the effectiveness of vaccines, and in this study we measured both responses. The functions of different classes of antibodies—IgM, IgE, IgA, and subclasses of IgG—in the control of infections include the prevention or limitation of the initial infection and subsequent viremia or bacteremia and the killing of infected cells by antibody-dependent cellular cytotoxicity or complement-mediated lysis. In the case of extracellular infections, specific antibodies are needed for the support of a strong response by CD4 ? type-1 helper T (Th1) cells [1, 8]. During intracellular infections, important T cell responses precede the formation of substantial levels of the antimicrobial antibody. The decrease in the level of infectious virus coincides with the increase in the activity of cytotoxic T cells. These effector T cells are primarily responsible for controlling and sometimes clearing many different intracellular infections, as has been fully documented for many infections [1, 8]. In spite of the fact that this work does not represent a novel approach to the development of a dengue vaccine, it is of fundamental importance because our data agree with
123
S. O. De Paula et al.
recent published work reporting the construction and testing of a DNA-based vaccine against DENV-3 [3]. All of these vaccines demonstrate the ability of a DENV-3 DNA vaccine to elicit a neutralizing antibody response and to protect against live virus challenge. Furthermore, besides the ability of working with this kind of technology for vaccine production, it is very important for developing countries to invest in the production of vaccines that will help to solve their public health problems at a lower cost than that practiced by the pharmaceutical companies. Thus, considering that the immune response induced by pVAC3DEN3 vaccine candidates was good, and considering the work being carried out with the other dengue viruses by our group, this vaccine candidate will certainly be analyzed in a tetravalent DNA vaccine format to determine vaccine efficacy. Acknowledgments This work was supported by Fundac¸a˜o de Amparo a Pesquisa do Estado de Sa˜o Paulo (FAPESP), Sa˜o Paulo, Brazil (Grant 00/12957-8). SOP was supported by a FAPESP scholarship (Grants 00/09287-0). Thanks to Jeffrey Ryan Oar of Oregon State University for the revision and corrections made to the text.
References 1. Ada G (2001) Vaccines and vaccination. N Engl J Med 345:1042–1053 2. Bhamarapravati N, Sutee Y (2000) Live attenuated tetravalent dengue vaccine. Vaccine 18:44–47 3. Blair PJ, Koche l, Raviprakash K, Guevara C, Salazar M, Wu SJ, Olson JG, Porter KR (2006) Evaluation of immunity and protective efficacy of a dengue–3 premembrane and envelope DNA vaccine in Aotus nancymae monkeys. Vaccine 24:1427–1432 4. Burke DS, Monath TP (2001) Flavivirus. In: Knipe DM, Howley PM (eds) Fields virology, 4th edn. Williams & Willkins, Philadelphia, pp 1043–1125 5. Cazionez RO, Fonseca BAL (2001) Recombinant plasmid expressing a truncated dengue–2 virus E protein without coexpression of prM protein induces partial protection in mice. Vaccine 19:648–654 6. Chambers TJ, Tsai TF, Pervikov Y, Monath TP (1997) Vaccine development against dengue and Japanese encephalitis: report a World Health Organization meeting. Vaccine 15:1494–1502 7. Crill WD, Roehrig RT (2001) Monoclonal antibodies that bind to domain III of dengue virus E glycoprotein are the most efficient blockers of virus adsorption to Vero cells. J Virol 75:7769–7773 8. Delves PJ, Roitt IM (2000) The immune system. N Engl J Med 343:37–49 9. Dharakul T, Kurane I, Bhamarapravati N, Yoksan S, Vaughn DW, Hoke CH, Ennis FA (1994) Dengue virus-specific memory T cell responses in human volunteers receiving a live attenuated dengue virus type 2 candidate vaccine. J Infect Dis 170:27–33 10. Edelman R, Wasserman SS, Bodison SA, Putnak RJ, Eckels KH, Tang D, Kanesa-Thasan N, Vaughn DW, Innis BL, Sun W (2004) Phase I trial of 16 formulations of a tetravalent live-attenuated dengue vaccine. Am J Trop Med Hyg 70:336 11. Fauquet CM, Mayo CM, Maniloff J, Desselberger U, Ball LA (2005) Virus taxonomy eight report of the international committee on taxonomy of viruses. Elsevier Academic Press, California
Dengue-3 DNA vaccine protection against lethal challenge 12. Fonseca B, Pincus S, Shope RE, Paoletti E, Mason PW (1994) Recombinant vaccinia viruses co-expressing dengue–1 glycoproteins prM and E induce neutralizing antibodies in mice. Vaccine 12:279–285 13. Gibbons RV, Vaughn DW (2002) Dengue: an escalating problem. BMJ 324:1563–1566 14. Gubler DJ (1998) Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11:480–496 15. Guirakhoo F, Pugachev KV, Zhang ZX, Myers G, Levenbook I, Draper K, Lang J, Ocran S, Itchell F, Parsons M, Brown N, Brandler S, Fournier C, Barrere B, Rizvi F, Travassos A, Nichols R, Trent D, Monath TP (2004) Safety and efficacy of chimeric yellow fever-dengue virus tetravalent vaccine formulations in nonhuman primates. J Virol 78:4761–4775 16. Hahn CS, Lusting S, Strauss EG, Strauss JH (1988) Western equine encephalitis virus is a recombinant virus. Proc Natl Acad Sci USA 85:5997–6001 17. Halstead SB (1988) Pathogenesis of dengue: challenges to molecular biology. Science 239:476–481 18. Heinz FX, Stiasny K, Puschner-Auer G, Holzman H, Allison SL, Mandl CW, Kunz C (1994) Structural changes and functional control of the tick-borne encephalitis virus glycoprotein E by the heterodimeric association with protein prM. Virology 198:109– 117 19. Jaiswa S, Khanna N, Swaminathan S (2004) High-level expression and one-step purification of recombinant dengue virus type– 2 envelope domain III protein in Escherichia colli. Protein Expr Purif 33:80–91 20. Kaufman BM, Summers PL, Dubois DR, Eckels KH (1987) Monoclonal antibodies against dengue–2 virus E glycoprotein protect mice against lethal dengue infection. Am J Trop Med Hyg 36:427–434 21. Konishi E, Fujii A (2002) Dengue type 2 virus subviral extracellular particles produced by a stable transfected mammalian cell line and their evaluation for a subunit vaccine. Vaccine 20:1058–1067 22. Konishi E, Yamaoka M, Khin-Sane-Win, Kurane I, Mason PW (1998) Induction of protective immunity against Japanese encephalitis in mice by immunization with a plasmid encoding JE virus premembrane and envelope genes. J Virol 72: 4925–4930
2223 23. Kurane I, Meage RA, Ennis FA (1989) Dengue virus-specific human T cell clones serotype crossreactive proliferation, interferon gamma production, and cytotoxic activity. J Exp Med 170:763–775 24. Lin B, Parrish CR, Murray JM, Wright PJ (1994) Localization of a neutralization epitope on the envelope protein of dengue virus type 2. Virology 202:885–890 25. Raviprakash K, Kochel TJ, Ewing D, Simmons M, Phillips I, Hayes CG, Porter KR (2000) Immunogenicity of dengue virus type 1 DNA vaccines expressing truncated and full length envelope protein. Vaccine 18:2426–2436 26. Rigau-Perez JG, Clark CG, Gubler DJ, Reiter P, Sanders EJ, Vorndam AV (1998) Dengue and dengue haemorrhagic fever. Lancet 352:971–977 27. Rothman AL, Kanesa-Thasan N, West K, Janus J, Saluzzo JF, Ennis FA (2001) Induction of T lymphocyte responses to dengue virus by a candidate tetravalent live attenuated dengue virus vaccine. Vaccine 19:4694–4699 28. Russell PK, Nisalak A (1967) Dengue virus identification by the plaque reduction neutralization test. J Immunol 99:291–296 29. Seligman SJ, Gould EA (2004) Live flavivirus vaccines: reasons for caution. Lancet 363:2073–2075 30. Tesh RB (1979) A method for the isolation and identification of dengue viruses, using mosquito cell cultures. Am J Trop Med Hyg 28:1053–1059 31. Trirawatanapong T, Chandran B, Putnak R, Padmanabhan R (1992) Mapping of a region of dengue virus type 2 glycoprotein required for binding by a neutralizing monoclonal antibody. Gene 16:139–150 32. Twiddy SS, Holmes EC (2003) The extent of homologous recombination in members of the genus Flavivirus. J Gen Virol 84:429–440 33. Wu S-F, Liao C-L, Lin Y-L, Yeh C-T, Chen L-H, Huang Y-F, Chou H-Y, Huang J-L, Shaio M-F, Sytwu H-K (2003) Evaluation of a protective efficacy and immune mechanisms of using a nonstructural protein NS1 in DNA vaccine against dengue 2 virus in mice. Vaccine 21:3919–3929
123
