Ascorbic acid rescues cardiomyocyte development in Fgfr1−/− murine embryonic stem cells

Biochimica et Biophysica Acta 1833 (2013) 140–147

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr

Ascorbic acid rescues cardiomyocyte development in Fgfr1 −/− murine embryonic stem cells Elisabetta Crescini a, Laura Gualandi b, 1, Daniela Uberti c, Chiara Prandelli c, Marco Presta b, Patrizia Dell'Era a,⁎ a b c

Fibroblast Reprogramming Unit, Department of Biomedical Sciences and Biotechnology, University of Brescia, 25123 Brescia, Italy General Pathology and Immunology Unit, Department of Biomedical Sciences and Biotechnology, University of Brescia, 25123 Brescia, Italy Pharmacology Unit, Department of Biomedical Sciences and Biotechnology, University of Brescia, 25123 Brescia, Italy

a r t i c l e

i n f o

Article history: Received 21 January 2012 Received in revised form 15 June 2012 Accepted 18 June 2012 Available online 23 June 2012 Keywords: FGFR1 Cardiomyocyte differentiation Embryonic stem cell Ascorbic acid

a b s t r a c t Fibroblast growth factor receptor 1 (Fgfr1) gene knockout impairs cardiomyocyte differentiation in murine embryonic stem cells (mESC). Here, various chemical compounds able to enhance cardiomyocyte differentiation in mESC [including dimethylsulfoxide, ascorbic acid (vitC), free radicals and reactive oxygen species] were tested for their ability to rescue the cardiomyogenic potential of Fgfr1 −/− mESC. Among them, only the reduced form of vitC, L-ascorbic acid, was able to recover beating cell differentiation in Fgfr1 −/− mESC. The appearance of contracting cells was paralleled by the expression of early and late cardiac gene markers, thus suggesting their identity as cardiomyocytes. In the attempt to elucidate the mechanism of action of vitC on Fgfr1−/− mESC, we analyzed several parameters related to the intracellular redox state, such as reactive oxygen species content, Nox4 expression, and superoxide dismutase activity. The results did not show any relationship between the antioxidant capacity of vitC and cardiomyocyte differentiation in Fgfr1−/− mESC. No correlation was found also for the ability of vitC to modulate the expression of pluripotency genes. Then, we tested the hypothesis that vitC was acting as a prolyl hydroxylase cofactor by maintaining iron in a reduced state. We first analyze hypoxia inducible factor (HIF)-1α mRNA and protein levels that were found to be slightly upregulated in Fgfr1 −/− cells. We treated mESC with Fe2+ or the HIF inhibitor CAY10585 during the first phases of the differentiation process and, similar to vitC, the two compounds were able to rescue cardiomyocyte formation in Fgfr1−/− mESC, thus implicating HIF-1α modulation in Fgfr1-dependent cardiomyogenesis. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The Fibroblast Growth Factor (FGF) family is composed by at least 22 structurally related polypeptides implicated in a variety of physiological and pathological conditions, including embryonic development, tissue growth and remodeling, inflammation, tumor growth and vascularization [1,2]. FGFs mediate their biological responses by binding to cell surface high affinity tyrosine kinase (TK) FGF receptors (FGFRs), designated FGFR-1 to ‐4 [3]. FGFRs are composed of an extracellular portion consisting of three immunoglobulin (Ig)-like domains (D1, D2, and D3), a hydrophobic transmembrane region, and a cytoplasmic TK tail. The ligand binding site for FGFs is located in the Ig-like domains D2–D3 and the linker that connects them [4]. FGF/FGFR signaling plays important functions in mesoderm formation and development [5]. Accordingly, Fgfr1−/− mice die during gastrulation, displaying defective

⁎ Corresponding author at: Fibroblast Reprogramming Unit, Department of Biomedical Sciences and Biotechnology, University of Brescia, Viale Europa, 11, 25123 Brescia, Italy. Tel.: +39 0303717539; fax: +39 0303701157. E-mail addresses: [email protected], [email protected] (P. Dell'Era). 1 Present address: Philochem AG, Otelfingen, Switzerland. 0167-4889/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.bbamcr.2012.06.024

mesoderm patterning with reduction in the amount of paraxial mesoderm and lack of somite formation [6,7]. Studies on chimeric embryos using FGFR1-deficient embryonic stem (ES) cells revealed an early defect in the mesodermal and endodermal cell movement through the primitive streak, followed by deficiencies in contributing to anterior mesoderm, including heart tissue [8,9]. Pluripotent murine embryonic stem cells (mESC) originate from the inner cell mass of the blastocyst and are capable of cell renewal and differentiation after in vitro aggregation into three-dimensional structures termed embryoid bodies (EBs) [10]. EBs generate derivatives of all three primary germ layers, including cardiomyocytes that are manifested by the appearance of spontaneously contracting foci [10]. The cardiogenic differentiation of mESC has been extensively studied because of their potential in regenerative medicine. Indeed, mESC-based cell therapy is a promising approach for the treatment of impaired myocardial function and provides promising results compared to other cell types [11]. To this respect, in order to enhance the efficiency of mESC differentiation toward a cardiomyogenic phenotype, modulation of cardiomyocyte differentiation has been achieved by treating mESC with various cytokines, growth factors, and synthetic chemical compounds, including dimethylsulfoxide, retinoic acid, or

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

ascorbic acid (vitC) [12]. Indeed, vitC enhances differentiation of ESC into cardiac myocytes [13], promotes the proliferation of cardiac progenitor cells [14], improves cardiomyoblast survival and promotes neovascularization in bioartificial grafts [15]. The isoform IIIc of FGFR1 has been implicated in cardiomyocyte development during EBS differentiation [16]. Indeed, Fgfr1 +/− and Fgfr1 −/− mESC are morphologically indistinguishable, have similar growth rates in vitro, and can generate muscle cells when injected in nude mice to form teratomas [7]. Nevertheless, analysis of the in vitro differentiation process of the two cell lines following EBS formation demonstrates a non-redundant role for Fgfr1 in cardiomyocyte development [16]. Accordingly, the expression of Fgfr1 is strictly required to up-regulate Nkx2.5, one of the first transcription factors that will guide differentiating mESC toward the cardiac lineage [16]. Here we show that the inhibitory effect of Fgfr1 knockout on cardiomyocyte differentiation can be overcome by treating mESC with vitC, Fe 2+, or the hypoxia inducible factor (HIF) inhibitor CAY10858. Taken together our data suggest that the cardiomyogenic property of vitC in Fgfr1−/− mESC system is related to its activity as a prolyl hydroxylase cofactor, thus implicating HIF-1α modulation in Fgfr1-dependent cardiomyogenesis. 2. Materials and methods 2.1. Chemicals L-Ascorbic Acid (vitC), 5-Azacytidine (AZA), S-Nitroso-N-Acetyl-DLPenicillamine (SNAP), N,N-Diethylaniline (DEA), Retinoic Acid (RA), Dimethyl-sulfoxide (DMSO), α-tocopherol (VitE), Sodium metabisulfite (Na2S2O5), N-Acetyl-L-Cysteine (NAC), L-Glutathione (GSH), N6,2′-Odibutyryladenosine 3′,5′ cyclic monophosphate (db-cAMP), Iron(II) chloride (FeCl2), and Dehydroascorbic acid (DHA) were from Sigma-Aldrich. The HIF-1α inhibitor CAY10585 [17] was from Cayman Chemical.

2.2. Cell culture Murine R1 mESC [7,16] were adapted to grow without feeder cells and maintained in DMEM supplemented with 15% fetal bovine serum (Hyclone), 0.1 mmol/L non essential amino acids, 1 mmol/L sodium pyruvate, 0.1 mmol/L b-mercaptoethanol, 2 mmol/L L-glutamine, and 1000 U/mL LIF (ESGRO, Chemicon). At T0 of differentiation, (differentiation day 0, DD0), exponentially growing mESC were resuspended in LIF-deprived (EBS) medium and cultured in 30 μL hanging drops (400 cells) for 2 days to allow cell aggregation. Then, aggregates were transferred onto 0.5% agarose-coated dishes and grown for 5 days in EBS medium. At DD7, EBs were transferred into 24-well tissue culture plates and allowed to adhere. Aggregates were monitored for the appearance of spontaneously contracting foci during the following days. The treatments with the different compounds were started at DD0. 2.3. RNA extraction, semi-quantitative, and quantitative RT-PCR analysis Total RNA was extracted from mESC as described [18]. Contaminating DNA was digested using DNAse, following indications reported in RNeasy® Micro Handbook (Qiagen). Two micrograms of total RNA was retrotranscribed with MMLV reverse transcriptase (InVitrogen) using random hexaprimers in a final 20 μL volume. For semiquantitative PCR, 2 μL of the retrotranscribed RNA were subjected to polymerase chain reaction (PCR) using REDTaq® ReadyMix™ PCR Reaction Mix (Sigma). Oligonucleotide primers and PCR conditions were described previously [16]. The data were confirmed by analyzing RNA extracted from two or more independent differentiation experiments. Quantitative PCR (qPCR) was performed with a Biorad iCycler iQ™ Real-Time PCR Detection System using a iQ™ SYBR Green Supermix (Biorad) according to manufacturer's instructions. The qPCR specific

141

primers (final concentration 400 nM) were as follows: Nkx2.5 forward (for) primer: 5′-CCAAGTGCTCTCCTGCTTTC; reverse (rev) primer: 5′GTCCAGCTCCACTGCCTTCT; Myl2 for: 5′-AAAGAGGCTCCAGGTCCAAT; rev: 5′-CTGGTCGATCTCCTCTTTGG; Tubulin for: 5′-CCGGACAGTGTGG CAACCAGATCGG; rev: 5′-TGGCCAAAAGGACCTGAGCGAACGG; Vcam1 for: 5′-GAACTGATTATCCAAGTCTCTCCA; rev: 5′-CCATGTCTCCTGTCTTT GCTT; Brachyury(T) for: 5′-GAACCTCGGATTCACATCGT; rev: 5′-TTCTTT GGCATCAAGGAAGG; Nox4 for: 5′-TGTTGGGCCTAGGATTGTGTT; rev: 5′-AGGGACCTTCTGTGATCCTCG; Oct4 for: 5′-GACCGCCCCAATGCCGTG AA; rev: 5′-GGGCTTTCATGTCCTGGGACTCC; Nanog for: 5′-CCTTCCCTC GCCATCACACTGACA; rev: 5′-GAGGAAGGGCGAGGAGAGGCAGC; Sox2 for: 5′-CAAGGCAGAGAAGAGAGTGTTTGCA; rev: 5′-GCCGCCGCGATTGTT GTGAT; Klf4 for: 5′-TTCTCCACGTTCGCGTCCGG; rev: 5′-ACGCCAACGGT TAGTCGGGGC. HIF-1α for: 5′-TGCTCATCAGTTGCCACTTC; rev: 5′-CCATC TGTGCCTTCATCTCA. Gene expression levels were evaluated by comparing differentiated cells to the corresponding undifferentiated cells. Data were analyzed using REST [19]. 2.4. Whole mount in situ hybridization Total RNA from Fgfr1+/− EBs at DD10 was reverse transcribed to cDNA and used as templates for PCR reactions using the following oligonucleotide primers: Myl2 for: 5′-GCCAAGAAGCGGATAGAAGG; rev: 5′-CTGTGGTTCAGGGCTCAGTC; Cdh5 for: 5′-TTTGGAATCAAATGCACA TCGA; rev: 5′-TGCTGTACTTGGTCATCCGGTT. Fragments were subcloned into pCR®II-TOPO® vector (inVitrogen). The plasmids were linearized and used as template for RNA synthesis with T7 or SP6 polymerase for antisense and sense control probes in the presence of digoxigenin-11-UTP by using DIG RNA labeling kit (Roche Diagnostics). At DD9 EBs were fixed overnight in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS), dehydrated with methanol 100% and stored at −20 °C until hybridization. Fixed EBs were rehydrated and rinsed twice in PBT (PBS, 0.1% Tween®20), then digested with proteinase K (10 μg/mL in PBT) for 15 min at room temperature, followed by incubation in 4% PFA in PBS for 20 min. EBs were subsequently rinsed twice in PBT for 5 min and pre-hybridized at 65 °C in hybridization mix (HM: 50% formamide, 5× SSC, 10 mM citric acid pH 6, 0.1% Tween® 20, 50μg/mL heparin, 50μg/mL tRNA) for 2h. EBs were then incubated overnight at 65°C in HM containing 1mg/mL of denatured riboprobe. On the second day, EBs were sequentially washed in 2× SSC containing 75%, 50%, 25%, and 0% of hybrizidation wash mix (50% formamide, 5× SSC, 10mM citric acid pH 6, 0.1% Tween® 20) at 65°C for 15min each, followed by three washes with 0.2× SSC at 65°C for 30min. EBs were then rinsed at room temperature with increasing concentration of PBT (25%, 50%, and 75% respectively) in 0.2× SSC, 10min each, incubated in blocking buffer (BB: 2% sheep serum, 2mg/mL BSA in PBT) for 3h, and immunodecorated overnight at 4 °C in BB containing 1:10,000 alkaline phosphatase-coupled anti-Digoxigenin antibody (Roche Diagnostics). On the following day EBs were extensively washed with PBT and the reaction was developed in staining solution [100 mM Tris HCl pH 9.5, 50 mM MgCl2, 100 mM NaCl, 0.1% Tween® 20, 500 mM Tetramisole, NBT and BCIP (Roche Diagnostics)]. Hybridized EBs were post-fixed for 20min in 4% PFA in PBS and subsequently dehydrated and included in paraffin. 7 μm sections were cut, mounted with DPX (Fluka), observed and photographed under a Zeiss Axiovert 200M microscope. 2.5. Immunostaining of EBs At DD9 EBs in suspension were fixed overnight in PBS-diluted 4% PFA, dehydrated with methanol and stored at −20°C until immunostaining. Fixed EBs were rinsed three times in Tris/HCl pH 8.2, 150 mM NaCl (TBS) and blocked in 3% Normal serum (determined by host species for secondary antibody) in TBS/TNB with 0,3% Triton-X (TBS++) for 2 h at room temperature. EBs were incubated with primary mouse anti-actin (α-sarcomeric) monoclonal antibody (Sigma Aldrich) in

142

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

TBS++ overnight at 4 °C in an orbital shaker. The following day, EBs were rinsed in TBS for three times, 15min each and incubated in TBS++ once for 1 h at room temperature. EBs were incubated with secondary goat FITC-conjugated anti-mouse IgM (μ-chain specific) (Sigma Aldrich). EBs were rinsed in TBS for three times, 15min each, washed in DAPI-containing TBS for 10min and rinsed four times in TBS 15min each. EBs were mounted with Dako Fluorescence Mounting Medium (DAKO) and then photographed under a Zeiss Axiovert 200M microscope. 2.6. Measurement of reactive oxygen species (ROS) content Intracellular ROS levels were measured using the fluorescent dye 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA) (Molecular Probes), a nonpolar compound that is converted into a nonfluorescent polar derivative (H2DCF) by cellular esterases after incorporation into cells. H2DCF is membrane impermeable and is rapidly oxidized to the highly fluorescent 2′,7′-DCF (DCF) in the presence of intracellular ROS [20]. For the experiments, EBs were washed in Hanks' Balanced Salt Solution (HBSS, GIBCO) and then incubated in nitrogen-saturated HBSS with 20μM H2DCF-DA dissolved in DMSO for 30min at 37°C 5%CO2. Then EBs were washed twice in HBSS, and separated into single-cell suspension by incubation for 10 min at 37°C in Accutase™ (Sigma Aldrich), rinsed 10min in fetal bovine serum, washed in HBSS and filtrated through a 40μm Cell Strainers (BD Biosciences). Intracellular DCF fluorescence, proportional to the amount of ROS, was evaluated by flow cytometry. 2.7. Superoxide dismutase (SOD) activity SOD activity was assayed in terms of its ability to inhibit the radical-mediated chain-propagating autoxidation of epinephrine [21]. EBs were collected and lysed on ice in HNTG buffer (50mM HEPES, 150mM NaCl, 1% Triton X-100, 10% glycerol) containing 1.5mM MgCl2, 1.0mM EGTA. After centrifugation to remove cellular debris, total protein content was assayed and 10μL of cell lysate was used for further analysis. Auto-oxidation of epinephrine was performed in buffer containing 0.05M glycine, 0.1M NaOH and 0.1M NaCl, at pH 10.3 in the presence or absence of sample or purified enzyme. The reaction was monitored in a 96-well plate reader by measuring the decrease of absorbance at 540nm, due to SOD-mediated inhibition of epinephrine oxidation. For the different samples, SOD units were normalized for total protein content and expressed as a percentage of SOD activity in undifferentiated mESC. 2.8. Western blot analysis Nuclear proteins were isolated from mESC using “Nuclear Extract Kit” (Active Motif) and quantified using a Bradford assay (Bio-Rad). Forty micrograms of nuclear-extracted proteins were denatured in sample buffer, boiled at 95 °C for 5 min, fractionated by 7% SDS polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride (PVDF) membrane (Immobilon-P, Millipore). In order to assess the uniformity of protein loading, membranes were stained with 1% amido black solution. Western blot analysis was performed using an anti-HIF-1α monoclonal antibody (clone H1α67, Millipore) followed by a HRP-conjugated goat anti-mouse secondary antibody incubation (Sigma-Aldrich). Immune complexes were visualized by incubating PVDF with Western Blot Luminol Reagent (Santa Cruz Biotechnology Inc.) containing 10% of chemiluminescence enhancer (Supersignal, Pierce) and exposing the membrane to X-ray film (Pierce). Quantification of the bands was performed using Image Analysis Software ImageJ 1.45s (NIH). Similar results were obtained by incubating the membrane with a secondary goat anti-mouse IRDye 800 CW conjugated antibody (LI-COR Bioscience), and quantifying the results using Odyssey® infrared scanner (LI-COR Bioscience).

3. Results 3.1. Ascorbic acid rescues beating foci formation in Fgfr1 −/− mESC Fgfr1 knockdown in the mESC model leads to a strong impairment in cardiomyocyte development [16]. Previous studies concerning cardiac differentiation had shown that various extrinsic factors promote in vitro cardiomyocyte differentiation of mESC, including growth factor peptides and a number of chemical compounds [22]. On this basis, Fgfr1 −/− mESC were subjected to a standard differentiation protocol in the presence of various chemicals known to be endowed with cardiogenic properties. In particular, Fgfr1 −/− mESC were treated at DD0 and DD2 with the synthetic nucleoside inhibitor of DNA methylation 5-azacitidine [23], the antioxidative agent vitC or its oxidized form DHA [13], the cyclic adenosine 3′,5′-monophosphate (cAMP) [24], the NO donors S-nitroso-N-acetylpenicillamine (SNAP) and 2-(N, N-diethylamino)-diazenolate-2-oxide (DEA) [25], the vitamin A active derivative retinoic acid (RA) [26], or the organosulfur compound DMSO [27]. Then, the appearance of beating foci in EBs was monitored daily and the results obtained at DD9 are shown in Fig. 1A. It is worth noting that the dose reported for each compound was chosen from preliminary dose–response experiments (data not shown). Among the compounds tested, only vitC treatment induced a significant increase in the appearance of beating foci in Fgfr1 −/− EBs, although with a lower extent when compared to Fgfr1 +/− EBs that spontaneously generate beating foci during differentiation. In a second set of experiments, increasing concentrations of vitC and of its oxidized form DHA were compared for their cardiomyogenic activity in Fgfr1−/− mESC. As shown in Fig. 1B, both compounds were able to rescue beating foci formation in a dose-dependent manner, with maximal stimulation at 30μM (80% rescue) and 100 μM (55% rescue) for vitC and DHA, respectively. In addition, a series of experiments in which Fgfr1−/− mESC were treated with vitC at different time points during the differentiation protocol showed that vitC administration at DD0 and DD2 of the differentiation protocol was necessary and sufficient to induce the appearance of beating foci in Fgfr1−/− EBs (data not shown). 3.2. Molecular analysis of vitC-treated Fgfr1 −/− EBs In order to confirm that the beating cells observed during differentiation of vitC-treated Fgfr1−/− mESC represent mature cardiomyocytes, we analyzed the expression of early transcriptional (Nkx2.5) and late structural (Myl2) cardiac gene markers. To this purpose, RNA was extracted at different time points and analyzed by real time quantitative PCR (qPCR). As shown in Fig. 2A, treatment of Fgfr1−/− mESC with 30μM vitC results in a significant upregulation of both Nkx2.5 and Myl2 expression in respect to untreated mESC, while the expression of the endothelial marker Vcam1 remains unchanged. qPCR results were confirmed by whole mount in situ hybridization experiments on EBs at DD9, probing the expression of the structural cardiac protein Myl2, and using the endothelial marker Cdh5 as an internal control (Fig. 2B). As expected, vitC treatment induces a significant increase of Myl2-positive areas in Fgfr1−/− EBs, while no modulation was observed for Cdh5 expression. Moreover, immunohistochemical analysis of vitC-treated Fgfr1−/− EBs shows a significant increase in the expression of the cardiac structural protein α-actin (Fig. 2B). Thus, vitC rescues cardiomyocyte formation during Fgfr1−/− mESC differentiation process. FGFR1 signaling plays important functions in mesoderm formation and development [28] and indeed, mesodermal genes are strongly upregulated in Fgfr1 −/− mESC [29]. In order to identify the target of vitC intervention, modulation of Brachyury(T) gene expression during the first phases of mESC differentiation was evaluated. As shown in Fig. 2C, vitC treatment of Fgfr1 −/− mESC slightly downregulates Brachyury(T), without bringing its expression back to the heterozygous level.

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

143

Fig. 1. Effect of several compounds on beating foci formation during Fgfr1−/− EBs differentiation. A. Fgfr1−/− mESC were stimulated at DD0 and DD2 with the indicated compounds and subjected to a standard differentiation protocol. The percentage of EBs with spontaneously contracting foci was counted at DD9 under an inverted microscope. Data represent the mean of at least three independent experiments. B. Fgfr1−/− mESC were stimulated at DD0 and DD2 with different doses of vitC and its oxidized form DHA. The percentage of EBs with spontaneously contracting foci was counted at DD9 under an inverted microscope. Data represent the mean of three independent experiments.

3.3. VitC as a modulator of intracellular redox state in Fgfr1 −/− mESC Ascorbic acid is an hormetic molecule acting as a strong antioxidant compound that reduces the oxidative indices after ischemia/reperfusion [30,31] or as a pro-oxidant molecule by generating cytotoxic amounts of H2O2 under defined experimental conditions [32,33]. Accumulating evidences point to an important role for ROS as signaling molecules during cardiomyocyte differentiation in mESC. Indeed, mechanical strain-induced cardiovascular differentiation depends on ROS generation [34] and low levels of hydrogen peroxide stimulate cardiomyogenesis of mESC [35]. On this basis, we assessed the possibility that vitC may rescue cardiomyocyte differentiation in Fgfr1 −/− mESC via modulation of the intracellular redox state. To this purpose, the levels of intracellular ROS and SOD activity were measured in differentiating EBs generated by Fgfr1 +/− and Fgfr1 −/− mESC in the absence or in the presence of vitC treatment. In a first set of experiments, mESC were labeled with the ROS-sensitive indicator H2DCF-DA and the generation of oxidized fluorescent DCF was monitored daily by flow cytometry until DD4. As shown in Table 1, a progressive enhancement of ROS formation was observed at DD3 and DD4 in both heterozygous and homozygous Fgfr1 knockout EBs, showing a higher increase at DD4 for Fgfr1−/− EBs in comparison with heterozygous cells. VitC addition to Fgfr1−/− mESC prevented such increase, thus suggesting that vitC acts as an antioxidant compound in the mESC system. To confirm these observations, ROS

levels were measured also in v-wt-hFGFR1 EBs in which cardiomyocyte development was rescued by FGFR1 lentiviral transduction in Fgfr1−/− mESC [36]. Again, an increment in ROS formation was observed from DD3, reaching values higher than those measured in Fgfr1−/− EBs at DD4. Thus, no relationship appears to exist between ROS levels and cardiomyogenic activity in mESC. The cellular levels of ROS are controlled by different enzymatic and non-enzymatic antioxidant systems. In particular, vitC modulates superoxide dismutase (SOD) activity [37]. Also, DCF dependent fluorescence may reflect relocation to the cytosol of lysosomal iron and/ or mitochondrial cytochrome c rather than intracellular ROS content [38]. On this basis, we measured the SOD activity of differentiating Fgfr1 +/− and Fgfr1 −/− EBs (Fig. 3A). Fgfr1 +/− EBs showed a progressive enhancement of SOD activity from DD2 until DD4, while no significant increment was observed in Fgfr1 −/− mESC. In agreement with previous observations [37], treatment of Fgfr1 −/− EBs with vitC downregulates intracellular SOD activity, thus confirming the antioxidant activity of vitC in this system. Again, these data suggest that mESC cardiomyogenesis is independent of the modulation of redox homeostasis. The ROS-generating NADPH oxidase Nox4 is the main Nox isoform expressed in mESC [39] and Nox4 expression is significantly elevated by vitC in mESC differentiated in low glucose medium [35]. As shown in Fig. 3B, Nox4 expression progressively increases during EBS differentiation of both Fgfr1 +/− and Fgfr1 −/− EBs, peaking at DD7 to decrease thereafter. Such increase was somehow reduced from DD4

Fig. 2. VitC-induced cardiomyocyte formation during differentiation of Fgfr1−/− mESC. A. qPCR analysis of the expression of lineage markers in EBs. Total RNA was extracted from Fgfr1+/−, Fgfr1−/− and vitC-treated Fgfr1−/− EBs at DD9. Equivalent amounts of cDNA were amplified by qPCR and gene expression levels were quantified using REST [19], by comparing differentiated cells to corresponding undifferentiated cells. Data are representative of at least two independent experiments. B. Cardiac marker expression in whole EBs. Fgfr1+/−, Fgfr1−/− and vitC-treated Fgfr1−/− EBs were collected at DD9 and subjected to either whole mount in situ hybridization using Myl2 and Cdh5 antisense probes or immunostained using an anti-α-actin antibody (ACTA1/ACTC1). C. Brachyury(T) expression during differentiation of EBs. Fgfr1+/−, Fgfr1−/− and vitC-treated Fgfr1−/− EBs were collected at different DD, total RNA was extracted, and retrotranscribed. Equivalent amounts of cDNA were amplified by qPCR and gene expression levels were quantified using REST [19], by comparing differentiated cells to corresponding undifferentiated cells. Data are representative of at least two independent experiments.

144

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

Table 1 Geo means of intracellular DCF fluorescence.

Fgfr1+/− Fgfr1−/− Fgfr1−/− +vitC v-wt-hFGFR1

DD2

DD3

DD4

12.8±2.1 11.4±2.3 10.3±1.3 9.6±1.9

15.5±1.7 14.7±1.1 10.7±1.3 14.8±1.3

13.8±1.8 16.6±1.5 11.3±1.2 17.0±1.1

Fgfr1+/−, Fgfr1−/−, vitC-treated Fgfr1−/−, and v-wt-hFGFR1 EBs were incubated with H2DCF-DA for 30 min at the indicated days of differentiation (DD). After extensive washing, EBs were separated into single cell suspension and intracellular DCF fluorescence was assayed by flow cytometry. The reported values represent intensity mean of two independent experiments.

onwards by vitC treatment of Fgfr1 −/− mESC, thus indicating the lack of any correlation between Nox4 expression and cardiomyocyte formation in mESC. Taken together, all the data point to the absence of a significant correlation between vitC modulation of intracellular redox state and cardiomyocyte formation during Fgfr1−/− mESC differentiation. Indeed, at variance with vitC and similar to the antioxidant retinoic acid (Fig. 1A), the antioxidant compounds vitamin E, sodium metabisulfite (Na2S2O5), N-acetylcysteine (NAC), and glutathione (GSH) were all unable to rescue cardiomyocyte formation in Fgfr1−/− EBs (Fig. 3C). Thus, the antioxidant activity of vitC does not appear to play any role in cardiomyocyte differentiation in Fgfr1−/− EBs.

3.4. VitC as a modulator of pluripotency genes in Fgfr1 −/− mESC Murine somatic cells can be reprogrammed to induced pluripotent stem cells (iPSC) by retrovirus-mediated transduction of defined transcription factors, including Oct3/4, Sox2, and Klf4, followed by selection for Fbx15 expression [40]. When compared to ES cells, these iPSC showed different gene expression and DNA methylation patterns and did not contribute to adult chimeras [40]. At variance, selection of transduced cells for Nanog rather than Fbx15 expression resulted in high-quality iPSC comparable to ES cells in terms of morphology, proliferation, teratoma formation, gene expression and competency for adult chimeras [41]. VitC treatment of porcine blastocysts upregulates the expression of Oct4, Sox2 and Klf4 [42], the latter acting as a transcriptional repressor of p53 [43]. Indeed, vitC enhances iPSC generation from both mouse and human somatic cells, acting, at least in part, by reducing p53 levels [44].

Previous observations had shown that Oct4 is properly downregulated in both Fgfr1+/− and Fgfr1−/− mESC at DD7 and later time points of differentiation [16]. Since vitC exerts its cardiomyogenic rescue action when administered during the very early phases of the differentiation process (DD0 and DD2), we analyzed by qPCR the expression of Oct4, Sox2, Klf4, and Nanog immediately for the first 48 after removal of LIF from the mESC culture medium and the data were compared to those measured in undifferentiated cells (Fig. 4). Undifferentiated Fgfr1+/− and Fgfr1−/− mESC express similar levels of Oct4 and Sox2 transcripts whereas Klf4 and Nanog mRNA content was approximately two-fold higher in Fgfr1−/− mESC (asterisks in Fig. 4), thus suggesting a modulation of their expression by Fgfr1 signaling. Following LIF removal, differentiating Fgfr1+/− mESC were characterized by the upregulation of Oct4 and Sox2 expression and the downregulation of Nanog and Kfl4 transcript levels, each gene showing specific kinetics of expression. When compared to Fgfr1+/− cells, differentiating Fgfr1−/− mESC showed similar kinetics of Oct4 expression but differed for the other genes investigated (higher transcript levels for Nanog and Klf4 and reduced levels for Sox2). However, vitC did not induce a pattern of gene expression in Fgfr1 −/− mESC similar to that observed in Fgfr1 +/− cells. Indeed, vitC treatment decreased the expression of Oct4 and Nanog in Fgfr1 −/− mESC at 24 h of differentiation with no significant effect on Sox2 and Kfl4, the latter gene being downregulated by vitC treatment only at 48 h. Similar results were obtained with a second, independent clone of Fgfr1 −/− mESC (data not shown). Next, we analyzed the impact of vitC on p53 levels in mESC. No differences in either p53 protein levels or in the expression of p53 target genes, such as Spp1 and GADD45, were detected following vitC treatment of Fgfr1 −/− EBs (data not shown). 3.5. VitC as a cofactor of prolyl hydroxylase in Fgfr1 −/− mESC Ferrous iron-dependent hydroxylation by prolyl hydroxylase (PHD) contributes to hypoxia inducible factor (HIF)-1α degradation in an oxygenate environment [45]. Previous observations have shown that vitC maintains the iron in a reduced state, thus acting as a PHD cofactor [46]. We examined HIF-1α levels in undifferentiated and vitC-treated mESC and found that Fgfr1−/− mESC have higher basal content of HIF-1α, as judged by both mRNA and nuclear protein content (Fig. 5A). In addition, a 24h vitC treatment of mESC slightly enhances HIF-1α nuclear immunoreactivity in both lines, independent of the presence of FGFR1 (Fig. 5A). Since the quantifications using either ImageJ (NIH) or

Fig. 3. VitC-mediated modulation of intracellular redox state. A. SOD activity. Fgfr1+/−, Fgfr1−/− and vitC-treated Fgfr1−/− EBs were collected at the indicated DD, lysed, and tested for their capacity to inhibit autoxidation of epinephrine. Data are expressed as percentage of SOD activity measured in undifferentiated cells. Data are representative of three independent experiments. B. qPCR analysis of Nox4 expression. Total RNA was extracted from Fgfr1+/−, Fgfr1−/− and vitC-treated Fgfr1−/− EBs at the indicated time points. Equivalent amounts of cDNA were amplified by qPCR and gene expression levels were quantified using REST [19], by comparing differentiated cells to corresponding undifferentiated cells. Data are representative of two independent experiments. C. Fgfr1−/− mESC were stimulated at DD0 and DD2 with the indicated compounds and subjected to a standard differentiation protocol. The percentage of EBs with spontaneously contracting foci was counted at DD9 under an inverted microscope. Data represent the mean of at least three independent experiments.

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

145

Fig. 4. VitC-induced pluripotent gene modulation during differentiation of Fgfr1−/− mESC. qPCR analysis of the expression of Oct4 (A), Nanog (B), Sox2 (C), and Klf4 (D). LIF was removed from culture medium and cells were stimulated or not with 50 μM vitC. Total RNA was extracted from Fgfr1+/−, Fgfr1−/− and vitC-treated Fgfr1−/− EBs at the indicated time points. Equivalent amounts of cDNA were amplified by qPCR and gene expression levels were quantified using REST [19], by comparing differentiated cells to Fgfr1+/− undifferentiated cells. Data are representative of at least two independent experiments. The relative mRNA levels in undifferentiated Fgfr1−/− mESC in respect to undifferentiated Fgfr1+/− mESC are represented by the asterisk on the Y axis.

the Odyssey® infrared imaging system (Li-Cor Bioscience) indicate a double amount of nuclear HIF-1α in Fgfr1−/− vs Fgfr1+/− mESC, we went further to elucidate this issue. We treated Fgfr1−/− mESC with the reduced form of iron (FeCl2) or CAY10585, an inhibitor of the accumulation and of the transcriptional activity of HIF-1α [17]. Treatments followed the

same schedule as vitC, starting at LIF removal and repeated two days later. Beating foci appearance was monitored daily and the results at DD9 demonstrate that, similar to vitC, both FeCl2 and CAY10585 rescue cardiomyocyte development in Fgfr1−/− EBs, as shown by the appearance of beating foci (Fig. 5A) and expression of cardiac gene markers (Fig. 5B).

Fig. 5. HIF-1α-related modulation of cardiomyocyte differentiation in Fgfr1−/− EBs. A. HIF-1α mRNA levels were assessed in undifferentiated mESC by qPCR analysis (upper panel), while nuclear HIF-1α protein was evaluated in heterozygous and homozygous mESC, following a 24 h treatment with 50 μM vitC (lower panel). The same result was obtained in three independent experiments B. Fgfr1−/− mESC were stimulated at DD0 and DD2 with the indicated compounds and subjected to a standard differentiation protocol. The percentage of EBs with spontaneously contracting foci was counted at DD9 under an inverted microscope. Data represent the mean of at least three independent experiments. C. qPCR analysis of the expression of lineage markers in EBs. Total RNA was extracted from Fgfr1+/−, Fgfr1−/−, FeCl2-, and CAY10585-treated Fgfr1−/− EBs at DD9. Equivalent amounts of cDNA were amplified by quantitative PCR and gene expression levels were quantified using REST [19], by comparing differentiated cells to the relative undifferentiated state. Data are representative of at least two independent experiments.

146

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

4. Discussion Embryonic stem cells are a powerful tool to study the impact of specific gene inactivation during development also for those loss-of-function mutations resulting in early embryonic lethality, such as FGFR1. The mechanism by which the absence of FGFR1 does not allow cardiomyocyte development in the mESC system is poorly understood. Previous observations from our laboratory had shown the impairment of early mesodermal gene expression in Fgfr1 −/− EBs at DD3/4 [29], followed by the lack of Nkx2.5 upregulation at DD5 [36], thus suggesting that FGFR1 is required within the first days of mESC differentiation. Various extrinsic factors can promote cardiogenesis in the mESC system, including a variety of chemical compounds with different, not fully characterized mechanisms of action [22]. In the present work various cardiomyocyte-enhancing molecules were assessed for their ability to rescue cardiomyocyte development in Fgfr1−/− mESC. The results demonstrate that, among the molecules tested, only vitC was able to restore beating foci appearance and cardiac gene expression at both mRNA and protein levels, thus indicating a functional recovery of cardiomyocyte development after Fgfr1 knockdown. The appearance of beating foci in Fgfr1−/− EBs could be obtained also by treatment with the oxidized form of vitC, DHA, although with a lower efficiency, probably due to its instability in solution [47]. It should be noticed that vitC can recover also the absence of cardiomyocyte differentiation in EphB4 knockout EBs [48], thus suggesting that the compound is acting downstream of both FGFR1 and EphB4, supposedly in a common pathway that leads to cardiomyocyte development. Although we did not observe any modulation of EphB4 expression in vitC-treated Fgfr1 −/− EBs (data not shown), transactivation between members of the FGFR and ephrin receptor families has been demonstrated following the direct contact between their cytoplasmic domains [49]. Further experiments are required to elucidate this issue. VitC is a multifaceted molecule acting as a cofactor in several enzymatic reactions [50,51]. In order to identify which of its properties is responsible for cardiomyocyte differentiation rescue in Fgfr1−/− EBs, we initially investigated the capacity of vitC to affect the intracellular redox state of mESC by evaluating the modulation of ROS content, SOD activity, and Nox4 expression. VitC treatment reduced all these parameters in Fgfr1−/− EBs, thereby suggesting that vitC can indeed affect the redox state of the mESC system. However, the different levels of ROS, SOD, and Nox4 measured in Fgfr1+/−, Fgfr1−/−, vitC-treated Fgfr1−/−, and hFGFR1-overexpressing Fgfr1−/− EBs did not correlate with their different cardiomyogenic ability during the differentiation process. These observations, together with the incapacity of various well-known antioxidant molecules to mimic the cardiomyogenic activity of vitC in Fgfr1−/− mESC, rule out the possibility that the antioxidant activity of vitC plays a role in mediating cardiomyocyte formation downstream of FGFR1. Next, we analyzed the hypothesis that vitC could overcome Fgfr1 loss-of-function through modulation of pluripotency genes and/or their main target protein p53. We showed that Fgfr1 knockout doubles the expression levels of Klf4 and Nanog in undifferentiated Fgfr1−/− mESC as compared to their heterozygous counterpart. Following LIF removal, differentiating Fgfr1+/− and Fgfr1−/− mESC showed a different pattern of expression of the pluripotency genes Nanog, Klf4 and Sox2 and a similar Oct4 expression. However, vitC did not restore a pattern of gene expression in Fgfr1−/− mESC similar to that observed in Fgfr1+/− cells. Thus, none of the differences in Oct4, Sox2, Kfl4, and/or Nanog expression observed between Fgfr1 +/− and Fgfr1 −/− mESC in the absence or in the presence of vitC treatment appears to parallel the reduced cardiomyogenic ability of Fgfr1−/− mESC and explain the cardiomyogenic rescuing capacity exerted by vitC in these cells. In addition, vitC treatment did not affect p53 protein levels and the expression of the p53 target genes Spp1 and GADD45 in Fgfr1−/− mESC (data not shown).

Our data indicate that the lack of cardiomyocyte development in Fgfr1 −/− EBs can be rescued by addition of vitC, Fe 2+, or the HIF-1α inhibitor CAY10585 during the first steps of the differentiation process. Of note, other divalent metals, such as cadmium, copper, or zinc, were ineffective (data not shown). Fgfr1 −/− mESC generate a large amount of mesodermal cells and vitC addition, that does not change significantly the expression of Brachyury(T), effectively allows the following differentiation of Nkx2.5 + cardiac progenitor cells. Further experiments using different models are required to elucidate this issue. Although these results do not rule out other mechanisms of action, our observations point to HIF-1α modulation as a crucial step in FGFR1-dependent cardiomyogenesis. To our knowledge, no correlations exist between the presence/activation of FGFR1 and HIF-1α level modulation, although it has been reported that HIF-1α is required for Nkx2.5 upregulation in Xenopus heart development [52] as well as Fgfr1 that is needed to upregulate Nkx2.5 in mESC [16]. Therefore, it is tempting to hypothesize that FGFR1 acts as a controller of HIF-1α level during the first phases of development, where hypoxia plays a fundamental role for heart formation [53]. The maintenance of a basal HIF-1α level in Fgfr1+/− mESC, possibly restored in Fgfr1−/− mESC by the increase of PHD activity or by HIF-1α inhibition, will allow the following boost necessary for Nkx2.5 upregulation in cardiovascular progenitor cells. 5. Conclusions In conclusion, our data demonstrate that vitC, FeCl2, and the HIF-1α inhibitor CAY10585 rescue cardiomyocyte differentiation due to the genetic defect of Fgfr1 −/− mESC. We extend previous observations about the cardiomyogenic properties of vitC and suggest that modulation of HIF-1α may mediate the effect of Fgfr1 on cardiomyogenesis during mESC differentiation. Acknowledgements We thank Daniel P. Stiehl-Braun, Patrizia Benzoni, Riccardo Ronzoni, German Andres, Stefania Mitola, Antonella Naldini, and Paolo Arosio for helpful discussion. This work was supported by grants from Fondazione Berlucchi, Ministero Istruzione Università e Ricerca, e Centro per lo Studio del Trattamento dello Scompenso Cardiaco (University of Brescia). References [1] C.J. Powers, S.W. McLeskey, A. Wellstein, Fibroblast growth factors, their receptors and signaling, Endocr. Relat. Cancer 7 (2000) 165–197. [2] M. Presta, P. Dell'Era, S. Mitola, E. Moroni, R. Ronca, M. Rusnati, Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis, Cytokine Growth Factor Rev. 16 (2005) 159–178. [3] D.E. Johnson, L.T. Williams, Structural and functional diversity in the FGF receptor multigene family [Review], Adv. Cancer Res. 60 (1993) 1–41. [4] A.N. Plotnikov, S.R. Hubbard, J. Schlessinger, M. Mohammadi, Crystal structures of two FGF–FGFR complexes reveal the determinants of ligand-receptor specificity, Cell 101 (2000) 413–424. [5] X. Xu, M. Weinstein, C. Li, C. Deng, Fibroblast growth factor receptors (FGFRs) and their roles in limb development, Cell Tissue Res. 296 (1999) 33–43. [6] T.P. Yamaguchi, K. Harpal, M. Henkemeyer, J. Rossant, fgfr-1 is required for embryonic growth and mesodermal patterning during mouse gastrulation, Genes Dev. 8 (1994) 3032–3044. [7] C.X. Deng, A. Wynshaw-Boris, M.M. Shen, C. Daugherty, D.M. Ornitz, P. Leder, Murine FGFR-1 is required for early postimplantation growth and axial organization, Genes Dev. 8 (1994) 3045–3057. [8] B.G. Ciruna, L. Schwartz, K. Harpal, T.P. Yamaguchi, J. Rossant, Chimeric analysis of fibroblast growth factor receptor-1 (Fgfr1) function: a role for FGFR1 in morphogenetic movement through the primitive streak, Development 124 (1997) 2829–2841. [9] C. Deng, M. Bedford, C. Li, X. Xu, X. Yang, J. Dunmore, P. Leder, Fibroblast growth factor receptor-1 (FGFR-1) is essential for normal neural tube and limb development, Dev. Biol. 185 (1997) 42–54. [10] I. Desbaillets, U. Ziegler, P. Groscurth, M. Gassmann, Embryoid bodies: an in vitro model of mouse embryogenesis, Exp. Physiol. 85 (2000) 645–651. [11] E. Kolossov, T. Bostani, W. Roell, M. Breitbach, F. Pillekamp, J.M. Nygren, P. Sasse, O. Rubenchik, J.W. Fries, D. Wenzel, C. Geisen, Y. Xia, Z. Lu, Y. Duan, R. Kettenhofen, S. Jovinge, W. Bloch, H. Bohlen, A. Welz, J. Hescheler, S.E. Jacobsen, B.K. Fleischmann,

E. Crescini et al. / Biochimica et Biophysica Acta 1833 (2013) 140–147

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20] [21]

[22] [23]

[24]

[25]

[26]

[27] [28]

[29] [30]

[31]

[32]

Engraftment of engineered ES cell-derived cardiomyocytes but not BM cells restores contractile function to the infarcted myocardium, J. Exp. Med. 203 (2006) 2315–2327. B.C. Heng, H. Haider, E.K. Sim, T. Cao, S.C. Ng, Strategies for directing the differentiation of stem cells into the cardiomyogenic lineage in vitro, Cardiovasc. Res. 62 (2004) 34–42. T. Takahashi, B. Lord, P.C. Schulze, R.M. Fryer, S.S. Sarang, S.R. Gullans, R.T. Lee, Ascorbic acid enhances differentiation of embryonic stem cells into cardiac myocytes, Circulation 107 (2003) 1912–1916. N. Cao, Z. Liu, Z. Chen, J. Wang, T. Chen, X. Zhao, Y. Ma, L. Qin, J. Kang, B. Wei, L. Wang, Y. Jin, H.T. Yang, Ascorbic acid enhances the cardiac differentiation of induced pluripotent stem cells through promoting the proliferation of cardiac progenitor cells, Cell Res. 22 (2011) 219–236. E.C. Martinez, J. Wang, S.U. Gan, R. Singh, C.N. Lee, T. Kofidis, Ascorbic acid improves embryonic cardiomyoblast cell survival and promotes vascularization in potential myocardial grafts in vivo, Tissue Eng. Part A 16 (2010) 1349–1361. P. Dell'Era, R. Ronca, L. Coco, S. Nicoli, M. Metra, M. Presta, Fibroblast growth factor receptor-1 is essential for in vitro cardiomyocyte development, Circ. Res. 93 (2003) 414–420. K. Lee, J.H. Lee, S.K. Boovanahalli, Y. Jin, M. Lee, X. Jin, J.H. Kim, Y.S. Hong, J.J. Lee, (Aryloxyacetylamino)benzoic acid analogues: a new class of hypoxia-inducible factor-1 inhibitors, J. Med. Chem. 50 (2007) 1675–1684. P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156–159. M.W. Pfaffl, G.W. Horgan, L. Dempfle, Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR, Nucleic Acids Res. 30 (2002) e36. K. Frenkel, C. Gleichauf, Hydrogen peroxide formation by cells treated with a tumor promoter, Free Radic. Res. Commun. 12–13 (Pt 2) (1991) 783–794. G. Cenini, G. Maccarinelli, C. Lanni, S.A. Bonini, G. Ferrari-Toninelli, S. Govoni, M. Racchi, D.A. Butterfield, M. Memo, D. Uberti, Wild type but not mutant APP is involved in protective adaptive responses against oxidants, Amino Acids 39 (2010) 271–283. K. Chen, L. Wu, Z.Z. Wang, Extrinsic regulation of cardiomyocyte differentiation of embryonic stem cells, J. Cell. Biochem. 104 (2008) 119–128. S. Makino, K. Fukuda, S. Miyoshi, F. Konishi, H. Kodama, J. Pan, M. Sano, T. Takahashi, S. Hori, H. Abe, J. Hata, A. Umezawa, S. Ogawa, Cardiomyocytes can be generated from marrow stromal cells in vitro, J. Clin. Invest. 103 (1999) 697–705. Y. Chen, J.Z. Shao, L.X. Xiang, J. Guo, Q.J. Zhou, X. Yao, L.C. Dai, Y.L. Lu, Cyclic adenosine 3′,5′-monophosphate induces differentiation of mouse embryonic stem cells into cardiomyocytes, Cell Biol. Int. 30 (2006) 301–307. S. Kanno, P.K. Kim, K. Sallam, J. Lei, T.R. Billiar, L.L. Shears II, Nitric oxide facilitates cardiomyogenesis in mouse embryonic stem cells, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 12277–12281. A.M. Wobus, G. Kaomei, J. Shan, M.C. Wellner, J. Rohwedel, G. Ji, B. Fleischmann, H.A. Katus, J. Hescheler, W.M. Franz, Retinoic acid accelerates embryonic stem cell-derived cardiac differentiation and enhances development of ventricular cardiomyocytes, J. Mol. Cell. Cardiol. 29 (1997) 1525–1539. C. Ventura, M. Maioli, Opioid peptide gene expression primes cardiogenesis in embryonal pluripotent stem cells, Circ. Res. 87 (2000) 189–194. X. Xu, C. Li, K. Takahashi, H.C. Slavkin, L. Shum, C.X. Deng, Murine fibroblast growth factor receptor 1alpha isoforms mediate node regression and are essential for posterior mesoderm development, Dev. Biol. 208 (1999) 293–306. G. Minchiotti, C. D'Aniello, R. Ronca, L. Gualandi, P. Dell'Era, Embryonic Stem Cells: The Hormonal Regulation of Pluripotency and Embryogenesis, Intech, 2011. V. De Tata, S. Brizzi, M. Saviozzi, A. Lazzarotti, V. Fierabracci, G. Malvaldi, A. Casini, Protective role of dehydroascorbate in rat liver ischemia–reperfusion injury, J. Surg. Res. 123 (2005) 215–221. M.O. Taha, H.S. Souza, C.A. Carvalho, D.J. Fagundes, M.J. Simoes, N.F. Novo, A. Caricati-Neto, Cytoprotective effects of ascorbic acid on the ischemia–reperfusion injury of rat liver, Transplant. Proc. 36 (2004) 296–300. N. Karasavvas, J.M. Carcamo, G. Stratis, D.W. Golde, Vitamin C protects HL60 and U266 cells from arsenic toxicity, Blood 105 (2005) 4004–4012.

147

[33] H. Sakagami, K. Satoh, Modulating factors of radical intensity and cytotoxic activity of ascorbate (review), Anticancer Res. 17 (1997) 3513–3520. [34] M. Schmelter, B. Ateghang, S. Helmig, M. Wartenberg, H. Sauer, Embryonic stem cells utilize reactive oxygen species as transducers of mechanical strain-induced cardiovascular differentiation, FASEB J. 20 (2006) 1182–1184. [35] F.L. Crespo, V.R. Sobrado, L. Gomez, A.M. Cervera, K.J. McCreath, Mitochondrial reactive oxygen species mediate cardiomyocyte formation from embryonic stem cells in high glucose, Stem Cells 28 (2010) 1132–1142. [36] R. Ronca, L. Gualandi, E. Crescini, S. Calza, M. Presta, P. Dell'Era, Fibroblast growth factor receptor-1 phosphorylation requirement for cardiomyocyte differentiation in murine embryonic stem cells, J. Cell. Mol. Med. 13 (2009) 1489–1498. [37] P.F. Kao, W.S. Lee, J.C. Liu, P. Chan, J.C. Tsai, Y.H. Hsu, W.Y. Chang, T.H. Cheng, S.S. Liao, Downregulation of superoxide dismutase activity and gene expression in cultured rat brain astrocytes after incubation with vitamin C, Pharmacology 69 (2003) 1–6. [38] M. Karlsson, T. Kurz, U.T. Brunk, S.E. Nilsson, C.I. Frennesson, What does the commonly used DCF test for oxidative stress really show? Biochem. J. 428 (2010) 183–190. [39] J. Li, M. Stouffs, L. Serrander, B. Banfi, E. Bettiol, Y. Charnay, K. Steger, K.H. Krause, M.E. Jaconi, The NADPH oxidase NOX4 drives cardiac differentiation: role in regulating cardiac transcription factors and MAP kinase activation, Mol. Biol. Cell 17 (2006) 3978–3988. [40] K. Takahashi, S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors, Cell 126 (2006) 663–676. [41] K. Okita, T. Ichisaka, S. Yamanaka, Generation of germline-competent induced pluripotent stem cells, Nature 448 (2007) 313–317. [42] Y. Huang, X. Tang, W. Xie, Y. Zhou, D. Li, J. Zhu, T. Yuan, L. Lai, D. Pang, H. Ouyang, Vitamin C enhances in vitro and in vivo development of porcine somatic cell nuclear transfer embryos, Biochem. Biophys. Res. Commun. 411 (2011) 397–401. [43] B.D. Rowland, R. Bernards, D.S. Peeper, The KLF4 tumour suppressor is a transcriptional repressor of p53 that acts as a context-dependent oncogene, Nat. Cell Biol. 7 (2005) 1074–1082. [44] M.A. Esteban, T. Wang, B. Qin, J. Yang, D. Qin, J. Cai, W. Li, Z. Weng, J. Chen, S. Ni, K. Chen, Y. Li, X. Liu, J. Xu, S. Zhang, F. Li, W. He, K. Labuda, Y. Song, A. Peterbauer, S. Wolbank, H. Redl, M. Zhong, D. Cai, L. Zeng, D. Pei, Vitamin C enhances the generation of mouse and human induced pluripotent stem cells, Cell Stem Cell 6 (2010) 71–79. [45] W.G. Kaelin Jr., P.J. Ratcliffe, Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway, Mol. Cell 30 (2008) 393–402. [46] J. Myllyharju, Prolyl 4-hydroxylases, key enzymes in the synthesis of collagens and regulation of the response to hypoxia, and their roles as treatment targets, Ann. Med. 40 (2008) 402–417. [47] J.M. May, Z.C. Qu, R.R. Whitesell, C.E. Cobb, Ascorbate recycling in human erythrocytes: role of GSH in reducing dehydroascorbate, Free Radic. Biol. Med. 20 (1996) 543–551. [48] K. Chen, H. Bai, M. Arzigian, Y.X. Gao, J. Bao, W.S. Wu, W.F. Shen, L. Wu, Z.Z. Wang, Endothelial cells regulate cardiomyocyte development from embryonic stem cells, J. Cell. Biochem. 111 (2010) 29–39. [49] H. Yokote, K. Fujita, X. Jing, T. Sawada, S. Liang, L. Yao, X. Yan, Y. Zhang, J. Schlessinger, K. Sakaguchi, Trans-activation of EphA4 and FGF receptors mediated by direct interactions between their cytoplasmic domains, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 18866–18871. [50] O. Arrigoni, M.C. De Tullio, Ascorbic acid: much more than just an antioxidant, Biochim. Biophys. Acta 1569 (2002) 1–9. [51] Q. Chen, M.G. Espey, M.C. Krishna, J.B. Mitchell, C.P. Corpe, G.R. Buettner, E. Shacter, M. Levine, Pharmacologic ascorbic acid concentrations selectively kill cancer cells: action as a pro-drug to deliver hydrogen peroxide to tissues, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 13604–13609. [52] K. Nagao, Y. Taniyama, T. Kietzmann, T. Doi, I. Komuro, R. Morishita, HIF-1alpha signaling upstream of NKX2.5 is required for cardiac development in Xenopus, J. Biol. Chem. 283 (2008) 11841–11849. [53] S.L. Dunwoodie, The role of hypoxia in development of the mammalian embryo, Dev. Cell 17 (2009) 755–773.