CASE REPORT
Acquired Macrolide-Resistant Treponema pallidum After a Human Bite Robyn Neblett Fanfair, MD, MPH,* Mark Wallingford, MD,Þ Lana L. Long, MD,þ Kai-Hua Chi, MS,* Allan Pillay, PhD,* Cheng-Yen Chen, PhD,* and Kimberly A. Workowski, MD*§
Abstract: Syphilis is a systemic disease caused by the spirochete Treponema pallidum that is usually acquired through sexual exposure.
S
yphilis has reemerged as a significant public health concern, especially in men who have sex with men.1 Nonsexual transmission has been described in children via close nonsexual contact2 and by mouth-to-mouth transfer of prechewed food.3 We report a case of acquired primary syphilis with a macrolideresistant T. pallidum strain after a human bite from a nonsexual contact.
Case Report A 57-year-old man presented for evaluation of nontender, right-sided posterior cervical lymphadenopathy. Significant medical history included diabetes mellitus type 2, hypertension, and hyperlipidemia. There were no constitutional symptoms including fever, myalgias, weight loss, fatigue, or exposure to tuberculosis. The patient was a nonsmoker, heterosexual, and married and denied any extramarital sexual activity including oral, vaginal, or anal intercourse with men or women. The patient, a resident of a Midwestern state in the United States, denied recent domestic or international travel. Upon further questioning, the patient revealed that he was the victim of an attempted carjacking 3 months earlier. An unknown assailant reached through the driver window in an attempt to remove the keys; when the patient grabbed the arm of his assailant, he was bitten on the right forearm. The patient presented to an ambulatory clinic 10 days after the human bite for evaluation. He was given a tetanus booster; no laboratory studies were performed. At the time of presentation to our facility, the patient reported that he still had a ‘‘scar’’ on his right forearm. Physical examinations demonstrated a 2.5-cm 4.0-cm nontender right posterior cervical lymph node and an erythematous scaly patch on the anterior surface of his right forearm (Fig. 1A). The patch was nontender, well demarcated, and 3 cm in diameter. There were no other findings on physical examination. Laboratory studies were performed, and a punch biopsy of the lesion was conducted and sent for microscopic evaluation and immunohistochemical staining. The specimen demonstrated From the *Division of STD Prevention, National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, US Centers for Disease Control and Prevention, Atlanta, GA; †Maysville Internal Medicine and Pediatric Associates, Maysville, KY; ‡City Dermatology and Laser, Cincinnati, OH; and §Department of Medicine, Emory University School of Medicine, Atlanta, GA
Conflict of interest: None declared. Correspondence: Robyn Neblett Fanfair, MD, MPH, 1600 Clifton Rd, MS E02 Atlanta, GA 30333. E-mail:
[email protected]. Received for publication February 24, 2014, and accepted May 16, 2014. DOI: 10.1097/OLQ.0000000000000156 Copyright * 2014 American Sexually Transmitted Diseases Association All rights reserved.
Sexually Transmitted Diseases
&
hyperkeratosis, psoriasiform epidermal hyperplasia, and a bandlike infiltrate of lymphocytes, histiocytes, and plasma cells. Immunoperoxidase staining with rabbit antiYT. pallidum antiserum revealed coiled spirochetes along the epidermal-dermal junction. A tissue block was sent to the Centers for Disease Control and Prevention (CDC) for confirmatory testing. At CDC, DNA was extracted from the formalin-fixed, paraffin-embedded tissue specimen (DL11-92215) using the ChargeSwitch gDNA Mini Tissue Kit (Invitrogen Corporation, Carlsbad, CA) following the manufacturer’s instructions, with the exception that tissue lysis was done overnight at 55-C and DNA was eluted with 80 HL elution buffer. A T. pallidum-specific DNA target, the DNA polymerase I gene (polA, tp0105), and a polymerase chain reaction (PCR) inhibition control (human ribonulease P gene) were used in a real-time duplex PCR test. Polymerase chain reaction amplification was performed in a 25 HL reaction using 10 HL of DNA sample. The PCR reaction mixture contained 300 nM of sense primer (CAGGATCCGGCATA TGTCC), 300 nM of antisense primer (AAGTGTGAGCGTC TCATCATTCC), and 200 nM of TaqMan probe (CalRed610CTGTCATGCACCAGCTTCGACGTCTTYblack hole quencher 3 [BHQ3]) for polA detection; and 80 nM sense primer (CCAAG TGTGAGGGCTGAAAAG), 80 nM antisense primer (TGTT GTGGCTGATGAACTATAAAAGG), and 80 nM TaqMan probe (Cy5-CCCCA GTCTCTGTCAGCACTCCCTTC-BHQ3) for human ribonulease P gene detection; 1 PCR buffer; 5 mM MgCl2; 200 HM each dATP, dGTP, dCTP, and dUTP; 0.5 unit of uracil-Nglycosylase; and 1unit of AmpliTaq Gold DNA polymerase (All Applied Biosystems, Carlsbad, CA). Appropriate positive and negative template controls were included in the run. The following conditions were used for PCR amplification: the first cycle was performed at 50-C for 2 minutes followed by 95-C for 10 minutes. Subsequently, 50 PCR cycles were performed at 95-C for 20 seconds and 60-C for 1 minute. Polymerase chain reaction amplification was done in a RotorGene Q real-time PCR instrument (Qiagen Inc, Germantown, MD). The analytical sensitivity of the PCR assay was previously calculated to be between 1 and 10 genomic copies per reaction using a serial dilution of purified T. pallidum genomic DNA. The specimen tested positive for T. pallidum using the polA realtime duplex PCR. Positive fluorescent signals were seen with the FAM-labeled TaqMan probes for the specimen (DL1192215) and the positive control DNA (PC1) from the Nichols strain of T. pallidum (Fig. 1B). The Cy5-labeled TaqMan probe also gave positive signal for human DNA from the specimen indicating that the sampling was adequate for PCR and no inhibition was observed (Fig. 1C). As expected, a second positive control (PC2), which had spiked human DNA, gave a positive fluorescent signal in the Cy5 channel, whereas PC1 and negative template control did not contain human DNA and exhibited no fluorescence. A second real-time PCR targeting the treponemal 47-kDa lipoprotein gene (tpn47, tp0574) was used as a confirmatory
Volume 41, Number 8, August 2014
493
Copyright © 2014 by the American Sexually Transmitted Diseases Association. Unauthorized reproduction of this article is prohibited.
Fanfair et al.
FIGURE 1. A, Erythematous scaly patch on the anterior surface of right forearm. B/C, detection of T. pallidumYspecific DNA by polA real-time PCR. B, Amplification results of real-time PCR: FAM-labeled TaqMan probe targeting polA. C, Cy5labeled TaqMan probe targeting human ribonulease P gene. (B). FAM channel (C). Cy5 channel.
test, as previously described.4 Our patient’s specimen also tested positive for T. pallidum using the tpn47 real-time PCR assay (data not shown). Both polA and tpn47 real-time PCR tests are specific for pathogenic treponemes, and no PCR amplification was observed when a panel of organisms, including nonpathogenic treponemes, commensal, and pathogenic microbes found in the genitourinary tract and normal skin flora, were tested.5 A TaqMan-based real-time triplex PCR assay that can simultaneously detect the A2058G and A2059G mutations associated with azithromycin resistance was performed using a Rotor-Gene Q real-time PCR instrument.6 The specimen tested positive for the A2059G mutation indicating that the T. pallidum strain from the patient carried a macrolide-resistant genotype. Serological testing demonstrated a positive rapid plasma reagin (titer, 1:128) and reactive fluorescent treponemal antibodyabsorption test results. Enzyme-linked immunoassay test results for human immunodeficiency virus and hepatitis B and C were negative. Laboratory test results performed on his spouse were negative, including HIV, hepatitis B and C, and syphilis serological tests. The patient received treatment of early syphilis, one intramuscular injection of benzathine penicillin G, 2.4 million units. He reported transient chills and rigors within the first 24 hours after administration of penicillin therapy consistent with the Jarisch-Herxheimer reaction. The patient returned for clinical and serological evaluation 6 weeks after treatment. Resolution of cervical lymphadenopathy was noted, and the erythematous scaly patch on his forearm had been reduced to an area of mild discoloration. Sequential serological tests revealed greater than a 4-fold decline in rapid plasma reagin titer, 1:8 (6 weeks after treatment) and 1:4 (12 weeks after treatment).
DISCUSSION Syphilis, a systemic disease caused by T. pallidum, is usually acquired via sexual contact; however, among children,
494
nonsexual transmission via close contact with infected family members has been described.2 There have been several case reports of extragenital syphilitic chancres on a nipple after a human bite during sexual intercourse7,8; however, to our knowledge, this is the first report detailing acquisition of primary syphilis after a human bite from a nonsexual contact. The human oropharynx harbors a highly diverse treponeme population. Although T. pallidum is not considered to be a resident species of the human oral cavity, 7 species of oral treponemes have been cultured and additional cultivable species have been identified.3 Clinical manifestations of syphilis can be divided into a series of overlapping stages. This patient acquired primary syphilis from a human bite and presented to care for evaluation of a painless lesion at the site of inoculation. In the absence of treatment, the lesion ulcerated and spontaneously crusted in the weeks after exposure. Three months later, the patient sought evaluation for new-onset lymphadenopathy, a manifestation of secondary syphilis. At that time, a diagnostic workup including serological tests and lesion biopsy revealed T. pallidum as the causative organism; treatment of early syphilis led to the complete resolution of symptoms. This case report has several important clinical and public health implications. First, health care providers should consider syphilis as a potential cause of soft tissue infection after a human bite. Untreated syphilis can progress to cardiovascular disease and neurosyphilis.9 Early diagnosis and effective treatment are imperative to prevent transmission to others and the development of complications associated with latent or tertiary syphilis. Second, chromosomal mutations associated with macrolide resistance in T. pallidum and treatment failures have been associated with a single mutation (A2058G or A2059G) in the 23S rRNA gene and have been documented in multiple geographical locations.10Y12 Recently Chen et al.6 analyzed 129 genital ulcer specimens obtained from several geographic locations to determine the prevalence of A2058G or A2059G mutations in the United
Sexually Transmitted Diseases
&
Volume 41, Number 8, August 2014
Copyright © 2014 by the American Sexually Transmitted Diseases Association. Unauthorized reproduction of this article is prohibited.
Syphilis, Human Bite, Macrolide Resistance
States. The A2059G mutation was detected in 13.2% of samples. The T. pallidum strain in this report revealed a A2059G mutation. Our case in the Midwest is consistent with previous research that documented the presence of this mutation in many areas of the United States. Because of the prevalence of these chromosomal mutations, azithromycin should not be used as first-line therapy for syphilis and should be used with caution only when treatment with penicillin or doxycycline is not feasible.9 Accordingly, when treating syphilis, only penicillin or doxycycline (in nonpregnant patients) is recommended. Syphilis remains a major public health problem. Primary and secondary syphilis cases reported to CDC continue to increase annually.1 Our report documents a rare route of transmission of T. pallidum, a human bite not associated with sexual contact. Provider awareness of this rare and unusual presentation may facilitate earlier recognition, diagnosis, and treatment of extragenital syphilitic chancres associated with human bites. REFERENCES 1. Centers for Disease Control and Prevention. Sexually Transmitted Disease Surveillance 2011. Atlanta: U.S. Department of Health and Human Services; 2012. 2. Long FQ, Wang QQ, Jiang J, et al. Acquired secondary syphilis in preschool children by nonsexual close contact. Sex Transm Dis 2012; 39:588Y590. 3. Zhou P, Qian Y, Lu H, et al. Nonvenereal transmission of syphilis in infancy by mouth-to-mouth transfer of prechewed food. Sex Transm Dis 2009; 36:216Y217.
Sexually Transmitted Diseases
&
4. Chen CY, Chi KH, George RW, et al. Diagnosis of gastric syphilis by direct immunofluorescence staining and real-time PCR testing. J Clin Microbiol 2006; 44:3452Y3456. 5. Liu H, Rodes B, Chen CY, et al. New tests for syphilis: rational design of a PCR method for detection of Treponema pallidum in clinical specimens using unique regions of the DNA polymerase I gene. J Clin Microbiol 2001; 39:1941Y1946. 6. Chen CY, Chi KH, Pillay A, et al. Detection of the A2058G and A2059G 23S rRNA gene point mutations associated with azithromycin resistance in Treponema pallidum by use of a TaqMan real-time multiplex PCR assay. J Clin Microbiol 2013; 51:908Y913. 7. Oh Y, Ahn SY, Hong SP, et al. A case of extragenital chancre on a nipple from a human bite during sexual intercourse. Int J Dermatol 2008; 47:978Y980. 8. Chiu H, Tsai T. A crusted plaque on the right nipple. JAMA 2012; 308:403Y404. 9. CDC. Sexually transmitted diseases treatment guidelines, 2010. MMWR Morbid Mortal Wkly Rep 2010; 59. 10. Stamm LV, Bergen HL. A point mutation associated with bacterial macrolide resistance is present in both 23S rRNA genes of an erythromycin-resistant Treponema pallidum clinical isolate. Antimicrob Agents Chemother 2000; 44:806Y807. 11. Matejkova P, Flasarova M, Zakoucka H, et al. Macrolide treatment failure in a case of secondary syphilis: A novel A2059G mutation in the 23S rRNA gene of Treponema pallidum subsp. pallidum. J Med Microbiol 2009; 58(pt 6):832Y836. 12. Workgroup AGP. Prevalence of the 23S rRNA A2058G point mutation and molecular subtypes in Treponema pallidum in the United States, 2007 to 2009. Sex Transm Dis 2012; 39:794Y798.
Volume 41, Number 8, August 2014
495
Copyright © 2014 by the American Sexually Transmitted Diseases Association. Unauthorized reproduction of this article is prohibited.
