AhpC (alkyl hydroperoxide reductase) from Anabaena sp. PCC 7120 protects Escherichia coli from multiple abiotic stresses

Biochemical and Biophysical Research Communications 381 (2009) 606–611

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

AhpC (alkyl hydroperoxide reductase) from Anabaena sp. PCC 7120 protects Escherichia coli from multiple abiotic stresses Yogesh Mishra, Neha Chaurasia, Lal Chand Rai * Molecular Biology Section, Laboratory of Algal Biology, Center of Advanced Study in Botany, Banaras Hindu University, Varanasi-221005, India

a r t i c l e

i n f o

Article history: Received 9 February 2009 Available online 25 February 2009

Keywords: Anabaena sp. PCC 7120 Alkyl hydroperoxide reductase (AhpC) Abiotic stress Cloning RT-PCR

a b s t r a c t Alkyl hydroperoxide reductase (AhpC) is known to detoxify peroxides and reactive sulfur species (RSS). However, the relationship between its expression and combating of abiotic stresses is still not clear. To investigate this relationship, the genes encoding the alkyl hydroperoxide reductase (ahpC) from Anabaena sp. PCC 7120 were introduced into E. coli using pGEX-5X-2 vector and their possible functions against heat, salt, carbofuron, cadmium, copper and UV-B were analyzed. The transformed E. coli cells registered significantly increase in growth than the control cells under temperature (47 °C), NaCl (6% w/v), carbofuron (0.025 mg ml1), CdCl2 (4 mM), CuCl2 (1 mM), and UV-B (10 min) exposure. Enhanced expression of ahpC gene as measured by semi-quantitative RT-PCR under aforementioned stresses at different time points demonstrated its role in offering tolerance against multiple abiotic stresses. Ó 2009 Elsevier Inc. All rights reserved.

Introduction Alkyl hydroperoxide reductase (AhpC) is a key component of a large family of thiol-specific antioxidant (TSA) proteins distributed among prokaryotes and eukaryotes. Kim and Rhee [1] reported this protein from Saccharomyces cerevisiae and named as ‘‘Protector Protein”. Soon after, Jacobson et al. [2] reported the presence of AhpC in the bacterium Salmonella typhimurium. AhpC is known to scavenge a variety of peroxides, reactive oxygen, nitrogen and sulfur species [3,4]. A critical perusal of literature suggests that information on AhpC have remained confined to yeast and bacteria as for the molecular mechanism of its function against abiotic stresses is concerned. Bioinformatics analysis of the AhpC/TSA family revealed the presence of two highly conserved cysteine residues corresponding to Cys-47 and Cys-170 in yeast TSA. The N-terminal cysteine is conserved in all family members while the C-terminal cysteine is conserved in all except six members. Both Cys-47 and Cys-170 have been reported to be indispensable for the maintenance of the dimeric structure of the oxidized TSA and Cys-47. However, Cys-170 is not essential for the antioxidant activity as measured in vitro [3]. During the last few years the AhpC has been studied from a variety of aerobic and anaerobic bacteria including Clostridium pasteurianum [5] and Bacillus subtilis [6] with a major focus to understand the role of AhpC in (i) scavenging ROS and peroxides, (ii) virulence, (iii) interaction with other pathways, (iv) coloniza* Corresponding author. Fax: +91 542 2368174. E-mail addresses: [email protected], [email protected] (L.C. Rai). 0006-291X/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2009.02.100

tion, and (v) switching from a peroxide reductase to a molecular chaperone function. However, information on cyanobacterial AhpC has remained confined to Synechocystis [7]. Keeping in mind the reports that AhpC affects gene expression, protects DNA from oxidative damage, behaves as molecular chaperone under peroxide stress and binds metals, it was hypothesized that enhanced expression of this protein in Escherichia coli might offer protection from abiotic stresses. This study has been designed to clone ahpC gene from the filamentous diazotrophic cyanobacterium Anabaena sp. PCC 7120 into E. coli and examine its tolerance to abiotic stresses like heat, salt, pesticide, heavy metals and UV-B radiation. Materials and methods Cyanobacterial and bacterial strains and plasmids. Anabaena sp. PCC 7120 was grown photoautotrophically in BG-11 medium [8] buffered with Tris/HCl at 24 ± 2 °C under day light fluorescent tubes emitting 72 lmol photon m2 s1 PAR (photosynthetically active radiation) light intensity with a photoperiod of 14:10 h at pH 7.5. The cultures were shaken by hand 2–3 times daily. Escherichia coli strain DH5a and E. coli BL21 (Novagen) were used as hosts for cloning and expression, respectively. Escherichia coli cultures were stored as 10% (v/v) glycerol stocks at 80 °C and maintained on Luria–Bertani (LB) plates containing 1.4% (w/v) agar at 37 °C. Cells harboring recombinant plasmids were grown and maintained on LB media supplemented with 100 lg/ml ampicillin [9]. Plasmid pGEX-5X-2 (GE Healthcare) was used as a vector for cloning.

Y. Mishra et al. / Biochemical and Biophysical Research Communications 381 (2009) 606–611

Cloning of the ahpC gene from Anabaena sp. PCC 7120. Genomic DNA from Anabaena sp. PCC 7120 was isolated as previously described [10]. An open reading frame alr4404, putatively encoding alkyl hydroperoxide reductase was amplified by polymerase chain reaction using genomic DNA as template with a pair of primers, Pf (50 CGGAATTCCCATGGCTCTCCGTCTTGGT30 ) and Pr (50 ATTTGCGG CCGCTTACTTGTTAGGTTGAGGAGT30 ). The underlined bases represent EcoRI and NotI recognition sites, respectively. The PCR was done in a reaction mixture of 25 ll for 30 cycles at 94 °C for 1.5 min, 62 °C for 1 min, and 72 °C for 2 min using standard PCR conditions (100 ng DNA, 2.5 ll of 10 PCR buffer with 15 mM MgCl2, 200 lM dNTPs, 10 pmol of each primer and 0.2 U Taq DNA polymerase in an Icycler (Bio-Rad, USA). The amplified product was purified using standard freeze–thaw method for cloning. Construction of expression vector. The purified PCR product was digested with EcoRI and NotI (NEB) and the resultant DNA fragment was cloned into the expression vector pGEX-5X-2, digested with the same restriction enzymes. To construct the recombinant, plasmid pGEX-5X-2-ahpC was introduced into E. coli BL21, the latter was then grown in LB medium. The plasmid was then isolated and the DNA sequence of alr4404 was confirmed by sequencing. Expression analysis of ahpC gene using RT-PCR. For expression analysis of ahpC, E. coli. BL21 harboring the pGEX-5X-2-ahpC plasmid was grown in LB medium supplemented with 100 lg ml1 ampicillin in an orbital shaker (200 rpm) at 37 °C. When A600 of the culture reached a value of 0.5, isopropyl b-D-1-thiogalactopyranoside (IPTG) was added at a final concentration of 0.5 mM and the culture was grown for another 6 h at 37 °C. RNA was isolated from mid-exponential phase cells harboring the pGEX-5X-2-ahpC before and after IPTG induction using the TRIzol reagent as per the instructions given in the manufacturer’s protocol. All RNA samples were diluted to a concentration of 3 lg ml1 prior to RT. In a clear nuclease free 0.2 mL microcentrifuge tube 1 lL of 10 mM dNTP mix, 1 lL RNA template and 6 lL of nuclease free water was mixed gently and incubated at 70 °C for 10 min to remove any secondary structure of RNA. This was now placed on ice. About 15 U of MMLV reverse transcriptase (SIGMA, USA) was added along with the RT buffer. The final volume was adjusted to 20 ll with nuclease free water. The reaction mixture was incubated at 25 °C for 5 min followed by 37 °C for 50 min. To test the purity of the cDNA control reaction mixtures were prepared in the same way as mentioned above except that M-MLV RT was not added. To ascertain the equal concentration of RNA in the different samples RT-PCR of 16S rDNA was also performed and used as an internal control. The primer pair 8F 50 AGAGTTTGATCCTGGCTCAG30 and 518R 50 ATTACCGCGGCTGCTGG30 was used to amplify 16S rDNA by using the PCR cycle as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of incubation each consisting of 1 min denaturation at 94 °C, 1.5 min annealing at 58 °C, 2 min extension at 72 °C and a final extension of 10 min at 72 °C. To allow relative quantification of the ahpC gene, preliminary experiments were carried out with stepwise reduction of the number of PCR cycles to determine the maximum cycle number where samples do not reach amplification plateau. For amplification of the ahpC genes, 1 lL of the RT reaction product was used in subsequent PCR. PCR was performed in 25 ll final volume of reaction mixture containing 100 ng of DNA, 2.5 ll of 10X PCR buffer with 15 mM MgCl2, 200 lM dNTPs, 10 pmol of each primer and 0.2 U Taq DNA polymerase (Bangalore Genei, India) in an Icycler (Bio-Rad, USA). The Icycler profile was as follows: initial denaturation for 5 min at 94 °C followed by 40 incubation cycles each consisting of 1.5 min denaturation at 94 °C, 1 min annealing at 62 °C, 2 min extension at 72 °C and a final 10 min extension at 72 °C. The intensities of the RT-PCR products on agarose gels were quantified with the Gel Doc 2000 system using the Quantity one software (BioRad, USA).

607

Enzyme activity assay. For enzymatic assay of alkyl hydroperoxide reductase, E. coli BL21 harboring the pGEX-5X-2-ahpC and pGEX-5X-2 plasmids was grown as described previously in expression analysis of ahpC gene using RT-PCR. Cells harvested by centrifugation were suspended in 20 mM sodium phosphate buffer (pH 7.4) and disrupted by ultrasonication. The crude extract was centrifuged at 15,000 rpm for 1 h and the clear supernatant used for enzymatic assay. The rate of DTT oxidation catalyzed by AhpC in the presence of the peroxide substrate was measured by monitoring the change in absorbance at 310 nm due to the formation of the DTT disulfide. Typical conditions for the assays include enzyme (5.6 lM) incubated for 10 min with 10 mM DTT and 2 mM t-butyl hydroperoxide in 50 mM potassium phosphate buffer, pH 7.5, containing 300 mM NaCl and 1 mM EDTA in a 1-ml quartz cuvette. The rate of DTT oxidation was measured spectrophotometrically at 310 nm at room temperature [11]. SDS–PAGE analysis. For preparation of cell-free extracts (for SDS–PAGE) bacteria were harvested by centrifugation at 5000 rpm for 10 min in SIGMA 3 K-30 laboratory centrifuge, Germany and washed twice with extraction buffer (50 mM Tris–HCl, 10 mM MgCl2, 20 mM KCl, pH 7.5). The pellet was re-suspended in 5 ml extraction buffer and subjected to grinding under liquid nitrogen to break the cells. The extract was centrifuged at 10,000 rpm for 60 min. The supernatant was subjected to acetone/TCA precipitation overnight at 20 °C followed by centrifugation at 10,000 rpm for 15 min. The pellet was re-suspended in 500 ll Tris buffer (10 mM Tris–HCl, 50 mM NaCl, 1 mM EDTA, pH 7.5). The sample was stored in small aliquots at 20 °C until further characterization. Western blot analysis. In order to confirm the expression of ahpC gene in E. coli cells, SDS–PAGE was carried out as per the method of Sambrook and Russell [9]. The gels were transferred to a PVDF membrane (Millipore Immobilon-P), using a dual mini-electroblot system (Precision Instruments, Varanasi, India). The gel cassette was kept in transfer buffer (3.03 g l1 Tris base, 14.4 g l1 glycine, and 200 ml methanol (99% v/v pure) for 12 h or overnight at 15 V at 4 °C. Membrane was blocked for 4 h in TTBS (Tris buffer saline containing 0.1% Tween 20) and 5% (w/v) non-fat dried milk. The primary antibody was diluted as per the instructions of the donors. The membrane incubated overnight was washed five times for 5 min each in TTBS. This was then incubated in a Goat anti Rabbit IgG HRP (horseradish peroxidase) conjugated secondary antibody (Genei, India) for 4 h. Following four consecutive 5 min wash in TTBS the membrane was developed with DAB/NiCl2 visualization solution. The reaction was terminated by washing the PVDF membrane with Milli Q water. The immunoblots were dried between filter paper to reduce the background staining and photographed using a gel documentation system (Bio-Rad, USA). Polyclonal antibodies used for the detection of AhpC were obtained as generous gift from Prof. Dr. Karl-Josef Dietz, Germany. Assay for abiotic stress tolerance in transformed E. coli cells. In order to assess the role of alkyl hydroperoxide reductase in multiple stress tolerance, effects of copper, UV-B, salt, carbofuron, cadmium and temperature on the growth of transformed E. coli BL21 cells with pGEX-5X-2 (empty vector) and pGEX-5X-2-ahpC (recombinant plasmid) were examined. Mode of stress application: NaCl autoclaved separately was added directly into the sterilized medium to achieve an appropriate concentration. Stock solution of CdCl22H2O (100 mM), CuCl22H2O (1 M) and carbofuron (120 mg ml1) was prepared in glass-distilled water and sterilized by passing through a Millipore membrane filter (0.22 lm). Temperature treatment to culture suspensions was given in a temperature controlled incubator. About 2 mL of bacterial culture suspension (OD 0.5) was transferred into quartz cuvette (Pye Unicam B538751 A, thickness 1 mm, capacity 4 ml) exposed to artificial UV-B radiation (from UV-B lamp, CAT

608

Y. Mishra et al. / Biochemical and Biophysical Research Communications 381 (2009) 606–611

No. 34408, fotodyne, Inc. USA giving its maximum output at 310 nm). Measurement of survival and growth. Survival of the E. coli cells (transformed with empty vector) against salt, carbofuron, cadmium and temperature was measured by treating them with different concentrations of NaCl (2%, 4%, 6%, 8% and 10%), carbofuron (0.01, 0.02, 0.03, 0.04 and 0.05 mg ml1), CdCl2 (2, 4, 6 and 8 mM), temperature (42, 47, 52 and 57 °C), CuCl2 (0.5, 1, 2, 4 and 6 mM) and UV-B (5, 10, 20, 30, 40, 50 and 60 min), respectively. The LC50 for NaCl, carbofuron, cadmium (CdCl2), temperature, copper (CuCl2) and UV-B were determined by the plate colony count method. Approximately 50% survival of E. coli was observed at NaCl (6%), carbofuron (0.025 mg ml1), CdCl2 (4 mM), temperature (47 °C), CuCl2 (1 mM) and UV-B (10 min.), respectively. The E. coli cells transformed with empty vector failed to show any perceptible change in their growth when subjected to doses lower than LC50 of the selected stresses (data not shown). All growth experiments were conducted on a rotary shaker (200 rpm) at 37 °C. Single colony of E. coli BL21(DE3) cells transformed either with empty vector or recombinant plasmid was inoculated in tubes containing fresh LB medium and 100 lg ml1 ampicillin and grown overnight. On the following day the cultures were diluted to 0.05 optical density (OD) with fresh LB medium (25 ml in 100 ml conical flask) and incubated until OD value reached approximately 0.5. For abiotic stress treatment, 50 ll of E. coli culture (OD 0.5) was inoculated into flasks containing 50 ml culture medium and LC50 doses of NaCl, carbofuron, CdCl2 and CuCl2. For UV-B treatment 2 ml of E. coli culture (OD 0.5) was exposed to 10 min. of UV-B and 50 ll of such UV-B treated cells were inoculated into tubes containing 50 ml of liquid medium and grown in dark at 37 °C. For heat treatment, 50 ml of liquid medium inoculated by 50 ll of E. coli cells (OD 0.5) was incubated at 47 °C. The bacterial suspension was harvested at every 30 min and optical density measured by spectrophotometer (GE healthcare, USA). Specific growth rate was calculated by using the equation: l = [ln (n2/ n1)]/[t2-t1] where l stands for specific growth rate and n1, n2 are absorbance of culture suspension at the beginning (t1) and end

(t2) of selected time interval. Three independent measurements were taken and the average value was used for making the final data. Expressional analysis of ahpC in response to different abiotic stress. E. coli cells treated with UV-B, copper, salt, carbofuron, cadmium and temperature were withdrawn, RNA isolated using TRIzol reagent and expressional characterization of ahpC gene was done using RT-PCR as described above. To ascertain the equal loading of RNA in the different samples RT-PCR of 16S rRNA was also performed and used as an internal control. Results Molecular cloning of ahpC gene The PCR amplified product of about 664 bp (Fig. 1A) conforming to the theoretical length of the ahpC gene (639 bp) was cut with EcoRI and NotI, ligated to pGEX-5X-2 NotI and EcoRI digested backbone fragment and transformed in to E. coli strain BL21. The constructed plasmid was verified by DNA sequencing. The open reading frame of 639 bp encodes 212 amino acids with a calculated molecular weight of 23.7 kDa.

0.6

pGEX-5X-2-ahpC (-IPTG) pGEX-5X-2-ahpC (+IPTG) pGEX-5X-2 (empty vector)

Absorbance 310 nm

0.5 0.4 0.3 0.2 0.1 0.0

Fig. 1. (A) PCR amplification of the Anabaena sp. PCC 7120 ORF alr4404. Genomic DNA from Anabaena sp. PCC 7120 was isolated and amplified as described in Materials and methods. DNA samples were run on 1.2% agarose gel and visualized by ethidium bromide staining. Lane M DNA ladder (PCR marker), Lane 1 (L1) PCR product of alr4404 (639 bp). (B) Agarose gel showing double digested recombinant clones with EcoRI and NotI showing the presence of 639 bp fragment and 4.9 kb pGEX-5X-2 vector. Lane M DNA ladder (1 kb), Lane 1 (L1) PCR product of alr4404 (639 bp), Lane (L2) double digestion of pGEX-5X-2-ahpC with EcoRI and NotI showing release of (639 bp) fragment. (C) Expression of ahpC gene M DNA ladder (100 bp), N negative control, I without IPTG, +I with IPTG.

0

50

100

150

Time (Sec)

200

250

300

Fig. 2. (A) Twelve percentage SDS–PAGE analysis of AhpC protein expression in E. coli BL21 (Coomassie blue staining). Lane 1(M), protein marker; lane 2 (L1), whole cell lysate of BL21 E. coli cells containing the empty vector pGEX-5X-2 without IPTG induction; lane 3 (L2) whole cell lysate of E. coli BL21 cells containing the empty vector pGEX-5X-2 obtained at 4 h post-induction with 0.5 mM IPTG.; lane 4(L3), whole cell lysate of non-induced E. coli BL21 cells containing plasmid pGEX-5X-2ahpC; lane 4 (L4), whole cell lysate of the same cells obtained after 4 h induction with 0.5 mM IPTG. The number on the right is the apparent molecular mass of the recombinant ahpC protein (50 kDa). (B) Immunoblot detection of AhpC protein before and after IPTG induction. Lane 1 (M) molecular weight maker; lane 2 (N) negative control i.e., protein sample from E coli cells containing empty vector (pGEX-5X-2); lanes 3 and 4 (L1 and L2) sample from E. coli cells containing (pGEX5X-2-ahpC) incubated without (I) and with (+I) IPTG, respectively. (C) Activity assay of AhpC following oxidation of DTT from sample of E. coli cells containing empty vector (pGEX-5X-2) and cells containing recombinant plasmid (pGEX-5XahpC) with and without IPTG induction.

609

Y. Mishra et al. / Biochemical and Biophysical Research Communications 381 (2009) 606–611

Expressional analysis of ahpC gene in E. coli using RT-PCR and SDS– PAGE A 3–4 h exposure of cells transformed with recombinant plasmid to 0.5 mM IPTG was found to produce 4.5-fold increase in the transcript level compared to non-induced cells (Fig. 1C). Likewise, the fusion protein (on the SDS–PAGE) also showed induction after IPTG treatment (Fig. 2A).The molecular weight of GST-AhpC was found to be 50 kDa.

Western blotting and enzymatic activity assay Western blot analysis with anti-AhpC produced a single band of 50 kDa showing good agreement with the molecular weight (49.7) of ahpC gene deduced from the nucleotide sequence. This confirmed that E. coli cells containing pGEX-5X-2-ahpC produced an AhpC protein (Fig. 2B). The activity of alkyl hydroperoxide reductase was assayed by DTT oxidation in the presence of the peroxide as substrate and measured by monitoring the change in

pGEX-5X-2 (empty vector)

3.5

pGEX-5X-2 (empty vector) + 47ºC pGEX-5X-2-ahpC (recombinant plasmid) + 47ºC

3.5 3.0

Absorbance (600nm)

Absorbance (600nm)

3.0 2.5 2.0 1.5 1.0

2.5 2.0 1.5 1.0 0.5

0.5 0.0 0.0

pGEX-5X-2 (empty vector) pGEX-5X-2 (empty vector) + 6% NaCl pGEX-5X-2-ahpC (recombinant plasmid) + 6% NaCl

2.5

5.0

7.5

10.0

0.0 0.0

12.5

2.5

Absorbance (600nm)

3.0

pGEX -5X-2( empty vector) pGEX -5X-2 (empty vector) 2.5 mg carbofuron/100ml pGEX-5X-2-ahpC (recombinant plasmid ) 2.5 mg carbofuron /100ml

3.5

2.5 2.0 1.5 1.0

2.5 2.0 1.5 1.0 0.5

2.5

5.0

7.5

10.0

0.0 0.0

12.5

2.5

pGEX - 5X-2(empty vector) pGEX-5X-2(empty vector) +1mM CuCl2

3.5

7.5

10.0

12.5

pGEX-5X-2(empty vector) pGEX-5X-2(empty vector) 10min UV-B pGEX-5X-2-ahpC(recombinant vector)+10min UV-B

3.0

Absorbance (600nm)

3.0

Absorbance (600nm)

5.0

Time (h)

pGEX-5X-2-ahpC(recombinant plasmid) + 1mMCuCl2

2.5 2.0 1.5 1.0 0.5 0.0 0.0

12.5

pGEX-5X-2 (empty vector) pGEX-5X-2 (empty vector) + 4mM CdCl2

Time (h)

3.5

10.0

pGEX-5X-2-ahpC (recombinant plasmid) + 4mM CdCl

0.5 0.0 0.0

7.5

3.0

Absorbance (600nm)

3.5

5.0

Time (h)

Time (h)

2.5 2.0 1.5 1.0 0.5

2.5

5.0

7.5

Time (h)

10.0

12.5

0.0 0.0

2.5

5.0

7.5

10.0

12.5

Time (h)

Fig. 3. Effect of (A) heat, (B) salt, (C) carbofuron (pesticide), (D) cadmium, (E) copper and (F) UV-B on the growth of transformed E. coli cells containing recombinant plasmid (pGEX-5X-2-ahpC) and empty vector (pGEX-5X-2).The mean of three independent replicates are plotted with error bars indicating standard deviations. A–F represents the growth curves of E. coli cells in liquid medium exposed to heat, salt, carbofuron, cadmium, copper and UV-B, respectively.

610

Y. Mishra et al. / Biochemical and Biophysical Research Communications 381 (2009) 606–611

OD at 310 nm due to formation of the DTT disulfide. The cells containing (pGEX-5X-2-ahpC) plasmid showed increased activity over those containing empty vector. This level was further increased after IPTG treatment. Control cells containing empty plasmid pGEX-5X-2 did not depict any enzymatic activity (Fig. 2C). Effect of various abiotic stresses on growth of transformed E. coli cells The transformed cells with recombinant plasmid (pGEX-5X-2ahpC) showed better growth than those transformed with empty vector (Fig. 3A–F). When LC50 dose for cells transformed with empty vector was applied on pGEX-5X-2-ahpC transformed cells, the decrease in specific growth rate was only 15%, 20%, 8%, 5%, 25% and 23% under heat, salt, carbofuron, cadmium, copper and UV-B stress, respectively. Expression of ahpC in response to various abiotic stresses All the selected stresses triggered significant increase in the transcript level of ahpC gene at various time points (Fig. 4A–F). This increase being 1.10-, 1.23-, 2.51-fold in heat; 1.07-, 2.0-, 2.48-fold in salt; 1.98-, 2.34-, 2.42-fold in carbofuron; 1.72-, 2.42-, 2.54-fold in cadmium; 1.69-, 1.72-, 1.77-fold in copper and 1.58-, 1.91-, 2.09-fold in UV-B over control after 3, 6 and 9 h, respectively. Discussion Molecular analysis of cyanobacterial ahpC revealed its involvement against heat, salt, carbofuron, cadmium, copper and UV-B stresses. Specific growth rate of pGEX-5X-2-ahpC transformed E. coli cells was about 20–30% better than cells transformed with

pGEX-5X-2 under different stresses (Fig. 3A–F). The abiotic stresses used in the present study possessed a common mode of action e.g. disruption of redox homeostasis and generation of reactive oxygen species (ROS) resulting in impairment of key metabolic, regulatory and dissipative pathways. The cyanobacterial ahpC gene in E. coli conceivably quenches the ROS and RSS thereby ameliorating the destructive impacts caused by above stresses. It finds support from Nguyen-nhu and Knoops [4] where Ahp1p from S. cerevisiae protected against metals. Similarly, Guimaraes et al. [12] reported that AhpC is a key element protecting Mycobacterium tuberculosis from oxidative stress. Notwithstanding above, the enhanced tolerance of E. coli containing ahpC may be due to activation of the transcriptional activity of stress responsive genes. It is quite likely that the AhpC protein of transformed E. coli may act as general reductant performing the general folding or chaperoning function as known for heat shock proteins (HSPs). This speculation finds support from the present result as well as the report of Antelmann et al. [6] where a new class of HSP III induced by heat or salt stress in strictly rB independent manner was identified as AhpC. Thus, we presume that increased accumulation of AhpC in E. coli cells offers protection against above stresses. To explore the relationship between environmental stresses and ahpC induction, the expression of ahpC gene was attested by RT-PCR (Fig. 4A–F). A significant up-regulation of ahpC transcript as observed under different stresses at different time points suggested stress dependent differential regulation of ahpC gene. Our results are also supported by the report where up-regulation of ahpC gene was triggered by environmental stresses [13,14]. However, the spiking of IPTG in the culture medium failed to improve the stress tolerance of cells expressing cyanobacterial ahpC gene (data not shown). It is worth speculating that a sufficient amount of AhpC protein for combating stresses was already synthesized in the cells even without IPTG.

Fig. 4. RT-PCR analysis of ahpC gene exposed to (A) heat, (B) salt, (C) carbofuron (pesticide), (D) cadmium (E) copper and (F) UV-B at various time points.

Y. Mishra et al. / Biochemical and Biophysical Research Communications 381 (2009) 606–611

These results confirmed the hypothesis, that enhanced expression of ahpC gene from the Anabaena sp. PCC 7120, a heterologous source, can confer tolerance in non-photosynthetic E. coli cells against heat, salt, pesticide (carbofuron), cadmium, copper and UV-B. Therefore, engineering of this trait (ahpC) of Anabaena sp. PCC 7120 may open newer possibilities for development of a genetically modified cyanobacterium with greater agility to accommodate environmental hardship and fix nitrogen under abiotic stresses rampant in the paddy fields. Acknowledgments L.C. Rai is thankful to DST for financial support, and Yogesh Mishra and Neha Chaurasia to CSIR and UGC for SRF, respectively. We thank M. Gopinath, Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, India for pGEX-5X-2, and BL21, and Dr. Shashi Pandey for help in cloning experiments and the Program Coordinator, CAS in Botany for facilities. References [1] K.H. Kim, S.G. Rhee, Sequence of peptides from Saccharomyces cerevisiae glutamine synthetase N-terminal peptide and ATP-binding domain, J. Biol. Chem. 263 (1988) 833–838. [2] F.S. Jacobson, R.W. Morgan, M.F. Christman, B.N. Ames, An alkyl hydroperoxide reductase from Salmonella typhimurium involved in the defense of DNA against oxidative damage: purification and properties, J. Biol. Chem. 264 (1989) 1488– 1496. [3] H.Z. Chae, T.B. Uhm, S.G. Rhee, Dimerization of thiol-specific antioxidant and the essential role of cysteine 47, Proc. Natl. Acad. Sci. USA 91 (1994) 7022– 7026.

611

[4] N.T. Nguyen-nhu, B. Knoops, Alkylhydroperoxide reductase I protects Saccharomyces cerevisie against metal ion toxicity and glutathione depletion, Toxicol. Lett. 135 (2002) 219–228. [5] C.M. Reynolds, J. Meyer, L.B. Poole, An NADH-dependent bacterial thioredoxin reductase-like protein in conjunction with a glutaredoxin homologue form a unique peroxiredoxin (AhpC) reducing system in Clostridium pasteurianum, Biochemistry 41 (2002) 1990–2001. [6] H. Antelmann, S. Engelmann, R. Schmid, M. Hecker, General and oxidative stress responses in Bacillus subtilis: cloning, expression and mutation of the alkyl hydroperoxide reductase operon, J. Bacteriol. 178 (1996) 6571–6578. [7] N.H. Matsuda, K. Motohashi, H. Yoshimura, A. Nozaki, K. Inoue, M. Ohmohri, Antioxidative stress system in cyanobacteria, J. Biol. Chem. 280 (2005) 840– 846. [8] R. Rippka, J. Deruelles, J.B. Waterbury, M. Herdman, R.Y. Stanier, Generic assignments, strain histories and properties of pure cultures of cyanobacteria, J. Gen. Microbiol. 111 (1979) 1–6. [9] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. [10] A.K. Srivastava, A. Ara, P. Bhargava, Y. Mishra, S.P. Rai, L.C. Rai, A rapid and costeffective method of genomic DNA isolation from cyanobacterial culture, mat and soil suitable for genomic fingerprinting and community analysis, J. Appl. Phycol. 19 (2007) 373–382. [11] K.S. Iyer, W.A. Klee, Direct spectrophotometer measurement of the rate of reduction of disulfide bonds. The reactivity of the disulfide bonds of bovine lactalbumin, J. Biol. Chem. 248 (1973) 707–710. [12] B.G. Guimaraes, H. Souchon, N. Honore, B.S. Joanis, R. Brosch, W. Shepard, S.T. Cole, P.M. Alzari, Structure and mechanism of the alkyl hydroperoxidase AhpC, a key element of the Mycobacterium tuberculosis defense system against oxidative stress, J. Biol. Chem. 280 (2005) 25735–25742. [13] S. Mongkolsuk, W. Whangsuk, M. Fuangthong, S. Loprasert, Mutation in OxyR resulting in peroxide resistance in Xanthomonas campestris, J. Bacteriol. 182 (2000) 3846–3849. [14] U.A. Ochsner, M.L. Vasil, E. Alsabbagh, K. Parvatiyar, D.J. Hassett, Role of Pseudomonas aeruginosa oxyR-recG-operon in oxidative stress defense and DNA repair: Oxy R-dependent regulation of katB-ankB and ahpC-ahpF, J. Bacteriol. 182 (2000) 4533–4544.