Brucella DNA is not detected in in-vitro produced embryos derived from ovaries of naturally infected buffaloes G. Neglia1, L. Zicarelli1, R. Di Palo1, E. Picillo2, L. Attanasio1, L. Boccia1, B. Gasparrini1, A. De Rosa1, T. Pepe1, A.E. Gravino2, G. Iovane4, C. Buonavoglia3, L. Manna2 1DISCIZIA,
Faculty of Veterinary Medicine, Federico II University, Naples, Italy
2Department 3Department 4Istituto
of Clinical Veterinary Sciences, Faculty of Veterinary Medicine, Federico II University, Naples, Italy
of Animal Health and Well-being, Faculty of Veterinary Medicine, University of Bari, Italy
Zooprofilattico Sperimentale del Mezzogiorno, Portici, Naples, Italy.
Corresponding author: Gianluca Neglia. DISCIZIA, Faculty of Veterinary Medicine, Federico II University, Via F. Delpino, 1, 80137 Naples, Italy – Tel. +390812536071 – Fax: +39081292981 – Email:
[email protected]
ABSTRACT: The aim of this study was to screen for Brucella spp. buffalo embryos produced in- vitro, by using cumulus oocytes complexes (COCs) recovered from ovaries of slaughtered buffaloes naturally infected with Brucella spp. Ovaries were collected from 5 female pluriparous buffaloes slaughtered in a local abattoir. EDTA-blood samples and nasal swabs collected from each animal were used for Brucella spp. DNA detection by real-time PCR. Buffalo ovaries (n = 10) were transported to the laboratory and maintained strictly separated throughout laboratory processing. Recovered COCs were matured, fertilized and cultured in vitro until day 7. Some immature COCs, all uncleaved COCs, all blocked cleaved embryos (2 to 16 cells) and all transferable embryos (tight morulae and blastocysts) were separately analysed by real-time PCR assay. Brucella spp. DNA was detected in both blood and nasal mucus of all subjects, whereas no trace of DNA of Brucella spp. was found on either COCs or embryos. Currently, the infected or seropositive buffaloes have to be slaughtered for sanitary reasons. Interestingly, the results of this preliminary trial suggest a possible utilization of the COCs from the infected subjects of high genetic value to obtain safe embryos. Key words: Buffalo, Brucellosis, Real–time PCR. INTRODUCTION – Since the advent in the late 1970s of successful cryopreservation and non-surgical embryo transfer great attention was given to the possible transmission of infectious diseases by embryos. This interest was even increased when the first calf was produced by in vitro embryo production technology (IVEP) (Brackett et al., 1982). Prior to ovulation, cumulus oocytes complexes (COCs) could be infected by infectious agents eventually present in either the ovarian cells or the follicular fluid (Bielanski, 1998). After fer-
900
Ital.J.Anim.Sci.
vol.
6, (Suppl. 2), 900-903, 2007
VIII World Buffalo Congress tilization those pathogens may be present in the embryonic cells or associated with the zona pellucida. In both cases, embryo transfer represents a serious risk at the sanitary level. Experimental information on the risk of pathogen transmission by in vitro produced embryos have been obtained by two approaches (Bielanski, 1998): the “in vivo-in vitro approach” (COCs collected from an infected or seropositive donor are fertilized in vitro with “clean” semen and assayed in vitro for infectious agents) and the “in vitro – in vitro approach” (COCs collected from a pathogen free and seronegative donor are exposed to infectious agents during the subsequent stages of the in vitro procedure and assayed in vitro for infectious agents). Several studies on viral pathogens, such as bovine herpes virus, bovine diarrhea virus, infectious bovine rhinotracheitis virus and blue tongue virus have been carried out (for reviews, see Bielanski, 1998; Philpott, 1994). However, only a little piece of information is available on bacterial pathogens transmission through embryos. In Italy, slaughtering of the infected animals is mandatory for some bacterial diseases (especially zoonoses) including brucellosis. In this case, apart from the loss of the animal, the major failure is represented by the loss of its genetic value. Stringfellow et al., (1986) demonstrated that preimplantation bovine embryos exposed in vitro to Brucella abortus do not show bacteria adherent to zona pellucida only after 10 sequential antibiotic-free washings. To our knowledge, similar studies have not been carried out in the buffalo species yet. The analytical sensitivity of molecular assay suggests its usefulness for the direct detection of Brucella spp. in clinical specimens. As described, the real-time multiplex PCR assay will permit the confirmation and quantification of bacterial DNA isolates as Brucella spp., within 2 to 3 h (Probert et al., 2004), whilst conventional methods for Brucella isolation and identification may take days to weeks to perform and often require the preparation of heavy suspensions of these highly infectious pathogens. Therefore, the aim of our study was to assess the sanitary status buffalo embryos produced in vitro, by using COCs recovered from ovaries of slaughtered buffaloes, which had tested naturally infected by Brucella spp. MATERIAL AND METHODS - The trial was carried out on 5 female pluriparous buffaloes naturally infected by Brucella spp. Brucella seropositive buffaloes were slaughtered in a local abattoir and ovaries were collected for further processing. EDTA-blood samples and nasal swabs were collected from each animal and used for Brucella spp. DNA detection by real-time PCR (see below). Buffalo ovaries (n=10), which were maintained strictly separated throughout laboratory processing, were delivered to the laboratory and COCs were recovered from small to medium size follicles (2 to 8 mm). Hence, COCs were matured in vitro according to previous studies (Gasparrini et al., 2006). The day after IVM the COCs were in vitro fertilized, by the sperm of a Brucella-free buffalo bull in the fertilization medium, a modified TALP supplemented with 0.2 mM penicillamine, 0.1 mM hypotaurine and 0.01 mM heparin. After 20-22 h of co-incubation with spermatozoa, presumptive zygotes were cultured in SOFaaBSA for 7 days in modulation chamber with a gas atmosphere of 5% CO2, 7% O2 and 88% N2. At day 5 (day 0 = IVF day) cleavage rate was assessed and embryos were transferred into fresh droplets of the same medium for further 2 days of culture, when final embryo output was evaluated. Some COCs recovered the day of IVM (3 for each animal), all uncleaved COCs assessed on day 5 of culture, all blocked cleaved embryos (2 to 16 cells) and all transferable embryos (tight morulae and blastocysts) were separately tested by realtime PCR assay for Brucella spp. DNA was extracted from embryos and oocytes by QIAamp Ital.J.Anim.Sci.
vol.
6, (Suppl. 2), 900-903, 2007
901
VIII World Buffalo Congress Blood Kit (Qiagen) according to the supplier’s instructions. The concentration and purity of extracted DNA were assessed by measuring spectrophotometrically the absorbance at 260 nm and 280 nm, respectively, and by gel electhrophoresis. Genus-specific primers-probe set assists in the identification of more Brucella species. TaqMan primers and probe for Brucella spp. DNA were showed in Table 1. Table 1.
Primers and probes for Brucella spp DNA and housekeeping β-actin genes. Forward primer
Reverse primer
Probe
Brucella spp.
5’- GCGCGTAAGGATGCAAACAT -3’
5’- CTTGCCTTTCAGGTCTGC -3’
5’- GGCTCATCCAGCGAAACG -3’
β-ACTIN
5’-CTGGCACCACACCTTCTACAA -3’
5’-GCCTCGGTCAGCAGCA -3’
5’-CCACGCGCAGCTCG -3’
Amplification was performed in 0.025 mL of reaction mixture containing 1X TaqMan Universal Master Mix (Applied Biosystems), 100 pmol/μL of the specific primer, 10 pmol/μL of the labelled probe, and 50 ng of DNA. The thermal cycling conditions included an initial incubation for 2 min at 50, followed by a 10 min denaturation at 95 °C, and 45 cycles at 95 °C for 15 s and 60 °C for 1 min each. Each amplification run contained a negative control. Each standard, each sample, and the negative control were analyzed in triplicate for each run. Serial 10-fold dilutions of a known amount (2*109 CFU) of Brucella purified DNA was utilized for standard curve preparation. The detection range for each set of primers and probe was 2*109 to 2*10 CFU. The standard curve, calculated by independent experiments, was linear over an at least 6-log range of DNA concentration points, with an average correlation coefficient of 0.988. The difference for each point of the curve was one log factor. To normalize for differences in efficiency of sample extraction, we used ß-actin, as housekeeping gene. For each experimental sample, the amount of target and housekeeping gene was determined from the appropriate standard curve. Then, the target DNA amount was divided by the housekeeping gene amount to obtain a normalized target value. Each of the normalized target values was divided by the calibrator normalized target value to generate relative expression levels. Statistical analysis was carried out by ANOVA. RESULTS AND CONCLUSIONS – Brucella spp. DNA was detected in at least one of the two samples (blood or nasal swabs) of all seropositive animals (Table 2). A total of 68 COCs were recovered and no trace of Brucella spp. DNA was detected in non-matured COCs, uncleaved COCs, blocked cleaved embryos and transferable embryos (Table 2). The number of animals used in this trial is very low and further studies are required to confirm our preliminary results. Currently, the infected or seropositive animals have to be slaughtered from sanitary reasons, leading to a great economic loss. The results of this preliminary trial suggest that an IVEP laboratory, in compliance with a molecular biology laboratory that is able to sensitively detect Brucella spp. DNA, may utilize the COCs from infected buffaloes of high genetic value for producing embryos. Further studies are needed in order to verify whether the molecular diagnosis by real time PCR on uncleaved COCs and blocked cleaved embryos may be correctly extrapolated to transferable embryos, or, otherwise, it may be performed on few cells of the transferable embryos.
902
Ital.J.Anim.Sci.
vol.
6, (Suppl. 2), 900-903, 2007
VIII World Buffalo Congress
Table 2.
Animal
1
Results of real-time PCR for Brucella spp. in blood, nasal swabs, oocytes (COCs) and in vitro produced embryos. Blood
Nasal swabs
Recovered COCs
NM
Uncl
Cl
Tr embryos
(CFU/µl)
(CFU/µl)
(n)
COCs
COCs
embryos
(TM + Bl)
1908
3450
(n)
(n) 2780
2 3
(n)
(n)
1502
3980
(n)
(n)
4 5
2145 (n)
(n)
564
4321
(n)
(n)
Total
11 18 13 18 8 68
(n)
(n)
(n)
(n)
NEG
NEG
NEG
NEG
(3)
(5)
(2)
(0+1)
NEG
NEG
NEG
NEG
(3)
(4)
(6)
(1+4)
NEG
NEG
NEG
NEG
(3)
(1)
(5)
(0+4)
NEG
NEG
NEG
NEG
(3)
(5)
(7)
(1+2)
NEG
NEG
NEG
N.P.
(3)
(3)
(2)
0
15
18
22
13
NM = Non matured; Uncl = Uncleaved; Cl = Cleaved; Tr = Transferable; NEG = Negative; N.P = Not performed
REFERENCES – Bielanski, A.B. 1998. Potential for disease control or transmission by embryos produced in vitro: a review of current literature. In Manual of the Embryo Transfer Society. Third Edition: 45-53. Brackett, BG., Bousquet, D., Boice, ML., Donawick, WJ., Evans, JF., Dressel, MA. 1982. Normal development following in vitro fertilization in the cow. Biol. Reprod. 27: 147-158. Gasparrini, B., Boccia L., Marchandise J., Di Palo R., George F., Donnay I., Zicarelli L. 2006. Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: effects of cystine on glutathione synthesis and embryo development. Theriogenology. 65:275-287. Philpott, M. 1994. The dangers of disease transmission by artificial insemination and embryo transfer. Br Vet J. 149: 339-69. Probert, W.S., Schrader, K.N., Khuong, N.Y., Bystrom, S.L., Graves, M.H. 2004. Real-time multiplex PCR assay for detection of Brucella spp, B. abortus and B. melitensis. J. Clin. Micr. 42: 1290-1293. Stringfellow, D.A., Wolfe, D.F., Lauerman, L.H., Sparling, P.H. 1986. Resistance of preimplantation bovine embryos to infection with Brucella abortus. Am J Vet Res. 47: 1924-1927.
Ital.J.Anim.Sci.
vol.
6, (Suppl. 2), 900-903, 2007
903
