ORIGINAL ARTICLE
CEACAM1, a Novel Serum Biomarker for Pancreatic Cancer Diane M. Simeone, MD,*Þ Baoan Ji, PhD,þ Mousumi Banerjee, PhD,§ Thiruvengadam Arumugam, PhD,þ Dawei Li, MD§ Michelle A. Anderson, MD,¶ Ann Marie Bamberger, MD,|| Joel Greenson, MD,** Randal E. Brand, MD,ÞÞ ViJaya Ramachandran, PhD,þ and Craig D. Logsdon, PhDþ,þþ Objectives: Serum biomarkers for early diagnosis of pancreatic adenocarcinoma are not currently available. We recently observed elevated expression of CEACAM1 in pancreatic adenocarcinomas and sought to determine whether serum CEACAM1 levels were elevated in pancreatic cancer patients. Methods: CEACAM1 messenger RNA levels were measured in pancreatic tissue samples using quantitative reverse transcriptionYpolymerase chain reaction. CEACAM1 was localized by immunohistochemistry in adenocarcinomas and in pancreatic intraductal neoplasia lesions. CEACAM1 serum levels were assessed by a double determinant enzyme-linked immunosorbent assay and compared with serum levels of CA19-9. Results: CEACAM1 had higher expression levels in pancreatic adenocarcinomas compared with noncancerous pancreas (P G 0.0001) and was localized to neoplastic cells (95% (45/47) of adenocarcinomas and 85% (17/20) of pancreatic intraductal neoplasia 3 lesions. CEACAM1 was expressed in the sera of 91% (74/81) of pancreatic cancer patients, 24% (15/61) of normal patients, and 66% (35/53) of patients with chronic pancreatitis, with a sensitivity and specificity superior to CA19-9. The combination of CEACAM1 and CA19-9 had significantly higher diagnostic accuracy than CA19-9. Conclusions: CEACAM1 is expressed in pancreatic adenocarcinoma, and serum levels of CEACAM1 serve as a useful indicator for the presence of pancreatic cancer. Additional validation studies on the use of serum CEACAM1 as a diagnostic marker in pancreatic cancer are warranted.
Received for publication August 15, 2006; accepted January 3, 2007. From the *Departments of Surgery and †Molecular and Integrative Physiology, University of Michigan, Ann Arbor, MI; ‡Department of Cancer Biology, MD Anderson Cancer Center, University of Texas, Houston, TX; §Departments of Biostatistics and ¶Department of Internal Medicine, University of Michigan, Ann Arbor, MI; ||Department of Clinical Chemistry, University of Hamburg, Hamburg, Germany; **Department of Pathology, University of Michigan, Ann Arbor, MI; ††Northwestern Healthcare, Evanston, IL; and ‡‡Department of Medical Oncology, MD Anderson Cancer Center, University of Texas, Houston, TX. D. M. Simeone and B. Ji contributed equally to the work. This work was supported by Michigan Economic Development grant (MEDC03-622, D.S. and C.L.), a National Cancer Institute-sponsored Early Detection Research Network Award (U01 CA84986, D.S.), and the Lustgarten Foundation (D.S.). Reprints: Diane M. Simeone, MD, University of Michigan Medical Center, TC 2922D, Box 0331, 1500 E Medical Center Dr, Ann Arbor, MI 48109 (e-mail:
[email protected]). Copyright * 2007 by Lippincott Williams & Wilkins
436
Key Words: pancreatic cancer, serum, biomarkers, CEACAM1, CA19-9, diagnosis Abbreviations: AUC - area under the curve, ROC - receiver operator characteristics (Pancreas 2007;34:436Y443)
A
denocarcinoma of the pancreas is currently the fourth leading cause of cancer-related death in the United States and has considerable economic and social impact.1 Pancreatic cancer remains generally incurable by available treatment modalities, with a 5-year survival rate of less than 3%. The lethality of this disease is largely because of late diagnosis and resistance to therapy. Unfortunately, effective early detection and screening are not currently available, and tumors are typically diagnosed at a late stage. The biomarker CA19-9 is currently used clinically to aid in diagnosis and to assess the effects of treatment of pancreatic cancer.2Y4 However, the sensitivity and specificity of this biomarker are not high, and serum levels are significantly increased in inflammatory diseases of the pancreas and biliary tract. Therefore, CA19-9 is not useful for early diagnosis, mass screening, distinguishing between adenocarcinoma and chronic pancreatitis, or for the targeting of therapeutics. Recently, several other serum biomarker candidates for pancreatic cancer have emerged from studies investigating genes or proteins differentially expressed in human pancreatic cancer, including osteopontin,5 macrophage inhibitory cytokine 1,6 MUC4,7,8 and hepatocarcinomaintestine-pancreas/pancreatitisYassociated protein 1.9 Other approaches have also been used to find pancreatic cancer biomarkers, including identifying circulating tumor antigens or their related autoantibodies,10,11 or serum profiling using mass spectrometry-based quantitative proteomics.12Y14 However, the clinical utility of these biomarkers remain to be determined, and many of these studies remain in the early discovery phase. For these reasons, there is a great need for continued work to discover new serum biomarkers for this disease. CEACAM1 (previously biliary glycoprotein 1) is a member of the human carcinoembryonic antigen (CEA) family. The CEA family consists of 29 genes randomly arranged on chromosome 19q13.2 that are classified into 2 major subfamilies, the CEACAM and the pregnancy-specific glycoprotein subgroups. The CEACAM subgroup members belong to the immunoglobulin superfamily of adhesion molecules. In normal tissues, CEACAM1 has a broad distribution, being Pancreas
& Volume 34, Number 4, May 2007
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Pancreas
& Volume 34, Number 4, May 2007
CEACAM1 Is a Pancreatic Cancer Serum Biomarker
expressed in a number of epithelia, including bile ducts as well as in monocytes, granulocytes, activated T cells, B cells, and a subset of natural killer cells.15 CEACAM1 is also a constituent of normal human bile and serum where it is found as a glycoprotein with a molecular weight of 90,000 d containing approximately 40% carbohydrate. In cancer, the expression of CEACAM1 has been demonstrated to be lower in tumor compared with normal tissue in cancers of the breast,16 colon,17,18 prostate,19 and endometrium,20 and to suppress tumorigenicity in breast and prostate cancer cells.21,22 Loss of CEACAM1 is also an adverse prognostic factor in hepatocellular carcinoma.23 In contrast, CEACAM1 expression is 24,25 and melanoma,26 and increased increased in lung cancer CEACAM1 expression is associated with tumor progression in these 2 cancer types. Recently, in microarray studies, CEACAM1 gene expression has been reported to be elevated in pancreatic adenocarcinoma compared with normal pancreas or chronic pancreatitis.27 In the current study, we verify the differential expression of CEACAM1 in human pancreatic adenocarcinoma compared with normal pancreas or samples of chronic pancreatitis and localize CEACAM1 expression to neoplastic epithelial cells within tumors indicating increased expression at the protein level. We also found that most pancreatic intraductal neoplasia 3 (PanIN-3) lesions, representing pancreatic carcinoma in situ, have elevated expression of CEACAM1, suggesting that it is expressed early in the development of the disease. Furthermore, we developed a sandwich enzyme-linked immunosorbent assay (ELISA) for CEACAM1 and used it to evaluate and compare CEACAM1 levels in sera from pancreatic cancer and sera from normal controls and patients with chronic pancreatitis. For comparison purposes, we also evaluated levels of CA19-9 and CEA in the same samples. We found that CEACAM1 was significantly elevated in the serum of a large proportion of patients with pancreatic adenocarcinoma and that the sensitivity and specificity of CEACAM1 are better than the other 2 biomarkers. Furthermore, used in conjunction with CA19-9, CEACAM1 has significantly higher diagnostic accuracy than either biomarker alone.
within the last 5 years. Sera were also obtained from 53 patients with chronic pancreatitis who were seen in the Gastroenterology Clinic at University of Michigan Medical Center and from 61 control healthy individuals collected at University of Michigan under the auspices of the Early Detection Research Network. The mean age of the tumor group was 65.4 years (range, 40Y89 years) and of the chronic pancreatitis group was 54 years (range, 40Y65 years). The sera from the normal subject group were age- and sexmatched to the tumor group. All sera were processed using identical procedures. The samples were permitted to sit at room temperature for a minimum of 30 minutes (and a maximum of 60 minutes) to allow the clot to form in the red top tubes, then centrifuged at 1300g at 4-C for 20 minutes. The serum was removed, transferred to a polypropylene, capped tube in 1-mL aliquots, and frozen. The frozen samples were stored at j70-C until assayed. All serum samples were labeled with a unique identifier to protect the confidentiality of the patient. None of the samples were thawed more than twice before analysis. Formalin-fixed paraffin-embedded tissue blocks were obtained from the archives of the Department of Pathology at University of Michigan Hospital.
MATERIALS AND METHODS
Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, Calif ) then cleaned on a RNeasy spin column (Qiagen Inc, Valencia, Calif ). The total RNA was reversed transcribed using AMV Reverse Transcriptase kit (Promega, Madison, Wis). Real-time polymerase chain reaction (PCR) was performed using specific primers for CEACAM1 (forward, AGCAACTGGACAGTTCCATGTATA; reverse, AGGTAGGTTGTGTCCTGAGTCT) and a specific Taqman probe (FAM-TGCCCAAGCCCTCCATCTCCAGC-BHQ-1). To correct for quantitative differences between samples and possible PCR artifacts, primers specific for RPS6 (forward, AAGGAGAGAAGGATATTCCTGGAC; reverse, AGAGAGATTGAAAAGTTTGCGGAT) and a Taqman primer (FAM-TGATACTACAGTGCCTCGCCGCCT-BHQ-1) were used as internal controls in each sample. RPS6 was proven to be expressed at the same levels in normal pancreas, pancreatitis, and pancreatic cancer when compared with the
Serum and Tissue Samples Serum and tumor tissue were obtained at the time of diagnosis after informed consent using Institutional Review BoardYapproved guidelines. A total of 81 serum samples were obtained from patients with a confirmed diagnosis of pancreatic adenocarcinoma who were seen in the Multidisciplinary Pancreatic Tumor Clinic at the University of Michigan Comprehensive Cancer Center and at Evanston Hospital. Inclusion criteria for the study included patients with a confirmed diagnosis of pancreatic cancer, the ability to provide written informed consent, and the ability to provide 40 mL of blood. Exclusion criteria included inability to provide informed consent, patients actively undergoing chemotherapy or radiation therapy for pancreatic cancer, and patients with other malignancies diagnosed or treated
Immunohistochemical Analysis A pancreatic cancer tissue microarray containing 5 samples of normal pancreas and 47 samples of pancreatic adenocarcinoma was used for immunohistochemical analysis of CEACAM1 expression. Twenty-five paraffin-embedded human pancreatic tissue samples containing PanIN lesions of varying stages were examined for CEACAM1 expression. Immunohistochemistry was performed on paraffin-embedded sections using the monoclonal antibody 4D1/C2, which does not cross-react with the CEA and different nonspecific crossreacting antigens.28,29 CEACAM1 expression in the pancreatic cancer tissue array and in PanIN lesions was evaluated in a blinded fashion by an experienced pancreatic pathologist (J.G.).
Quantitative Reverse TranscriptionYPolymerase Chain Reaction
* 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
437
Pancreas
Simeone et al
& Volume 34, Number 4, May 2007
20 KL, and RT was conducted for 60 minutes at 42-C. For standard PCR, 1 KL of the RT products were amplified by PCR using a hot start AmpliTaq Gold polymerase (Applied Biosystems, Bedford, Mass). Amplification was performed on a thermal cycler (Bio-Rad) for 40 cycles (denaturation, 20 seconds at 95-C; annealing and extension 1 minute at 60-C). The PCR products were separated on 1.8% agarose gels, and photomicrographs were taken of the ethidium bromideYstained gels.
Sandwich ELISA for CEACAM1 A sandwich ELISA was setup with a Protein Detector ELISA kit (KPL Inc, Gaithersburg, Md). Briefly, the affinitypurified CEACAM1 monoclonal antibody 4D1/C2 was coated to 96 well ELISA at a concentration of 1 Kg/mL overnight. Five microliters of patients’ sera with 95 KL of blocking buffer was added to the wells for 1 hour. After washing 3 times, a pan-CEA antibody (DAKO Corporation, Carpinteria, Calif ), which recognizes CEA, CEACAM1, and nonspecific cross-reacting antigen, was applied for another hour followed by washing. A horseradish peroxidaseYlabeled antibody that reacts with the pan-CEA antibody was then added and incubated for 1 hour and substrate was added after 5 washes. The plate was read with a plate reader at 405 nm. A GST-tagged CEACAM1 was expressed and purified from Escherichia coli and was used to make a standard curve.
Serological Concentrations of CA19-9 and CEA CA19-9 levels and CEA levels were measured in serum samples (100 and 50 KL, respectively) by commercially available ELISA kits (CA19-9; Panomic Inc, Fremont, Calif; CEA, Bio-quant Inc, San Diego, Calif ) according to manufacturer’s instructions.
Statistical Methods
FIGURE 1. A, Complementary DNA microarray analysis was performed using Affymetrix chips containing 6800 genes. Microdissected samples from pancreatic adenocarcinoma,10 chronic pancreatitis,5 and normal pancreas5 were analyzed. Messenger RNA expression levels of CEACAM1 were expressed as Affymetrix units. B, Validation of microarray results of CEACAM1 messenger RNA levels using quantitative RT-PCR. Total RNA was collected from samples of pancreatic adenocarcinoma,9 normal pancreas,10 and chronic pancreatitis6 and subjected to quantitative RT-PCR. RPS6 was used as an internal control for variance in loading. C, CEACAM1 immunostaining of a representative section of human pancreatic cancer. The arrow indicates staining of neoplastic epithelial cells.
criterion standard 18s rRNA. Briefly, 1 Kg of total RNA was denatured for 5 minutes at 70-C, cooled for 5 minutes on ice, then reverse transcriptase (RT) was added to a total volume of
438
Logistic regression was used to assess the significance of biomarkers in predicting pancreatic cancer versus normal controls or chronic pancreatitis. Univariate models were first examined to assess the individual significance of each biomarker. Multivariable logistic regression was then used to assess the significance of CEACAM1 in predicting pancreatic cancer, after adjusting for biomarker levels of CA19-9 and CEA. Receiver operating characteristics (ROCs) curves were constructed for each biomarker and combinations of the 3 biomarkers to assess the diagnostic accuracy of the biomarkers in distinguishing pancreatic cancer from normal controls or chronic pancreatitis. The area under the ROC curve (AUC) was used to compare between biomarkers
TABLE 1. Summary Measures of the Biomarkers Biomarker
Cancer (n = 81)
Normal Control (n = 61)
Chronic Pancreatitis (n = 53)
CA19-9 CEACAM1 CEA
72 (0Y4644.0) 29 (0Y140.0) 1.36 (0Y93.5)
0 (0Y31.0) 0 (0Y15.3) 0 (0Y52.8)
4.8 (0Y3072.8) 5 (0Y66.5) 5.9 (0Y53.9)
Values are given as median (range).
* 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Pancreas
& Volume 34, Number 4, May 2007
CEACAM1 Is a Pancreatic Cancer Serum Biomarker
FIGURE 2. A, Individual serum levels of CEACAM1 (left) and CA19-9 (right) in normal controls (N), pancreatic adenocarcinoma patients (CA), and patients with chronic pancreatitis (CP). B, Boxplot of CEACAM1 (A) and CA19-9 (B) serum levels for normal controls (N), pancreatic adenocarcinoma patients (CA), and patients with chronic pancreatitis (CP).
and determine the optimal combination of biomarkers for diagnostic purposes.
RESULTS CEACAM1 Expression Analysis As a strategy to identify potential serum biomarkers for pancreatic cancer, we conducted a study on molecular profiling on pancreatic cancer compared with normal pancreas and chronic pancreatitis in which we identified multiple genes that are differentially regulated in pancreatic cancer.27 Several of the genes identified as differentially expressed in pancreatic adenocarcinoma were known or deduced to likely represent secreted or cell surface proteins. One of these genes was CEACAM1, a member of the large family of CEAs. Previously, CEA was found not to be useful as a biomarker for pancreatic cancer because of its inability to discriminate between cancer and noncancer patients and its nonspecificity for pancreatic cancer.2 However, those studies used antibodies that cross-reacted with several members of this protein family. Our microarray results indicated that
CEACAM1, but not several other CEA proteins, was overexpressed specifically in 10/10 samples of pancreatic cancer, but not in samples of normal pancreas and chronic pancreatitis (Fig. 1A). We validated our microarray data by performing quantitative RT-PCR to measure messenger RNA levels for CEACAM1 in 9 samples of pancreatic adenocarcinoma, 10 samples of normal pancreas, and 6 samples of chronic pancreatitis. Quantitative RT-PCR demonstrated increased expression of CEACAM1 in pancreatic cancer,
TABLE 2. Logistic Regression Analyses to Predict Pancreatic Cancer Versus Normal Controls Unadjusted OR
Adjusted OR
Biomarker
Point Estimate
95% CI
Point Estimate
95% CI
CA19-9 CEACAM1 CEA
1.10 1.48 1.05
1.05Y1.15 1.23Y1.81 1.01Y1.10
1.07 1.36 0.99
1.01Y1.13 1.14Y1.63 0.92Y1.07
OR indicates odds ratio.
* 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
439
Simeone et al
Pancreas
& Volume 34, Number 4, May 2007
FIGURE 3. Receiver operator characteristic curves for the diagnosis of pancreatic adenocarcinomas versus noncancer samples. A, ROC curves comparing pancreatic adenocarcinoma to normal controls for CEACAM1 (AUC = 0.936), CA19-9 (AUC = 0.869), and CEA (AUC = 0.700). B, ROC curves comparing pancreatic adenocarcinoma to normal controls for combination CEACAM1 plus CA19-9 (AUC = 0.948), CEACAM1 (AUC = 0.936), and CA19-9 (AUC = 0.869). C, ROC curves comparing pancreatic adenocarcinomas to chronic pancreatitis for CEACAM1 (AUC = 0.752), CA19-9 (AUC = 0.724), and CEA (AUC = 0.662).
440
* 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Pancreas
& Volume 34, Number 4, May 2007
CEACAM1 Is a Pancreatic Cancer Serum Biomarker
with little/no expression in samples of normal pancreas and chronic pancreatitis (Fig. 1B). Using a pancreatic cancer tissue microarray containing 47 samples of pancreatic adenocarcinoma (n = 47), we found strong staining for CEACAM1 present in 45 of 47 samples, with CEACAM1 expression localized to the neoplastic epithelium (Fig. 1C, arrow). There was little/no staining in samples of chronic pancreatitis and normal pancreas (data not shown). These results confirm significant up-regulation of CEACAM1 levels in pancreatic adenocarcinoma.
CEACAM1 Sera Levels To specifically explore the potential of CEACAM1 as a serum biomarker for pancreatic cancer, we developed a sandwich ELISA using an antibody specific to CEACAM1 and with no cross-reactivity with other CEA family members.28,29 We measured CEACAM1 levels in 81 sera samples from patients with pancreatic adenocarcinoma, as well as in age- and sex-matched normal subjects (n = 61) and in 53 patients with chronic pancreatitis (Table 1). As a comparison, we also measured CA19-9 levels and CEA levels in the same sera samples. A plot of individual values for serum CEACAM1 and CA19-9 levels is shown in Figure 2A. The median serum CEACAM1 level was significantly higher in patients with pancreatic adenocarcinoma compared with normal healthy controls (P G 0.0001, Fig. 2B). For patients with pancreatic adenocarcinoma, the median CEACAM1 level was 29 ng/mL (range, 0Y140 ng/mL); for patients with chronic pancreatitis, the median was 5 ng/mL (range, 0Y66.5 ng/mL); and for normal controls, the median was 0 ng/mL (range, 0Y15.3 ng/mL). We used a cutoff level of 4.8 ng/mL for serum CEACAM1, which corresponded to 2 SD above the mean CEACAM1 level for normal controls. Of the 81 cancer samples, 69 had CEACAM1 levels above this cutoff, and 60 of the 61 normal samples were below this value. This corresponded to a sensitivity and specificity of elevated CEACAM1 in pancreatic cancer sera of 85% and 98%, respectively, with a 99% positive predictive value and a 83% negative predictive value. In comparison, using the standard cutoff of 37 units/mL, 53 of 81 patients had elevated CA19-9. All 3 biomarkers significantly predicted pancreatic cancer versus normal controls. The odds ratios for CEACAM1, CA19-9, and CEA based on univariate analyses were 1.48 (95% CI, 1.23Y1.81), 1.10 (95% CI, 1.05Y1.15), and 1.05 (95% CI, 1.01Y1.10) respectively (Table 2). Based on multivariable analysis, only CEACAM1 and CA19-9 independently predicted pancreatic cancer. Adjusted odds ratios for CEACAM1 and CA19-9 were 1.36 (95% CI, 1.14Y1.63) and 1.07 (95% CI, 1.01Y1.13), respectively (Table 2). Only CEACAM1 was significant in predicting pancreatic cancer versus chronic pancreatitis (odds ratio, 1.04; 95% CI, 1.02Y1.06). Neither CA19-9 nor CEA was significant in distinguishing pancreatic cancer from chronic pancreatitis.
Comparison of the Diagnostic Accuracy of Serum CEACAM1 and CA19-9 To evaluate the performance of CEACAM1 as a diagnostic test, ROC curves were generated by plotting
FIGURE 4. A, CEACAM1 expression in PanIN lesions. B, Photomicrograph of a PanIN-3 lesion demonstrating expression of CEACAM1.
sensitivity versus 1 j specificity for CEACAM1, CA19-9, and CEA. The AUC for CEACAM1 was 0.936, compared with 0.869 for CA19-9. Therefore, taken singly, CEACAM1 was better than CA19-9 in terms of diagnostic accuracy (P = 0.02) (Fig. 3A). As predicted, the AUC for CEA was low (0.700), demonstrating CEA to be far inferior to CEACAM1 or CA19-9 as a biomarker for pancreatic cancer. The AUC for the combination of CEACAM1 and CA19-9 was 0.948, with a P value of G0.05 compared with CA19-9 alone (Fig. 3B). ROC curves were also generated to compare the utility of CEACAM1 in differentiating sera samples of pancreatic cancer versus chronic pancreatitis (Fig. 3C). CEACAM1 was no better than CA19-9 in diagnostic accuracy, with an AUC of 0.752 for CEACAM1 compared with an AUC of 0.724 for CA19-9 (P value = 0.53). The combination of CEACAM1 and CA19-9 was not significantly different from CEACAM1 or CA19-9 alone in differentiating cancer from chronic pancreatitis (data not shown). Although the data support CEACAM1 as a potential novel biomarker for pancreatic cancer, the more important clinically relevant question is whether serum CEACAM1 measurements may be helpful in identifying patients with early stage disease. For a biomarker to be useful for the early detection of disease, it should be expressed early in the neoplastic process. A progression model of pancreatic cancer has become widely accepted, in which normal duct epithelium progresses to infiltrating cancer through a series of morphologically defined pancreatic cancer precursors named PanINs.30 Pancreatic intraductal neoplasia 1 lesions show hyperplasia without dysplasia, PanIN-2 lesions demonstrate dysplasia, and PanIN-3 lesions demonstrate severe nuclear atypia characteristic of carcinoma in situ. This progression is associated with the accumulation of specific genetic alterations such as K-ras mutation and inactivation of p16 and p53. To examine if increased expression of CEACAM1 occurs during pancreatic tumorigenesis, we examined CEACAM1 expression in PanIN lesions, as graded by a blinded pancreatic pathologist. CEACAM1 expression was observed in 1 of 11 PanIN-1 lesions (9%), 2 of 9 PanIN-2
* 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
441
Pancreas
Simeone et al
lesions (22%), and 17 of 20 PanIN-3 lesions (85%) (Fig. 4). These data suggest that CEACAM1 is overexpressed in a high percentage of pancreatic carcinoma in situ lesions and supports the possibility of CEACAM1 as a potential early stage biomarker.
DISCUSSION In this study, we demonstrate that CEACAM1 is overexpressed in human pancreatic adenocarcinomas, as measured by Affymetrix gene expression analysis and verified with quantitative RT-PCR and tissue array analysis. We also measured serum CEACAM1 to assess its potential as a new serum biomarker for pancreatic adenocarcinoma. The utility of CEACAM1 as a serum biomarker has not been previously explored in other malignancies. We demonstrated that CEACAM1 outperformed CA19-9, the current standard serum biomarker for pancreatic cancer. CEACAM1’s sensitivity (85%) compares favorably to the sensitivity of CA19-9 (65% using the 37 U/mL cutoff), and the specificity of CEACAM1 (98%) also compared well with the specificity of CA19-9. By ROC analysis, CEACAM1 (AUC, 0.936) outperformed CA19-9 (AUC, 0.869), and when both CEACAM1 and CA19-9 were used in combination, the results were even more favorable (AUC, 0.948) compared with using CA19-9 alone. Additional studies will need to be performed to assess whether CEACAM1 sera levels are elevated in other types of malignancies. The function of CEACAM1 in human pancreatic cancer remains unknown. In other cell types, CEACAM1 is a homophilic and heterophilic adhesion molecule and a regulator of signal transduction.31 In endothelial cells, CEACAM1 has angiogenic properties and acts as an effector of vascular endothelial growth factor.32 CEACAM1 interacts with cytoskeleton proteins and is expressed in high levels on the invading front of melanomas, suggesting that it may be important in tumor invasion.33,34 In addition, CEACAM1 has been shown to inhibit tumor cell lysis by natural killer cells35 and, therefore, may function not only by promoting tumorigenicity directly but also by altering the immune response to the tumor. The population of pancreatic cancer patients included in this study was primarily composed of patients with locally advanced, unresectable, or metastatic disease. A small number of sera samples from patients with early stage (stages 1 and 2) resectable disease were included (19 patients), however the numbers were inadequate to perform statistical analysis on the sensitivity and specificity of CEACAM compared with CA19-9 for early stage disease. Only CEACAM1 was significant in differentiating stage 1 or 2 pancreatic cancer from stage 3 or 4 pancreatic cancer (P value = 0.03). Neither CA19-9 nor CEA was significant in distinguishing stage 1 or 2 from stage 3 or 4 pancreatic cancer (P values = 0.62 and 0.49, respectively). To address the question of whether CEACAM1 might be a potential early detection biomarker, we examined CEACAM1 expression in PanIN lesions, preneoplastic lesions in the pancreas that give rise to pancreatic adenocarcinoma. We found that CEACAM1 was rarely expressed in PanIN-1 lesions, but expressed in 85% of PanIN-3 lesions, thought to
442
& Volume 34, Number 4, May 2007
represent carcinoma in situ. These data support the potential application of CEACAM1 in the detection of early disease. There is currently difficulty in testing potential early detection biomarkers on adequately sized reference sets of sera samples of patients with early pancreatic cancer, because few research centers have an adequately sized reference set of these sera samples from patients with early pancreatic cancer to allow meaningful statistical analysis. There is currently an initiative underway, under the directives of the Early Detection Research Network, a division of the National Cancer Institute, to create and make available such a reference set for pancreatic cancer biomarker studies. This type of initiative will be critical to allow validation of potential early disease biomarkers in pancreatic adenocarcinoma such as CEACAM1. Surprisingly, CEACAM1 was not able to differentiate sera samples from patients with pancreatic cancer from those with chronic pancreatitis, despite significant differences noted in CEACAM1 expression at the tissue level in these 2 disease states. One possible explanation is that CEACAM1 is expressed in biliary ductal epithelium and may have increased expression in the bile ducts that results in increased sera levels, either from peripancreatic inflammation or because of biliary obstruction secondary to fibrotic strictures. An alternative explanation is that the sandwich ELISA assay used to measure serum CEACAM1 levels does not adequately measure differences in posttranslation modification of the protein, such as differential glycosylation. CEACAM1 has been shown to demonstrate different glycosylation patterns in distinct cell types. 36,37 We are currently investigating this possibility by exploring whether CEACAM1 has altered glycosylation patterns in sera from patients with pancreatic adenocarcinoma compared with patients with chronic pancreatitis using a proteomics approach. In the event that CEACAM1 cannot differentiate pancreatic cancer from chronic pancreatitis, that does not preclude its utility as a potential biomarker. In this scenario, CEACAM1 could be used as a screening tool to select those individuals who do not have either disease, and a second screening test could be used to differentiate these 2 patient populations, such as endoscopic ultrasound with fine needle aspirate analysis. In summary, CEACAM1 is up-regulated in pancreatic cancer and is present in serum. CEACAM1 was more sensitive and specific than CA19-9 in differentiating cancer from normal controls, and this was improved upon by combining CEACAM1 and CA19-9. The presence of CEACAM1 in PanIN-3 lesions suggests it may be useful for early diagnosis. These results represent a phase 1 biomarker discovery study (see the work of Pepe et al38 for a review of phases of biomarker development for early detection of cancer) and the ultimate utility of CEACAM1 as a diagnostic marker for the early detection of pancreatic cancer, either alone or in combination with other biomarkers, will require validation studies with a blinded multicenter test set of early stage samples of pancreatic cancer. ACKNOWLEDGMENT We appreciate Dean Brenner’s thoughtful comments and helpful discussion. * 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Pancreas
& Volume 34, Number 4, May 2007
CEACAM1 Is a Pancreatic Cancer Serum Biomarker
REFERENCES 1. Jemal A, Murray T, Ward E, et al. Cancer statistics, 2005. CA Cancer J Clin. 2005;55:10Y30. 2. Niederau C, Grendell JH. Diagnosis of pancreatic cancer. Imaging studies and tumor markers. Pancreas. 1992;7(10):66Y86. 3. Steinberg W. The clinical utility of the Ca 19-9 tumorYassociated antigen. Am J Gastroenterol. 1990;85:350Y355. 4. DiMagno EP, Reber HA, Tempuro MA. AGA technical review on epidemiology, diagnosis, and treatment of pancreatic ductal adenocarcinoma. American Gastroenterological Association. Gastroenterology. 1999;117:1464Y1484. 5. Koopmann J, Fedarko NS, Jain A, et al. Evaluation of osteopontin as a biomarker for pancreatic cancer. Cancer Epidemiol Biomarkers Prev. 2004;13:487Y491. 6. Koopmann J, Buckhaults P, Brown DA, et al. Serum macrophage inhibitory cytokine 1 as a marker of pancreatic and other periampullary cancers. Clin Cancer Res. 2004;10:2386Y2392. 7. Swartz MJ, Batra SK, Varshney GC, et al. MUC4 expression increases progressively in pancreatic intraepithelial neoplasia. Am J Clin Pathol. 2002;117:791Y796. 8. Li XH, Xiong JX, Wang CY. Clinical significance of the expression of MUC4 mRNA in peripheral blood mononuclear cells of pancreatic cancer patients. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2005;27(5): 624Y627. 9. Rosty C, Christa L, Kuzdzal S, et al. Identification of hepatocarcinoma-intestine-pancreas/pancreatitisYassociated protein I as a biomarker for pancreatic ductal adenocarcinoma by protein chip technology. Cancer Res. 2002;62:1868Y1875. 10. Hong SH, Misek DE, Wang H, et al. An autoantibody-mediated immune response to calreticulin isoforms in pancreatic cancer. Cancer Res. 2004;64:5504Y5510. 11. Xia Q, Kong X-T, Zhang G-A, et al. Proteomics-based identification of DEAD-box protein 48 as a novel autoantigen, a prospective serum biomarker for pancreatic cancer. Biochem Biophys Res Commun. 2005;330:526Y532. 12. Koopmann J, Zhang Z, White N, et al. Serum diagnosis of pancreatic adenocarcinoma using surface-enhanced laser desorption and ionization mass spectrometry. Clin Cancer Res. 2004;10:860Y868. 13. Bhattacharyya S, Siegel ER, Peterson GM, et al. Diagnosis of pancreatic cancer using serum proteomic profiling. Neoplasia. 2004;6: 674Y686. 14. Yu Y, Chen S, Wang L-S, et al. Prediction of pancreatic cancer by serum biomarkers using surface-enhanced laser desorption/ionizationYbased decision tree classification. Oncology. 2005;68:79Y86. 15. Prall F, Nollau P, Neumaier M, et al. CD66a (BCP), an adhesion molecule of the carcinoembryonic antigen family, is expressed in epithelium, endothelium, and myeloid cells in a wide range of normal human tissues. J Histochem Cytochem. 1996;44:35Y41. 16. Riethdorf L, Lisboa BW, Henkel U, et al. Differential expression of CD66a (BGP), a cell adhesion molecule of the carcinoembryonic antigen family, in benign, premalignant, and malignant lesions of the human mammary gland. J Histochem Cytochem. 1997;45:957Y963. 17. Zhang L, Zhou W, Velculescu VE, et al. Gene expression profiles in normal and cancer cells. Science. 1997;276:1268Y1272. 18. Neumaier M, Paululet S, Chan A, et al. Biliary glycoprotein, a potential human adhesion molecule, is down-regulated in colorectal carcinomas. Proc Natl Acad Sci U S A. 1993;90:10744Y10748. 19. Kleinerman DI, Troncoso P, Lin SH, et al. Consistent expression of an epithelial cell adhesion molecule (C-CAM) during human prostate development and loss of expression in prostate cancer: implication as a tumor suppressor. Cancer Res. 1995;55:1215Y1220. 20. Bamberger AM, Riethdorf L, Nollau P, et al. Dysregulated expression of
21.
22.
23. 24. 25.
26. 27.
28.
29.
30. 31. 32. 33. 34. 35.
36. 37. 38.
CD66a (BGP, C-CAM), an adhesion molecule of the CEA family, in endometrial cancer. Am J Pathol. 1998;152:1401Y1406. Hsieh J-T, Luo W, Song W, et al. Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (C-CAM) in prostate carcinoma cells revealed by sense and anti-sense approaches. Cancer Res. 1995;55:190Y197. Luo W, Wood CG, Earley K, et al. Suppression of tumorigenicity of breast cancer cells by an epithelial adhesion molecule (C-CAM-1): the adhesion and growth suppression are mediated by different domains. Oncogene. 1997;14:1697Y1704. Cruz PV, Wakai T, Shirai Y, et al. Loss of carcinoembryonic antigen-related adhesion molecule 1 is an adverse prognostic factor in hepatocellular carcinoma. Cancer. 2005;104:354Y360. Laack E, Nikbakht H, Peter A, et al. Expression of CEACAM1 in adenocarcinoma of the lung: a factor of independent prognostic significance. J Clin Oncol. 2002;20:4279Y4284. Sienel W, Dango S, Woelfle U, et al. Elevated expression of carcinoembryonic antigen-related cell adhesion molecule 1 promotes progression of nonYsmall cell lung cancer. Clin Cancer Res. 2003;9:2260Y2266. Thies A, Moll I, Berger J, et al. CEACAM1 expression in cutaneous malignant melanoma predicts the development of metastatic disease. J Clin Oncol. 2002;20:2530Y2536. Logsdon CD, Simeone DM, Binkley C, et al. Molecular profiling of pancreatic adenocarcinoma and chronic pancreatitis identifies multiple genes differentially regulated in pancreatic cancer. Cancer Res. 2003;63:2649Y2657. Drzeniek Z, Lamerz R, Fenger U, et al. Identification of membrane antigens in granulocytes and colonic carcinoma cells by a monoclonal antibody specific for biliary glycoprotein, a member of the carcinoembryonic antigen family. Cancer Lett. 1991;56: 173Y179. Stoffel A, Neumaier M, Gaida F-J, et al. Monoclonal anti-domain and anti-peptide antibodies assign the molecular weight 160,000 granulocyte membrane antigen of the CD66 cluster to a mRNA species encoded by the biliary glycoprotein gene, a member of the carcinoembryonic antigen gene family. J Immunol. 1993;150:4978Y4984. Hruban RH, Adsay NV, Albores-Saavedra J, et al. Pancreatic intraepithelial neoplasms: a new nomenclature and classification system for pancreatic duct lesions. Am J Surg Pathol. 2001;25:579Y586. Plunkett TA, Ellis PA. CEACAM1: a marker with a difference or more of the same? J Clin Oncol. 2002;20:4273Y4275. Ergun S, Kilik N, Ziegeler G, et al. CEA-related cell adhesion molecule 1: a potent angiogenic factor and a major effector of vascular endothelial growth factor. Mol Cell. 2000;5:311Y320. Schumann D, Chen CJ, Kaplan B, et al. Carcinoembryonic antigen adhesion molecule 1 directly associates with cytoskeleton proteins actin and tropomyosin. J Biol Chem. 2001;276:47421Y47433. Brummer J, Ebrahimnejad A, Flayeh R, et al. cis interaction of the cell adhesion molecule CEACAM1 with integrin beta(3). Am J Pathol. 2001;159:537Y546. Markel G, Lieberman N, Katz G, et al. CD66a interactions between human melanoma and NK cells: a novel class I MHC-independent inhibitory mechanism of cytotoxicity. J Immunol. 2002;168: 2803Y2810. Stocks SC, Kerr MA. Neutrophil NCA-160 (CD66) is the major protein carrier of selectin binding carbohydrate groups LewisX and sialyl LewisX. Biochem Biophys Res Commun. 1993;195:478Y483. Lucka L, Fernando M, Grunow D, et al. Identification of Lewis x structures of the cell adhesion molecule CEACAM1 from human granulocytes. Glycobiology. 2005;15:87Y100. Pepe MS, Etzioni R, Feng Z, et al. Phases of biomarker development for early detection of cancer. J Natl Cancer Inst. 2001;93:1054Y1061.
* 2007 Lippincott Williams & Wilkins
Copyr ight © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
443
