STEM CELLS AND DEVELOPMENT 15:70–78 (2006) © Mary Ann Liebert, Inc.
Original Research Report Characterization of Serum-Free Ex Vivo–Expanded Hematopoietic Stem Cells Derived from Human Umbilical Cord Blood CD133 Cells CHAO-LING YAO,1 YIN-HSUN FENG,2 XI-ZHANG LIN,2 I-MING CHU,3 TZU-BOU HSIEH,1 and SHIAW-MIN HWANG1
ABSTRACT The development of ex vivo expansion of hematopoietic stem cells (HSCs) is a promising approach to restore the required bone marrow function of patients with hematological disorders. Previously, we have reported the development of an optimized serum-free and cytokines-limited defined medium using statistic methodology for umbilical cord blood-derived HSC expansion. The aim of this study was to analyze further the characteristics and functions of cells in vitro and in vivo when cultured in this defined medium. After a 7-day batch culture, the average absolute fold expansions for CD133 cells, CD34CD133 cells, CD34CD38 cells, CD133CD38 cells, CD34CXCR4 cells, CD133CXCR4 cells, and long-term culture-initiating cells were 21-, 20-, 723-, 618-, 160-, 384-, and 8-fold, respectively. The high enrichment of CD38 cells and CXCR4 cells of the CD34 subpopulation provided a very early uncommitted HSC proliferation and homing ability. Furthermore, the expanded cells showed a high level of telomerase activity to maintain their telomere length and repopulated the lethally irradiated NOD/SCID mice in vivo. These results indicated that the cytokineslimited expanded cells from CD133 cells could substantially support simultaneous expansion of various stem/progenitor cells and engraft with the expanded cells from a low number of HSCs initially. term culture, to express telomerase activity, and to engraft nonobese diabetic/severe combinated immunodeficiency (NOD/SCID) mice in vivo (5–10). Numerous studies have proposed many sets of cell-surface antigens to identify HSCs, such as CD34, CD133, CD38, and CXCR4. CD34 cell dose is an important prognostic factor of clinical HSC transplantation (11). Additionally, some studies have demonstrated that the CD34CD38 subpopulation cells contain more clonogenic cells that can repopulate NOD/SCID mice than CD34 cells (12–14). CD133 (formerly named AC133) is expressed mainly, but not exclusively, on CD34 cells, and CD34CD133 cells also show a higher content of colony-forming unit (CFU)-
INTRODUCTION
H
(UCB), collected from the postpartum placenta and cord, has been identified as a rich source of hematopoietic stem cells (HSCs), and provides an alternative to bone marrow (BM) or mobilized peripheral blood (MPB) transplantation (1,2). HSCs are defined by their capacities to selfrenew and the ability to differentiate into different hematopoietic cell lineages (3,4). However, unique markers specific to HSCs have not been identified. Empirically, HSCs are functionally assayed by their potential to produce hematopoietic colonies in vitro, to expand in longUMAN UMBILICAL CORD BLOOD
1Bioresource
Collection and Research Center, Food Industry Research and Development Institute, Hsinchu, Taiwan. of Clinical Medicine, School of Medicine, National Cheng Kung University, Tainan, Taiwan. 3Department of Chemical Engineering, National Tsing-Hua University, Hsinchu, Taiwan. 2Institute
70
CHARACTERIZATION OF EX VIVO–EXPANDED HSCs Mix and NOD/SCID repopulating cells than CD34 cells (15–17). The expression of CXCR4, stromal cell-derived factor-1 receptor, is critical for HSC homing and repopulation (18). Even if HSCs can be maintained and expanded in culture, engraftment defects still occur if the HSCs cannot home to BM efficiently (19,20). UCB transplantation has been used for treatment of hematologic disorders, congenital immunodeficiencies, metabolic disorders, and autoimmune diseases (21,22). The transplantation of unmanipulated UCB cells has two major disadvantages: (1) the low number of HSCs in each UCB unit limits its application to children, and (2) neutrophil and platelets in UCB engraftment patients have a longer recovery time than in BM or MPB (1,2,21,22). Ex vivo expansion of the UCB HSCs may solve the above shortages, and is an important issue for clinical purposes (23,24). We have reported a serum-free and stroma-free medium (SF-HSC medium) for expanding HSCs based on isolated CD133 cells from UCB (25). The HSC serum-free expansion medium was developed using a systematic and statistic methodology, and contained an optimal cytokinelimited cocktail formulation. After a 7-day batch culture, the number of CD34 cells and colony-forming cells could increase 27- and 22-fold, respectively. Here we report not only CD34 cells and colony-forming cells but also CD133 cells, CD34CD38 cells, CD34CD133 cells, CD34CXCR4 cells, CD133CXCR4 cells, long-term culture-initiating cells (LTC-ICs), and G0/G1phase cells were highly expanded in HSC serum-free expansion medium. Importantly, the expanded cells showed a high level of telomerase activity to maintain their telomere length and had the ability to repopulate NOD/SCID mice. These experimental results further demonstrated that UCB HSCs could be functionally expanded in the HSC serum-free expansion medium and should be beneficial to patients who require UCB HSCs transplantation.
were incubated for 30 min at 4°C with human immunoglobulin G (IgG), to block the Fc receptors, and human CD133 microbeads (Miltenyi Biotec). Labeled cells were passed through a magnetic column (Miltenyi Biotec) retained in a magnetic field. Unbound cells were washed out, and CD133 cells were recovered by releasing the magnetic field and eluted from the column. Cells were passed through a second column to achieve a purity 90%. Cell-surface antigen expression, cell cycle, LTC-ICs, telomerase activity, telomere length, and NOD/SCID repopulating cells were determined as day 0 for control.
Ex vivo expansion To expand cells, CD133 cells (5 104/ml) were culture in 24-well plates with SF-HSC medium that was developed previously (25). The SF-HSC medium was composed of Iscove’s modified Dulbecco’s medium (IMDM) contained a cytokine-limited cocktail consisting of 8.46 ng/ml thrombopoietin (TPO), 4.09 ng/ml interleukin-3 (IL-3), 15 ng/ml stem cell factor (SCF), 6.73 ng/ml flk2/flt3 ligand (FL), 0.78 ng/ml IL-6, 3.17 ng/ml granulocyte colony-stimulating factor (G-CSF), and 1.30 ng/ml granulocyte-macrophage (GM)-CSF (all recombinant human cytokines were purchased from PeproTech EC Ltd, London, UK), and serum substitutes (1.5 g/L bovine serum albumin (BSA; Sigma, St. Louis, MO), 4.39 g/ml human insulin (Sigma), 60 g/ml human transferrin (GIBCO BRL, Carlsbad, CA), and 25.94 M 2-mercaptoethanol (GIBCO BRL). After 7 days of culture, the cells were analyzed to compare with the day 0 control (all experiments were repeated at least six times).
Flow cytometry analysis of surface antigen expression and cell cycle Before and after expanding culture, cells were analyzed by two-color flow cytometry on a FACSCalibur analyzer with CellQuest software (Becton-Dickinson, San Jose, CA). Cells were stained with fluorescein isothiocyanate (FITC)-conjugated anti-human CD34 (Miltenyi Biotec), CD45 (Miltenyi Biotec), CD38 (Becton-Dickinson) or CXCR4 (Becton-Dickinson), and phycoerythrin (PE)conjugated anti-human CD34 (Miltenyi Biotec) or CD133 (Miltenyi Biotec). A replicate sample was stained with FITC-mouse IgG1 and PE-mouse IgG1 as an isotype control to ensure specificity. Cell cycle was analyzed using propidium iodide (PI; Sigma) staining on FACSCalibur analyzer with ModFit LT software (Becton-Dickinson).
MATERIALS AND METHODS Cell preparation The term UCB was harvested in a standard 250-ml blood bag (Terumo, Shibuya-ku, Tokyo, Japan) with informed consent and processed within 24 h. Buffy-coat cells were obtained from UCB by centrifugation. Mononuclear cells (MNCs) were collected after the buffy-coat cells were layered onto Ficoll-Paque solution (d 1.077 g/ml; Amersham Biosciences, Uppsala, Sweden) and centrifuged to deplete red blood cells, platelets, and plasma. The CD133 fraction was isolated with immunomagnetic selection on Miltenyi VarioMACS devices (Miltenyi Biotec, Bergisch Gladach, Germany), according to the manufacturer’s instruction. Briefly, MNCs
LTC-IC assay The murine fibroblast cell line M2–10B4 (BCRC 60228, Bioresource Collection and Research Center, 71
YAO ET AL. Hsinchu, Taiwan) was used as feeder layer. One day before initiation of co-culture with human cells, M2-10B4 cells were incubated with 20 g/ml mitomycin C (Sigma) for 3 h (26), trypsinized, and seeded into gelatin-coated 24-well plates (7.5 104/well). Cells both before and after ex vivo expansion (5 105 cells) were plated in eight replicate wells with M2-10B4 cells as feeder layer in 1 ml of Myelocult H5100 (StemCell Technologies, Vancouver, BC, Canada) supplemented with 106 M hydrocortisone (Sigma). The plates were incubated at 37°C, 5% CO2 for 5 weeks. At weekly intervals, half the culture medium was removed and replaced with fresh culture medium. At the end of the culture period, total cells were plated in semisolid culture (MethoCult GF H4434, StemCell Technologies) following the manufacturer’s instruction for CFU assay. The cells were seeded at suitable concentration (to give 100 colonies per 1 ml of culture) and incubated at 37°C in an atmosphere of 5% CO2 and humidified incubator. After 14 days culture, burst-forming unit-erythroid (BFU-E), CFU-GM, and CFU-granulocyte/erythroid/macrophage/megakaryocyte (GEMM) were scored under inverted microscope.
The membrane-bonded fragments were hybridized with a telomere specific digoxigenin (DIG)-labeled probe, incubated with anti-DIG alkalinephosphatase, and detected by chemiluminescence. The blotted signal was divided into 30 equidistant intervals from 1.9 to 21.2 kb to calculate mTRF by densitometer.
In Vivo repopulation assay in NOD/SCID mice NOD/SCID mice were maintained and used in accordance with animal law regulations and guidelines for animal care and experimentation established by the Council of Agriculture, Taiwan, and National Cheng Kung University and Hospital, Taiwan. Eight-week-old NOD/SCID mice were irradiated with 400 cGy using a linear accelerator source (27). The irradiated NOD/SCID mice were injected via tail vein with total 5 105 cells per mouse by either freshly purified CD133 cells or the expanded cells after 7-day culture in the SF-HSC medium. Control mice were injected with Dulbecco’s phosphate buffered saline (D-PBS; Sigma) only. Transplanted mice were sacrificed at week 6, and BM cells were obtained by flushing their femurs and tibias with D-PBS. Flow cytometric analysis of NOD/SCID mice BM cells was performed, using human monoclonal antibodies (CD34 and CD45) to analyze the percentage of engrafted human cells. For histological analysis, the femoral bones of NOD/SCID mice were harvested and immediately fixed in neutral buffered formalin (Sigma) overnight, and then decalcified with the formic acid-sodium citrate method. Whole-mount preparations of tissues were paraffin-embedded, sectioned at 5 m, and stained with Mayer’s Hematoxylin & Eosin B-phloxine (Sigma).
Telomerase and mean telomere length assay Total cellular RNA was extracted from 1 106 freshly purified CD133 cells or expanded cells using Trizol Reagent (Molecular Research Center Inc, Cincinnati, OH) according to the manufacturer’s instructions. The mRNA was reversely transcribed to cDNA, and specific cDNA was amplified by using OneStep RT-PCR kit (Qiagen, Valencia, CA) following the manufacturer’s protocol. The gene-specific primer sets were as follows: -actin (forward: TGGCACCACACCTTCTACAATGAGC, reverse: GCACAGCTTCTCCTTAAGTGCACGC). HTERT (forward: GTGTGCTGCAGCTCCCATTTC, reverse: GCTGCGTCTGGGCTGTCC). Thirty-five cycles were used for cDNA amplification, and consisted of a 1-min denaturation at 94°C, 1 min annealing (human telomerase reverse transcriptase, HTERT) at 60°C, and -actin (internal control) at 56°C, 1 min polymerization at 72°C, and a final 10 min extension at 72°C. Telomerase activity was determined using the TRAPEZE Telomerase Detection kit (Intergen, Purchase, NY) according to the manufacturer’s instructions. Genomic DNA of CD133 cells or expanded cells were isolated by DNAzol (Molecular Research Center Inc) at different time points. Mean length of terminal restriction fragment (mTRF) was measured using the TeloTTAGGG Telomere Length assay kit (Roche Molecular Biochemical, Indianapolis, IN) according to the manufacturer’s protocol. Briefly, 2 g of purified DNA was digested with a HinfI and RsaI enzyme mixture for 2 h at 37°C, separated on 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche).
Statistical analysis Results of multiple experiments were expressed as the mean standard error of the mean. Data were analyzed using a two-tailed paired Student’s t-test. Probability values 0.05 designated significant differences between test points.
RESULTS Immunophenotyping analysis and LTC-IC assay of freshly purified CD133 cells and their expanded cells in the SF-HSC medium Over 50 units of UCB were isolated. Flow cytometry and the LTC-IC assay were performed with freshly purified CD133 cells or 7-day expanded cells in the SFHSC medium. After CD133-microbeads isolation, the fractions of CD34 cells, CD133 cells, CD34CD133 72
CHARACTERIZATION OF EX VIVO–EXPANDED HSCs cells, CD34CD38 cells, CD133CD38 cells, CD34CXCR4 cells, CD133CXCR4 cells, and LTC-ICs in isolated cells were 96.4 3.2%, 95.4 2.9%, 94.8 2.6%, 2.0 0.2%, 1.9 0.2%, 4.2 0.3%, 2.5 0.2%, and 6.4 0.5%, respectively. A typical analysis is shown in Fig. 1. More than 99% of the CD34 cells co-expressed the CD133 surface antigen. Before culture, the initial cell density was 5 104 cells/ml in the 24-well plate, and we have demonstrated that the batch cell density of the CD34 cells reached the maximum on the seventh day in the SF-HSC medium (25). At the end of 7-day batch culture in the SF-HSC medium, the total cell density had increased to 3.18 0.29 106 cells/ml, and the fractions of CD34 cells, CD133 cells, CD34CD133 cells, CD34CD38 cells, CD133CD38 cells, CD34CXCR4 cells, CD133CXCR4 cells, and LTC-ICs in totally expanded cells were 42.0 2.6%, 30.4 2.1%, 29.4 2.0%, 22.0 1.8%, 18.4 1.6%, 10.1 1.0%, 14.7 1.3%, and 0.8 0.1%, respectively (Fig. 1). The absolute fold expansions for CD34 cells, CD133, CD34CD133 cells, CD34CD38 cells, CD133CD38 cells, CD34CXCR4 cells, CD133CXCR4 cells, and LTC-ICs were 27-, 21-, 20-, 723-, 618-, 160-, 384-, and 8-fold, respectively.
A
B
C
Cell cycle analysis of freshly purified CD133 cells and their expanded cells in the SF-HSC medium
D
Flow cytometry was performed for cell cycle analysis of the freshly purified CD133 cells or 7-day expanded cells in the SF-HSC medium using ModFit LT software. After CD133-microbeads isolation, the fractions of freshly purified CD133 cells in the G0/G1 phase, S phase, and G2/M phase of the cell cycle were 98.5 3.1%, 0.7 0.2%, and 0.8 0.2%, respectively (Table 1). After 3 days of culture in the SF-HSC medium, the fraction of G0/G1 cells decreased to 59.8 2.5% at the third day, which meant the quiescent cells were growing. However, after 7 days of culture in the SF-HSC medium, the fraction of G0/G1 cells increased due to medium starvation in the batch culture, and the fractions of totally expanded cells in the G0/G1 phase, S phase, and G2/M phase of cell cycle were 80.4 3.0%, 3.1 0.4%, and 16.5 1.1%, respectively (Table 1). Moreover, the number of cells in the G0/G1 phase, S phase, and G2/M phase were expanded 53-, 310, and 1547-fold at the end of 7 days of batch culture in the SF-HSC medium, respectively.
E
FIG. 1. Flow cytometry analysis of surface antigen expression of CD133cells before and after ex vivo expansion in the SF-HSC medium. Fresh CD133cells isolated from MNCs and their total expanding cells for 7-day culture in the SF-HSC medium were shown at the left and right of each figure, respectively. The numbers within dot plots indicated the percentage of total cells that fell within the particular quadrant. (A) CD34-FITC and CD133-PE. (B) CD38-FITC and CD34-PE. (C) CXCR4-FITC and CD34-PE. (D) CD38-FITC and CD133PE. (E) CXCR4-FITC and CD133-PE.
Telomerase and mean telomere length assay The activity of telomerase that can maintain telomere length throughout many cycles of cell division has been detected weakly in HSCs, but not in other somatic cells. 73
YAO ET AL. TABLE 1.
FLOW CYTOMETRY ANALYSIS
OF
CELL CYCLE
IN
CULTURE 7 days
Cell cycle phase G0/G1 S G2/M
0 days (%)
3 days (%)
(%)
Expansion fold
98.5 3.1% 0.7 0.2% 0.8 0.2%
59.8 2.5% 4.8 0.6% 35.4 1.5%
80.4 3.0% 3.1 0.4% 16.5 1.1%
53-fold 310-fold 1547-fold
The cell density in each starting culture was 5 105 cells/ml. After 7-day culture in SF-HSC medium, the total cell density was 3.3 106 cells/ml.
A
In this study, the telomerase gene expression, telomerase activity, and telomere length of CD133 cells before and after ex vivo expansion were shown in Fig. 2. The freshly purified CD133 cells showed a low-level telomerase gene (HTERT) expression and telomerase activity (day 0). The mean telomere length of fresh CD133 cells was 13.3 0.5 kb. When the cells began to proliferate at the third day in the SF-HSC medium, however, both telomerase gene expression and telomerase activity became obvious, and the mean telomere length of the expanded cells was maintained at 13.8 0.4 kb. At the end of 7-day batch culture, results indicated that the expanded cells had a high level of telomerase gene expression and telomerase activity. The mean telomere length of the expanded cells was 14.1 0.5 kb. These data suggested that only a small subpopulation of the purified CD133 cells had telomerase activity prior to culture, which could be expanded efficiently in the SFHSC medium, and their mean telomere length could be maintained at the same condition during the 7-day batch culture.
B
C
In vivo repopulation assay in NOD/SCID mice Groups of lethally irradiated NOD/SCID mice were transplanted with either freshly purified CD133 cells, total expanded cells in the SF-HSC medium, or D-PBS through the tail vein. Irradiated NOD/SCID mice that were injected with D-PBS (6 of 6) all died at week 2 with their bone marrow containing many dead cells and empty spaces (see Fig. 4D, below). Surviving NOD/SCID mice that were transplanted with human cells were sacrificed at week 6. Transplanted 5 105 freshly purified CD133 cells per mouse engrafted 6 of 8 mice (75%), and human CD45 cells and CD34CD45 cells were at levels of 31.8 5.1% and 13.2 3.6% in the mice BM cells, respectively (Fig. 3B). NOD/SCID mice transplanted with 5 105 total expanded cells in the SF-HSC medium per mouse engrafted 5 of 6 mice (84%). As shown in Fig. 3C, human CD45 cells and CD34CD45 cells were identified at levels of 30.5 4.0% and 13.0 2.8% in BM cells of the trans-
FIG. 2. Telomerase and mean telomere length assay of CD133 cells before and after ex vivo expansion in the SFHSC medium. (A) Telomerase-specific gene (HTERT) expression of fresh purified CD133 cells (day 0), or of expanded cells following 3-day or 7-day ex vivo culture in the SF-HSC medium. (B) Telomerase activity of fresh purified CD133 cells (day 0), or of expanded cells following 3-day or 7-day ex vivo culture in the SF-HSC medium (Pos, positive control). (C) Mean telomere length of fresh purified CD133 cells (day 0, 13.3 0.5 kb), or of expanded cells following 3-day (13.8 0.4 kb) or 7-day (14.1 0.5 kb) ex vivo culture in the SF-HSC medium (L, low-molecular weight marker, 3.9 kb; H, high-molecular weight marker, 10.2 kb).
74
CHARACTERIZATION OF EX VIVO–EXPANDED HSCs
A
B
C
FIG. 3. Flow cytometry analysis of human surface antigen expression in bone marrow of NOD/SCID mice. Survival NOD/SCID mice were sacrificed at week 6 after transplantation. Human cells were detected by staining with the human leukocyte antigen CD45 and the human HSC-specific antigen CD34. (A) NOD/SCID mice were injected with D-PBS (without 400 cGy irradiation). (B) NOD/SCID mice were transplanted with 5 105 fresh purified CD133 cells (with 400 cGy irradiation). (C) NOD/SCID mice were transplanted with 5 105 expanded cells derived from fresh purified CD133 cells following 7-day culture in the SFHSC medium (with 400 cGy irradiation).
FIG. 4. Histological analysis of NOD/SCID bone marrow. Mice were sacrificed at week 6 after transplantation. (A) NOD/ SCID mice were injected with D-PBS (without 400 cGy irradiation). (B) NOD/SCID mice were transplanted with 5 105 fresh purified CD133 cells (with 400 cGy irradiation). (C) NOD/SCID mice were transplanted with 5 105 expanded cells derived from fresh CD133 cells following 7-day culture in the SF-HSC medium (with 400 cGy irradiation). (D) NOD/SCID mice were with 400 cGy irradiation and injected with D-PBS only (died at week 2 and proceeded to histological analysis immediately).
75
YAO ET AL. hibit many defects, including the absence of both lymphoid and myeloid hematopoiesis in the BM (33,34). The over-expression of CXCR4 in human cells leads to enhance homing of these cells to the murine BM after transplantation (35). In our studies, results showed that CD34CXCR4 cells and CD133CXCR4 cells increased 160- and 384-fold, respectively, and suggested that the ex vivo-expanded cells had a strong bone marrow homing ability. In vivo repopulation assay also showed that the expanded cells could reconstitute the hematopoiesis of the irradiated NOD/SCID mice, and the efficacy was comparable to that of freshly purified CD133 cells. It has been shown that HSCs were quiescent, residing in the G0/G1 phase of the cell cycle (36,37). Our cell cycle analysis revealed that, while HSCs were actively engaged in cell renewal in vivo, the vast majority of cells were standing at the G0/G1 phase. Although the percentage of each fraction of cell cycle varied during culturing, the G0/G1 cell fraction remained over 60%, and the final cell number was increased 53-fold after 7day culture in SF-HSC medium. Telomerase activity has been shown to maintain telomeric repeats in HSCs, leading to an immortal phenotype (8,9). Many studies showed that telomere length shortening was not prevented on ex vivo expansion of hematopoietic cells (38–41). In this study, results showed that the telomerase activity in freshly purified CD133 cells from UCB was weakly expressed and the mean telomere length (13.3 kb) was consistent with other published data (8,9,38–41). However, the expanded cells after 7-day culture in the SF-HSC medium showed a high level of telomerase activity, and could maintain the same telomere length with freshly purified CD133 cells. It suggested that only a small subpopulation of freshly purified CD133 cells was positive for telomerase expression and was mainly expanded in the SF-HSC medium. The ex vivo expansion of HSC experiments performed herein in serum-free medium with optimal concentrations of cytokines can be easily modified and applied to HSC biology and preclinical studies, including stem cell transplantation, gene therapy, and tumor cell purging. Given the promising results of HSC expansion and the availability of cGMP-grade cytokines, the development of a clinical grade of HSC medium appears to be feasible now. The expanded HSC transplantation of UCB should be considered for restoring the required bone marrow function of patients.
planted mice, respectively. The data did not differ significantly from those of freshly purified CD133 cells (p 0.05). Furthermore, the bone marrow of transplanted NOD/SCID mice was functional and full of cells, comparable to that of nonirradiated NOD/SCID mice (Fig. 4).
DISCUSSION Although UCB has been successfully utilized as a source of transplantable HSCs in the treatment of patients with either malignant diseases or genetic disorders, clinical UCB transplantation was restricted to young children because of the limited number of HSCs in one UCB unit. Ex vivo expansion of HSCs may solve the foregoing restriction of UCB, and is an important course for clinical therapy. As stated in many publications, investigators have already shown that it is possible to expand HSCs with serum or xenogeneic stromal cells (28–31). However, there is little information about ex vivo expansion of HSCs under serum-free and stromal cell-free conditions. We developed a SF-HSC medium for the ex vivo expansion of HSCs by using factorial designs combined with the steepest ascent method to optimize its formula of cytokines and serum substitutes. At the end of 7-day batch culture, the average number of CD34 cells and colony-forming cells was increased 27- and 22-fold, respectively (25). In the present study, we further demonstrated that the SF-HSC medium could expand the primitive HSCs in terms of their immunophenotypic characteristics, telomerase activity, and NOD/SCID mice engraftment. The expanded cells satisfied both in vitro and in vivo criteria usually ascribed to the primitive HSC compartment: (1) surface antigen expression, CD34, CD133, and CD38; (2) multidifferentiation potential and long-term culture ability, LTC-ICs; (3) bone marrow homing ability, CXCR4 expression; (4) cell cycle position, G0/G1 phase; (5) in vivo engraftment ability; and (6) telomerase activity expression. When purified CD133 cells cultured for 7 days in SFHSC medium, the absolute fold expansions for CD133 cells, CD34CD133 cells, CD34CD38 cells, CD133CD38 cells, and LTC-ICs were 21-, 20-, 723-, 618-, and 8-fold, respectively. It is noteworthy that the high enrichment of CD34CD38 cells and CD133 CD38 cells are beneficial for HSC long-term culture and engraftment potentiality (32). By contrast, cultures maintained in 10% fetal bovine serum (FBS) with same cytokine cocktail conditions showed no detectable CD34 CD38 cells and CD133CD38 cells, although the CD34CD38 cells and CD133CD38 cells were highly expanded (data not shown). Recent studies have shown that the engraftment of human CD34 cells in NOD/SCID mice may depend on CXCR4 expression (18–20). Knockout CXCR4 mice ex-
ACKNOWLEDGMENTS This work was supported by the Ministry of Economic Affairs, Taiwan (93-EC-17-A-17-R7-0525). We thank Nation Cheng Kung University and Hospital for animal study experiments and pathological examination. 76
CHARACTERIZATION OF EX VIVO–EXPANDED HSCs
REFERENCES 1. Gluckman E, V Rocha and C Chastang. (1998). Cord blood banking and transplant in Europe. Bone Marrow Transplant 22:68–74. 2. Gluckman E. (2000). Current status of umbilical cord blood hematopoietic stem cell transplantation. Exp Hematol 28:1197–1205. 3. Moore KA, H Ema and IR Lemischka. (1997). In vitro maintenance of highly purified, transplantable hematopoietic stem cells. Blood 89:4337–4347. 4. McAdams TA, WM Miller and ET Papoutsakis. (1996). Hematopoietic cell culture therapies (part I): cell culture considerations. Trends Biotechnol 14:341–349. 5. Hows JM, BA Bradley, JC Marsh, T Luft, L Coutinho, NG Testa and TM Dexter. (1992). Growth of human umbilical cord blood in long term haemopoietic cultures. Lancet 340:73–76. 6. Sutherland HJ, PM Lansdrop, DH Henkelman, SC Eaves and CJ Eaves. (1990). Functional characterization of individual human hematopoietic stem cells at limiting dilution on supportive marrow stromal layers. Proc Natl Acad Sci USA 87:3584–3588. 7. Prosper F, K Vanoverbeke, D Stroncek and CM Verfaillie. (1997). Primitive long-term culture initialing cells (LTCICs) in granulocyte colony-stimulating factor mobilized peripheral blood progenitor cells have similar potential for ex vivo expansion as primitive LTC-ICs in steady state bone marrow. Blood 89:3991–3997. 8. Van Ziffle JA, GM Baerlocher and PM Lansdorp. (2003). Telomere length in subpopulations of human hematopoietic cells. Stem Cells 21:654–660. 9. Zimmermann S, S Glaser, R Ketteler, CF Waller, U Klingmuller and UM Martens. (2004). Effects of telomerase modulation in human hematopoietic progenitor cells. Stem Cells 22:741–749. 10. Larochelle A, J Vormoor, H Hanenberg, JC Wang, M Bhatia, T Lapidot, T Moritz, B Murdoch, XL Xiao, I Kato, DA Williams and JE Dick. (1996). Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implication for gene therapy. Nature Med 2:1329–1337. 11. Burt RK. (1999). Clinical utility in maximizing CD34 cell count in stem cell grafts. Stem Cells 17:373–376. 12. Danet GH, HW Lee, JL Luongo, MC Simon and DA Bonnet. (2001). Dissociation between stem cell phenotype and NOD/SCID repopulating activity in human peripheral blood CD34 cells after ex vivo expansion. Exp Hematol 29:1465–1473. 13. Zandstra PW, E Conneally, AL Petzer, JM Piret and CJ Eaves. (1997). Cytokines manipulation of primitive human hematopoietic cell self-renewal. Proc Natl Acad Sci USA 94:4698–4703. 14. Bhatia M, JC Wang, U Kapp, D Bonnet and JE Dick. (1997). Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice. Proc Natl Acad Sci USA 94:5320–5325. 15. De Wynter EA, D Buck, C Hart, R Heywood, LH Coutinho, A Clayton, JA Rafferty, D Burt, G Guenechea, JA Bueren, D Gagen, LJ Fairbairn, BI Lord and NG Testa. (1998).
16.
17. 18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
77
CD34AC133 cells isolated from cord blood are highly enriched in long-term culture-initiating cells, NOD/SCIDrepopulating cells and dendritic cell progenitors. Stem Cells 16:387–396. Yin AH, S Miraglia, ED Zanjani, G Almeida-Porada, M Ogawa, AG Leary, J Olweus, J Kearney and DW Buck. (1997). AC133, a novel marker for human hematopoietic stem and progenitor cells. Blood 90:5002–5012. Bhatia M. (2001). AC133 expression in human stem cells. Leukemia 15:1685–1688. Peled A, I Petit, O Kollet, M Magid, T Ponomaryov, T Byk, A Nagler, H Ben-Hur, A Many, L Shultz, O Lider, R Alon, D Zipori and T Lapidot. (1999). Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 283:845–848. Denning-Kendall P, S Singha, B Bradley and J Hows. (2003). Cytokine expansion culture of cord blood CD34 cells induces marked and sustained changes in adhesion receptor and CXCR4 expressions. Stem Cells 21:61–70. Hart C, D Drewel, G Mueller, J Grassinger, M Zaiss, LA Kunz-Schughart, R Andreesen, A Reichle, E Holler and B Hennemann. (2004). Expression and function of homingessential molecules and enhanced in vivo homing ability of human peripheral blood-derived hematopoietic progenitor cells after stimulation with stem cell factor. Stem Cells 22:580–589. Rubinstein P, C Carrier, A Scaradavou, J Kurtzberg, J Adamson, AR Migliaccio, RL Berkowitz, M Cabbad, NL Dobrila, PE Taylor, RE Rosenfield and CE Stevens. (1998). Outcomes among 562 recipients of placental-blood transplants from unrelated donors. N Engl J Med 339:1565– 1577. Laughlin MJ, M Eapen, P Rubinstein, JE Wagner, MJ Zhang, RE Champlin, C Stevens, JN Barker, RP Gale, HM Lazarus, DI Marks, JJ Van Rood, A Scaradavou and MM Horowitz. (2004). Outcomes after transplantation of cord blood or bone marrow from unrelated donors in adults with leukemia. N Engl J Med 351:2265–2275. Williams SF, WJ Lee, JG Bender, T Zimmerman, P Swinney, M Blake, J Carreon, M Schilling, S Smith, DE Williams, F Oldham and D Van Epps. (1996). Selection and expansion of peripheral blood CD34 cells in autologous stem cell transplantation for breast cancer. Blood 87:1687–1691. Ali MY, Y Oyama, J Monreal, JN Winter, MS Tallman, SF Williams, S Singhal, LI Gordon and J Mehta. (2003). Ideal or actual body weight to calculate CD34 cell doses for autologous hematopoietic stem cell transplantation? Bone Marrow Transplant 31:861–864. Yao CL, CH Liu, IM Chu, TB Hsieh and SM Hwang. (2003). Factorial designs combined with the steepest ascent method to optimize serum-free media for ex vivo expansion of human hematopoietic progenitor cells. Enzyme Micro Technol 33:343–352. Ponchio L, L Duma, B Oliviero, N Gibelli, P Pedrazzoli and G Robustelli Della Cuna. (2000). Mitomycin C as alternative to irradiation to inhibit the feeder layer growth in long-term culture assays. Cytother 2:281–286. Bhatia M, D Bonnet, U Kapp, JCY Wang, B Murdoch and JE Dick. (1997). Quantitative analysis reveals expansion of
YAO ET AL.
28.
29.
30.
31.
32.
33.
34.
35.
36. Lajtha LG. (1979). Stem cell concepts. Differentiation 14:23–34. 37. Fleming WH, EJ Alpern, N Uchida, K Ikuta, GJ Spangrude and IL Weissman. (1993). Functional heterogeneity is associated with the cell cycle status of murine hematopoietic stem cells. J Cell Biol 122:897–902. 38. Zimmermann S and UM Martens. (2005). Telomere dynamics in hematopoietic stem cells. Curr Mol Med 5: 179–185. 39. Engelhardt M, R Kumar, J Albanell, R Pettengell, W Han and MA Moore. (1997). Telomerase regulation, cell cycle, and telomere stability in primitive hematopoietic cells. Blood 90:182–193. 40. Rufer N, TH Brummendorf, S Kolvraa, C Bischoff, K Christensen, L Wadsworth, M Schulzer and PM Lansdorp. (1999). Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. J Exp Med 190:157–167. 41. Vaziri H, W Dragowska, RC Allsopp, TE Thomas, CB Harley and PM Lansdorp. (1994). Evidence for a mitotic clock in human hematopoietic stem cells: loss of telomeric DNA with age. Proc Natl Acad Sci USA 91:9857–9860.
human hematopoietic repopulating cells after short-term ex vivo culture. J Exp Med 186:619–624. Lebkowski JS, LR Schain and TB Okarma. (1995). Serumfree culture of hematopoietic stem cells: a review. Stem Cells 13:607–612. Sandstrom CE, WM Miller and TP Papoutsakis. (1994). Review: serum-free media for cultures of primitive and mature hematopoietic cells. Biotechnol Bioeng 43:706–733. Mobest D, R Mertelsmann and R Henschler. (1998). Serum-free ex vivo expansion of CD34 hematopoietic progenitor cells. Biotechnol Bioeng 60:341–347. Bruyn CD, A Delforge and D Bron. (2003). Ex vivo myeloid differentiation of cord blood CD34 cells: comparison of four serum-free media containing bovine or human albumin. Cytother 5:153–160. Cardoso AA, ML Li, P Batard, A Hatzfeld, EL Brown, JP Levesque, H Sookdeo, B Panterne, P Sansilvestri, SC Clark and J Hatzfeld. (1993). Release from quiescence of CD34CD38 human umbilical cord blood cells reveals their potentiality to engraft adults. Proc Natl Acad Sci (USA) 90:8707–8711. Nagasawa T, S Hirota, K Tachibana, N Takakura, S Nishikawa, Y Kitamura, N Yoshida, H Kikutani and T Kishimoto. (1996). Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382:635–638. Zou YR, AH Kottmann, M Kuroda, I Taniuchi and DR Littman. (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393:595–599. Sawada S, K Gowrishankar, R Kitamura, M Suzuki, G Suzuki, S Tahara and A Koito. (1998). Disturbed CD4 T cell homeostasis and in vitro HIV-1 susceptibility in transgenic mice expressing T cell line-tropic HIV-1 receptors. J Exp Med 187:1439–1449.
Address reprint requests to: Dr. Shiaw-Min Hwang Bioresource Collection and Research Center Food Industry Research and Development Institute 331 Shih-pin Road Hsinchu, 300 Taiwan E-mail:
[email protected] Received October 24, 2005; accepted December 2, 2005.
78
