Classical CD11c+ dendritic cells, not plasmacytoid dendritic cells, induce T cell responses to Plasmodium chabaudi malaria

International Journal for Parasitology 40 (2010) 711–719

Contents lists available at ScienceDirect

International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara

Classical CD11c+ dendritic cells, not plasmacytoid dendritic cells, induce T cell responses to Plasmodium chabaudi malaria Cecile Voisine 1, Beatris Mastelic, Anne-Marit Sponaas, Jean Langhorne * Division of Parasitology, MRC National Institute for Medical Research, London, UK

a r t i c l e

i n f o

Article history: Received 7 August 2009 Received in revised form 2 November 2009 Accepted 17 November 2009

Keywords: Malaria Plasmodium Plasmacytoid dendritic cell Antigen presentation Interferon alpha TLR9

a b s t r a c t Dendritic cells play an important role in the development of immune responses in malaria, but the contribution of plasmacytoid dendritic cells (pDC) to CD4 T cell activation and immunopathology is unknown. We have investigated pDC in a Plasmodium chabaudi infection in mice. During infection, pDC increased in number and transiently up-regulated expression of Major Histocompatibility Complex class II and co-stimulatory molecules. However, in contrast to classical CD11chigh DC, pDC could not phagocytose parasites or process parasite proteins, to activate CD4 T cells. Activation of naïve pDC, but not CD11chigh DC, by infected red blood cells induced IFNa in vitro, which was dependent on the Toll-like receptor, TLR9. However, inactivation of TLR9 in knock-out mice had no effect on a P. chabaudi infection suggesting that TLR9 was not crucial for parasite elimination or pathology. Neither pDC nor IFNab were essential for parasite clearance as mice depleted of pDC or IFNab Receptor-knock-out mice could control infection. However, these mice lost significantly more weight than untreated or wild-type mice. We conclude that classical DC are the major antigen-presenting cells for CD4 T cells in this infection, but that pDC and IFNab may play minor roles in controlling the magnitude of acute stage pathology. Crown Copyright Ó 2009 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc. All rights reserved.

1. Introduction Protective immunity against blood-stage malaria is dependent on CD4 T cells and B cells (Langhorne et al., 2008). In Plasmodium chabaudi infections in mice, development of IFNc-producing Th1 cells and antibody are required to control parasitemia. However, inflammatory responses and CD4 T cell responses, particularly those involving IFNc, have also been linked to pathology (Langhorne et al., 2008). Despite the importance of CD4 T cells in malaria infections, the factors governing their activation, differentiation and regulation are not fully understood. Dendritic cells (DC) are central to T lymphocyte activation and differentiation (Banchereau and Steinman, 1998). They take up and process antigens, up-regulate surface co-stimulatory and Major Histocompatibility Complex (MHC) molecules and present peptides to specific T cells. In addition, they produce cytokines which promote development of particular subsets of T cells with different functions. All of these events are regulated through pathogen recognition receptors and the micro-environment (Trinchieri and * Corresponding author. Address: Division of Parasitology, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, NW7 1AA London, UK. Tel.: +44 020 8816 2558; fax: + 44 020 8816 2638. E-mail address: [email protected] (J. Langhorne). 1 Present address: Department of Immunology, University College London, Royal Free Hospital, Rowland Hill Street, NW3 2PF London, UK.

Sher, 2007). In mouse malaria, CD11c+ DC are important in the development of immunity. In P. chabaudi infections the numbers of splenic CD11chigh DC increase, they up-regulate expression of co-stimulatory molecules and present Plasmodium antigens resulting in activation of CD4 T cells to produce IFNc, IL-2, IL-4 and IL-10 (Sponaas et al., 2006). DC from Plasmodium yoelli-infected mice or human DC exposed to Plasmodium falciparum have also been implicated in suppressing T cell responses (Urban et al., 1999; OcanaMorgner et al., 2003). Plasmacytoid DC (pDC) produce type I IFN upon viral infection or appropriate stimulation (Grouard et al., 1997; Asselin-Paturel et al., 2001). They exhibit dendritic morphology, up-regulate MHC class II and expression of co-stimulatory molecules (Asselin-Paturel et al., 2001) and it is now accepted that pDC can present endogenous antigens to T cells (Salio et al., 2004; Hoeffel et al., 2007). The interaction of pDC with Plasmodium has not been extensively investigated but there are suggestions that they might be important. Activation of DC by Plasmodium DNA in haemozoin (Parroche et al., 2007) is dependent on the Toll-like receptor, TLR9, present within pDC (Ahmad-Nejad et al., 2002). Also, human pDC up-regulate CD86 expression and produce IFNa after exposure to P. falciparum-infected red blood cells (iRBC) (Pichyangkul et al., 2004), suggesting that they play a role in antigen presentation to CD4 T cells, or in regulating immune responses via type I IFNs. Polymorphisms in IFNa Receptor 1 are associated with protection

0020-7519/$36.00 Crown Copyright Ó 2009 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc. All rights reserved. doi:10.1016/j.ijpara.2009.11.005

712

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

against cerebral malaria in humans (Aucan et al., 2003). IFNa treatment of Plasmodium berghei-infected mice inhibits cerebral malaria and development of P. yoelii blood-stage infections of mice (Vigario et al., 2001, 2007). Here we investigated whether pDC and type 1 IFNs contribute to the immune response to a P. chabaudi malaria infection using mice depleted of pDC or lacking IFNab receptors or TLR9. In addition, we have asked whether pDC up-regulate surface molecules involved in antigen presentation and whether, like classical DC, they are able to take up, process and present Plasmodium antigens to CD4 T cells. 2. Materials and methods 2.1. Mice and parasites Mice were bred at the National Institute for Medical Research (NIMR, London, UK) and housed under specific pathogen-free conditions. 129 Sv/Ev and IFNab Receptor-knock-out mice (IFNabR / ) were purchased from B&K Universal Ltd. (UK) and bred at NIMR. BALB/c mice, CD4 T cell receptor (TCR) transgenic (Tg) mice carrying a CD4 TCR specific for a peptide of P. chabaudi Merozoite Surface Protein 1 (MSP11157–1171) and MHC class II I-Ed (Stephens et al., 2005) were previously generated at NIMR (Stephens et al., 2005). TLR9 knock-out mice (TLR9 / ), back-crossed 10 times onto C57Bl/6, were a kind gift from Professor S. Akira (Osaka University, Japan). Female mice (8 and 12 weeks old) were infected with 105 P. chabaudi chabaudi AS iRBC and parasitemia, weight loss and body temperature were monitored as previously described (Li et al., 2003). All animal work was conducted under the relevant British Home Office licence and according to international guidelines, after approval from the NIMR Ethical Review Panel. 2.2. Enrichment of iRBC containing P. chabaudi schizonts Heparinised cardiac blood from P. chabaudi-infected mice (7 days p.i.) was collected, diluted 1:4 with RPMI (Gibco) layered onto 74% isotonic Percoll (Amersham Biosciences, UK) and centrifuged at 950g for 20 min. The iRBC at the interface were removed, washed twice in RPMI and passed through Plasmodipur filters (Euro-Diagnostica, Norway) to remove leukocytes before culture at 37 °C in air containing 5% oxygen, 88% nitrogen and 7% CO2 for 4 h. The purity of iRBC was greater than 99%, and more than 50% of iRBC contained multinucleate schizonts. Leukocytes were less than 0.5%.

isotype control antibodies and Fc receptor block were obtained from BD Biosciences (Cambridge Biosciences, Oxford) and eBioscience Inc. (California, USA). Spleen cells were isolated and stained with antibodies listed above as described previously (Sponaas et al., 2006). Samples were acquired on a FACScaliburÒ and analysed with Flojo software (BD Biosciences, San Jose, California, USA). 2.5. Cell sorting Splenocytes from naïve or P. chabaudi-infected mice were treated for 30 min at 37° C with 0.4 mg/ml of Liberase CI (Boehringer Mannheim, Germany). RBC were lysed with RBC lysing buffer (Sigma), and CD8b, CD19+, CD3+, TER119+ cells were depleted using anti-rat Ig Dynabeads (Dynal Biotech, Oslo, Norway). Cells were then incubated with CD11c-APC and 120G8-Alexa 488, and CD11chigh 120G8neg (CD11chigh DC) and CD11cint 120G8high (pDC) cells were sorted on a MoFlo cytometer (Cytomation). Dead cells were excluded by Propidium iodide staining. Purity was greater than 90%. Splenic CD4+ T cells from the B5 TCR Tg mice were isolated using CD4+ microbeads (Miltenyi, Germany) according to the manufacturer’s instructions. Purity was routinely 98%. 2.6. In vivo depletion of pDC To deplete mice of pDC, female 129 Sv mice were injected i.p. with 1 mg of purified anti-pDC mAb, 120G8, or rat IgG (Sigma, UK) every 3 days from day 0 to day 15. The efficacy of depletion as determined by flow cytometry on spleen cells 3 days after the final injection using anti-B220, and -GR1 antibodies as well as CD11c and 120G8 was greater than 98% (Supplementary Fig. S1). 2.7. Antigen presentation assays Splenic pDC and CD11chigh DC (1.5  103–1  105 per well) from uninfected or infected mice were incubated with 2  104 B5 or B7 CD4+ T hybridoma cells for 24 h, or with 1  105 Tg CD4+ T cells in 200 ll of complete Iscove’s modified Dulbecco’s medium (IMDM, Sigma, Dorset, UK), containing 10% FCS, 1 mM L-glutamine, 10 mM HEPES, 5  10–5 M 2 ME, 100 mg/ml penicillin 100 U/ml streptomycin and 1 mM sodium pyruvate in the presence or absence of iRBC or uninfected RBC (30:1 RBC:DC), or 1 lM of their respective peptide (B5: ISLKSRLLKRKKYI, B7: RCEKDTEATCSINKGGCDPS). After 3 days, cultures were pulsed for 24 h with 1 lCi 3H-thymidine (Amersham, UK) (Sponaas et al., 2006). Supernatants from the hybridoma cultures were added to 5000 CTLL-2 cells. Proliferation of CTLL-2 cells was determined as previously described (Quin et al., 2001).

2.3. Cell lines and peptides CD4+ T cell hybridomas, B5 and B7, specific for peptides of P. chabaudi MSP1 (MSP11690–1709 with MHC class I-Ad and MSP11157–1171 with MHC class II I-Ed, respectively) have been described (Quin et al., 2001). The CTLL-2 cell line was used to measure IL-2 produced by T cell hybridomas as described previously (Quin et al., 2001). 2.4. Antibodies for cell sorting and flow cytometry The monoclonal antibody (mAb), 120G8, specific for pDC was a kind gift of Dr. Georgio Trinchieri, National Institutes of Health (NIH, USA) and Dr. Anne O’Garra, NIMR (Asselin-Paturel et al., 2003) and was conjugated to biotin or Alexa 488 (Molecular Probes, Invitrogen, UK) according to manufacturers’ protocols. Unlabelled, fluorescent- or biotin-labelled antibodies specific for CD86 (PE) CD40 (PE), CD11c (APC and PE), H-2Ad (PE), GR1 (APC), B220 (Biotin), CD8b CD3 (biotin), CD19 (biotin), and TER119, Streptavidin-PerCP,

2.8. Cytokine production from isolated DC Sorted CD11chigh DC and pDC were cultured for 24 h at 2.5  105/ml in 2 ml complete IMDM with CpG ODN1668 (Invivogen, San Diego, USA) 10 lg/ml, iRBC or uninfected RBC (30:1, RBC:DC). Production of IFNa in supernatants was measured with an anti-IFNa capture mAb (Hycult, UK), and a rabbit anti-IFN-polyclonal antibody (PBL, NJ, USA) followed by goat anti-rabbit horse radish peroxidase (HRP) (Sigma–Aldrich), or a mouse Interferon Alpha (IFNa) ELISA kit (PBL). IL-12 p45 chain (IL-12p40) was measured with an OptEIA kit (BD Biosciences, Oxford, UK). 2.9. Phagocytosis assay Splenocytes (5  105) in 1 ml complete IMDM were incubated for 30 min in the presence or absence of cytochalasin (40 lg/ml), an inhibitor of phagocytosis (Sigma, Dorset, UK). iRBC were prepared as described above without the final differentiation step

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

for the schizonts, and incubated with 1 lM CFSE (Molecular Probes) for 1 min at room temperature in PBS and then washed three times in complete IMDM (500 g, 5 min at 4 °C). CFSE-labelled iRBC were added to the splenocytes (10:1, Schizonts: splenocytes) and incubated at 37 °C for 2.5 h. Cells were collected, iRBC lysed and incubated with labelled antibodies specific for CD11c and 120G8 and analysed by flow cytometry as described above. 2.10. Quantitative real-time PCR (qPCR) Total RNA was extracted from 3  105 to 2  106 CD11chigh and pDC using TRIZOLÒ extraction (Life technologies). Genomic DNA was removed by DNase treatment (Life technologies) and reverse-transcription was performed according to the manufacturer’s instructions (Invitrogen). The oligonucleotide sequences used for the quantitative real-time PCR (qPCR) are shown in the legend to Fig. 4. qPCR to measure RNA levels of cytokines, IFNa (1,2,5,7,abn), IFNa4 and Ubiquitin (as housekeeping gene) was performed using an Applied Biosystems GenAmp 7000 Sequence Detection System with SYBR Green PCR Core Reagents (ABgene, Surrey, UK). Total cDNA was amplified in 25 ll of PCR mix containing 12.5 ml of ABsolute QPCR SYBR green mix and 2 mM of each primer, according to the manufacturer’s instructions. The reaction started with 15 min at 95 °C to activate the DNA polymerase, followed by 40 cycles of 15 s at 95 °C, then 1 min at 60 °C. PCR products were detected by measuring the increase in fluorescence and normalised with the housekeeping gene. Expression levels of the PCR products relative to ubiquitin were calculated using the 2 DDCt method as previously described (Pfaffl, 2001) and results shown as fold increases compared with day 0 values. 2.11. Statistical analyses Statistical analyses were performed by Mann Whitney test using GraphPad Prism software. P values of less than 0.05 were considered significant. 3. Results 3.1. Splenic pDC are activated and increase in number during an acute P. chabaudi infection Populations of pDC, defined by their surface expression of a molecule recognised by the antibody 120G8 and surface expression of intermediate levels of CD11c (Asselin-Paturel et al., 2003), and classical DC (CD11chigh) (Fig. 1A and B) increased as the P. chabaudi infection progressed (twofold and threefold increases for pDC and cDC, respectively, compared with uninfected controls). The numbers were still elevated at day 20, despite the fact that by this time of infection parasitemia had been reduced to less than 1% iRBC (Fig. 1B) and the size of the spleen had decreased. The pDC appeared to be transiently activated in vivo. The mean fluorescence intensities (MFI) of CD86 and MHC class II, but not CD40, were slightly higher on splenic pDC from day 5 of infection on all three mouse strains tested (129/Sv, BALB/c and C57Bl/6) than on pDC from uninfected mice (Fig. 1C), but this was no longer the case by day 20 of infection (data not shown). However, expression of these molecules on pDC (uninfected or day 5 infected mice) were lower than on the surface of CD11chigh DC (Supplementary Fig. S2). 3.2. pDC are not able to phagocytosis P. chabaudi-iRBC or present malaria antigen to specific T cells For DC to process and present antigen on MHC class II to CD4 T cells, they must internalise exogenous antigens. Using an in vitro

713

FACS-based phagocytosis assay with CFSE-labelled iRBC, CD11chigh DC taken from uninfected BALB/c mice were able to take up CFSElabelled iRBC in a cytochalasin-dependent manner (Fig 2A). By contrast, less than 5% of pDC had phagocytosed CFSE-iRBC. Despite the fact that pDC did not phagocytose iRBC in vitro, it was possible that they could internalise unlabelled parasite material released from iRBC to present to CD4 T cells. Therefore we investigated whether pDC from uninfected mice processed and presented P. chabaudi antigens to specific CD4 T cells. CD4 T cells from TCR Tg mice specific for MSP11157–1171 with I-Ed (Stephens et al., 2005) were used to determine the T cell activating capacity of pDC. When Tg CD4 T cells were co-cultured with sorted naïve splenic pDC or CD11chigh DC and iRBC, or exogenously added specific peptide, only CD11chigh DC were able to induce Tg T cell proliferation (Fig. 2B), suggesting that pDC were unable to present peptide and activate CD4 T cells. However, as expression of CD40 and CD86 was lower on pDC compared with CD11chigh DC (Fig. 1C), this experiment could not distinguish between an inability of pDC to take up, process and present the parasite peptide, and the potential limiting level of co-stimulatory molecules. To assess this, pDC or CD11chighDC incubated with either iRBC or pulsed with peptide were cultured with MSP1-specific T cell hybridomas; B5 recognising the same epitope as the Tg CD4 T cells, and B7 recognising MSP11690–1709 (Quin et al., 2001). CD4 T cell hybridomas do not require co-stimulation and their TCRs require only ligation of the appropriate peptide and MHC complex for a specific response, which can be measured by their production of IL-2. In agreement with previous data (Sponaas et al., 2006), CD11chigh DC phagocytosed iRBC, processed and presented both MSP1 peptides as demonstrated by the positive IL-2 responses of both T cell hybridomas (Fig. 2C, b). Naïve pDC, on the other hand, cultured with iRBC could not induce IL-2 production by the same T cell hybridomas. However, they could present exogenously added peptides showing that the level of MHC expression was adequate for the T cell hybridoma response (Fig. 2C, a). These data suggest that pDC are unable to take up parasite material and present MSP1 peptides in vitro, and that they also lack the appropriate level of co-stimulatory properties to activate MSP1-specific CD4 T cells. Our findings with naïve DC do not rule out a role for pDC in activating T cells in vivo in infection. To examine this, the ability of pDC taken from P. chabaudi-infected mice to induce T cell proliferation was determined. pDC from day 3 (not shown) or day 7 of infection (Fig. 3A) failed to induce proliferation of the MSP-1-specific Tg CD4 T cells. By contrast, at this time of infection, as shown previously (Sponaas et al., 2006) CD11chigh DC had processed MSP1 in vivo and presented sufficient peptide to induce a Tg CD4 T cell response, and an IL-2 response from the T cell hybridoma (Fig. 3B, a). Addition of exogenous peptide to the pDC from day 7-infected mice did not restore the response of the Tg CD4 T cells (Fig. 3A) but did restore the IL-2 response of the hybridoma (Fig. 3B, b). We concluded therefore that both expression levels of co-stimulatory molecules and lack of presentation of processed peptides were responsible for the lack of response ex vivo. In summary we found no evidence that pDC were able to phagocytose, process and present Plasmodium peptides to CD4 T cells, and that this T cell activation took place primarily via the CD11chigh classical DC in the acute stage of this infection. 3.3. Plasmodium chabaudi stimulated-pDC produce IFNa Since pDC did not activate malaria-specific CD4 T cells, they may influence the response to P. chabaudi through their role as type-1-IFN-producing cells. mRNA transcripts for Type 1 IFN were transiently increased in pDC in the early stages of a P. chabaudi infection (Fig. 4A) and were more than 15-fold greater at day 3

714

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

A

Day 0

Day 5

104

2.19%

103

CD11c

10

10

1

10

2

10

3

0.66%

103

0.41%

10

0

1.15%

102

1

100

104

103

0.61%

102

10

Day 9

104

10

4

0.39%

102

1

10

100 10

0

10

1

10

2

10

3

10

4

1

100 10

0

10

1

10

2

10

3

10

4

120G.8

B

35

pDC

30

CD11chi

25

3

20 2 15 10

1

Parasitemia (% i RBC)

Number of cells (x106)

4

5 0 0

5

9

20

Days after infection

C

129/Sv

BALB/c

9.16 9.17

C57Bl/6

10.5 11.6

8.0 13.8 CD40

77.4 119

408 597

116 169 Class II

26.4 29.7

35.4 72.4

39.5 59.8 CD86

Fig. 1. Plasmacytoid dendritic cells (pDC) are activated during a Plasmodium chabaudi infection and increase in number during acute infection. (A) Representative Flow cytometry (FACS) plots showing pDC and CD11chigh DC within the total viable splenic cell population (gated on Foward light scatter and 90° scatter) of C57Bl/6 mice on different days of a P. chabaudi infection. The pDC population was defined as 120G8 + CD11cintermediate cells, and classical DC were defined as CD11chigh cells. iRBC, infected red blood cell. (B) The numbers of pDC (black bars) and CD11chigh DC (white bars) during the 20 days of a P. chabaudi infection (black squares, left axis) defined as shown in A above. Values shown are the means and standard errors of the mean of 10 mice. (C) Representative FACS histograms showing the fluorescence intensities of MHC class II, CD40 and CD86 on pDC, defined as in A above, on spleen cells from uninfected (black lines) and day 5 P. chabaudi-infected mice (red lines). Grey shaded histograms indicate the background staining with the relevant isotype control antibodies. The numbers in black and red are the mean fluorescence intensities (MFI) for uninfected and infected spleen cells, respectively.

715

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

A

Phagocytosis

(a)

(b)

CD11chi

pDC 100

100

80

80

45

60 3.68

35

% CFSE+ DC

% of Max

% of Max

40

60 43.6

40

40

20

20

0

0

30 25 20 15 10 5

100

101

CFSE

102 FL1-H

103

104

0 100

101

102 FL1-H

Response of MSP1-specifc Tg CD4 T cells

C

Response of MSP1-specific CD4 T cell hybridomas

104

CD11chi

pDC

T cell Proliferation (3H cpm)

B

103

CD11chigh

pDC

(b)

B5

p

B7

BC p

B5

e

id

BC

e

id

t ep

iR

p

e

id

t ep

iR

BC iR

e

id

t ep

iR BC

CTLL Proliferation (3H cpm)

(a)

t ep

p

B7

Fig. 2. Plasmacytoid dendritic cells (pDC) do not phagocytose Plasmodium chabaudi-infected red blood cells (iRBC) in vitro, and are unable to stimulate Merozoite Surface Protein 1 (MSP1)-specific CD4 T cells and T cell hybridomas. (A) (a): Representative FACS plots showing CFSE+ DC after culture of naïve spleen cells with CFSE-labelled iRBC as described in Section 2. pDC and CD11chigh DC were defined as shown in Fig. 1A. Histograms show the CFSE staining in each population of DC (black line) compared with CFSE staining in each population of DC in the presence of cytochalasin, an inhibitor of phagocytosis (grey line). (b): A comparison of the percentage of CFSE + pDC and CD11chigh DC. The values shown are the means and standard errors of the means of quadruplicate cultures from two independent experiments. (B) The proliferative response of MSP1specific T cell receptor (TCR) transgenic (Tg) CD4 T cells after co-culture of pDC (black bars) and CD11chigh DC (white bars) with infected red blood cells (1:30, DC: iRBC) as described in Section 2. DC populations, defined as shown in Fig. 1A, were purified by cell sorting from spleens of naïve BALB/c mice. The data shown are from a representative experiment of four performed and show the incorporation of 3H-thymidine after subtraction of the background c.p.m. of cultures of DC incubated without iRBC or peptide. The values are the means and S.E.M. of quadruplicate cultures. (C) The response of two MSP1-specific CD4 T cell hybridomas, B5 and B7 after co-culture with pDC (a) and CD11chigh DC (b) as described in B above with iRBC (solid bars and white bars for pDC and CD11chigh DC, respectively) or 1 lM of exogenously added peptide (hatched bars and stippled bars for pDC and CD11chigh DC, respectively). The IL-2 response of the hybridomas is shown as the proliferative response of IL-2 sensitive CTLL-2 cells as described in Section 2. The values shown are the means and S.E.M. of quadruplicate cultures of a representative experiment of four performed.

of infection than those of naïve pDC, but were not increased in CD11chigh DC at this time (data not shown). Increased transcription

of Type 1 IFN genes in pDC was dependent on signalling through TLR9, as pDC from infected TLR9 / mice did not produce IFNa

716

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

Fig. 3. Plasmacytoid dendritic cells (pDC) do not present Plasmodium chabaudi Merozoite Surface Protein 1 (MSP1) peptide in vivo during infection. (A) The proliferative response of MSP1-specific T cell receptor (TCR) transgenic (Tg) CD4 T cells after co-culture with different numbers of pDC (a) or CD11chigh DC (b) isolated from spleens of P. chabaudi-infected mice at day 7 of infection in the presence (open triangles and open squares) or absence (black triangles and black squares) of 1 lM of exogenously added peptide. The graphs show one experiment of four performed and the values are the means and S.E.M. of quadruplicate cultures. (B) The IL-2 response of CD4 T cell hybridoma, B7, after co-culture with CD11chigh DC or pDC isolated from spleens of P. chabaudi-infected mice at day 7 of infection (white bars, CD11chighDC; black bars pDC) in the presence or absence of 1 lM of exogenously added peptide (stippled bars) or na DC as a negative control. The IL-2 response of the hybridoma is shown as the proliferative response of IL-2-sensitive CTLL-2 cells as described in Section 2. The values shown are the means and S.E.M. of triplicate cultures of a representative experiment of three performed.

mRNA (Fig. 4A). Significant levels of IL-12p35, IL-23p19 or IL-6 mRNA transcripts were not detected in pDC, and both pDC and CD11chigh DC also had increased levels of IL-10 and IL-1a mRNA transcripts during the early infection compared with uninfected controls (data not shown). To investigate whether the IFNa produced by pDC was a direct result of stimulation by parasite material, naïve pDC and CD11chigh DC were cultured in vitro with iRBC (30:1, iRBC: DC), and IFNa and IL-12 measured in the culture supernatants (Fig. 4B). IFNa was produced by pDC cultured with iRBC, but not with uninfected RBC, although the amount was lower than that induced by CpG stimulation. pDC did not produce IL-12p40 after stimulation with iRBC (Fig. 4B, a) confirming the results obtained by qRT-PCR. CD11chigh classical DC, on the other hand, produced IL-12p40 after stimulation with iRBC but did not produce IFNa after stimulation with either iRBC or CpG (Fig. 4B, b). Production of IFNa by pDC in vitro was also dependent on TLR9, as IFNa mRNA was not induced in pDC isolated from TLR9 / mice in response to iRBC or CpG (Fig. 4C). 3.4. Depletion of pDC and lack of TLR9 or the IFNab receptor in vivo have minimal effects on a P. chabaudi infection and accompanying pathology Since pDC produced IFNa in response to P. chabaudi parasites both in vitro and in vivo, we investigated whether depletion of

pDC or absence of TLR9 or the IFNab receptor had any effect on a P. chabaudi blood-stage infection. In agreement with previous reports (Franklin et al., 2007), there were no significant effects of the lack of TLR9 in TLR9 / mice on parasitemia, weight loss or temperature change at any time during the 20 days of a primary P. chabaudi infection (data not shown). In IFNabR / mice, apart from a slightly increased peak parasitema, the course of a primary (Fig. 5A, a) and second infection (not shown) were not significantly different from those of control 129/ Sv mice. Interestingly, following peak infection (day 9) IFNabR / mice lost significantly more weight (Fig. 5B, a) and were more hypothermic (Fig. 5C, a) than the wild-type (WT) 129 Sv mice, suggesting that signalling through the IFNab receptor may affect acute stage pathology. In order to link these results to IFNa production by pDC, we infected mice which had been depleted of pDC by injection of the mAb, 120G8, previously shown to effectively deplete pDC in vivo (Asselin-Paturel et al., 2003). No significant changes in parasitemia or temperature were observed in mice given 120G8 antibodies compared with control IgG-treated mice (Fig. 5A and C, b). Although there was a trend of greater weight loss (Fig. 5B, b) at peak parasitemia in pDC-depleted mice than in control mice, these differences were not significant. Together these data suggest that although the IFNab receptor may minimally affect acute infection, this does not seem to be through ligation of TLR9.

717

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

A IFN

mRNA

(a)

(b) IFN 4

IFN consensus TLR9-/C57Bl/6

B In vitro culture (a)

(b)

IFN

600

pDC CD11chighDC

5

*

400

ng/ml

IU/mL

500

300

pDC CD11chighDC

4 3

*

2

200

1

100

0

0

medium

C

IL-12p40

6

700

iRBC

uRBC

CpG

medium

iRBC

uRBC

CpG

In vitro: TLR9-/- vs WT C57Bl/6 600

IU/mL

TLR9-/C57Bl/6

400

200

0 medium

iRBC

uRBC

CpG

Fig. 4. IFNa production is dependent on the presence of the Toll-like receptor, TLR9, and is produced by plasmacytoid dendritic cells (pDC) in response to Plasmodium chabaudi. (A) Levels of IFNa mRNA expressed in pDC from C57BL/6 mice (open bars) and TLR9 / mice (black bars) isolated from spleens of uninfected and mice infected for three days with P. chabaudi. Two different primer pairs were used: (a) detecting IFNa 4 and (b) detecting all IFNa. The data are normalised to ubiquitin and shown as fold increase relative to mRNA in pDC or CD11chigh DC from naïve mice (Day 0). These values shown are the means and S.E.M. of three independent experiments, each using total RNA from a pool of five mice. (B) IFNa (a) and IL-12p40 (b) secreted after co-culture of pDC (black bars) and CD11chigh DC (white bars) from C57Bl/6 mice with infected red blood cells (iRBC, ratio 1:30), normal RBC (uRBC, ratio 1:30) or CpG ODN1668 (10 lg/ml). C) IFNa secreted after co-culture of pDC from wild-type C57BL/6 (black bars) or TLR9 knock-out (TLR9 / , white bars) mice with infected red blood cells (iRBC, ratio 1:30), normal RBC (uRBC, ratio 1: 30), CpG ODN1668 (10 mg/ml) or medium. IFNa and IL12p40 in the supernatants were measured by ELISA assays. The values shown are the mean and S.E.M. of four independent experiments for pDC, and six experiments for CD11chigh DC.  indicates that the differences in cytokine levels between culture containing iRBC and uRBC were significant (P < 0.05) as determined by a Mann Whitney test. Primers used for PCR: IFNa4: Forward: TGGCTGTGAGGACATACTTCCA, Reverse: AGGCCA GAGGCT GTGTTTCTT; IFNaall: Forward:CCTGCTGGCTGTGAGGAAATA, Reverse: AAGACAGGGCTCTCCAGACTTCT; Ubiquitin: Forward: TGGCTA TTAATTATTCGGTCTGCAT, Reverse, GCAAGTGGCTAGAGTGCAGAGTAA. WT, wild-type.

4. Discussion Here we show that both pDC and CD11chigh DC are activated during a blood-stage malaria infection in mice, but only classical CD11chigh DC phagocytose P. chabaudi-iRBC, present antigens and activate CD4 T cells. pDC produce IFNa upon exposure to Plasmodium-iRBC in a TLR9-dependent manner, but the lack of TLR9, IFNab receptor, or depletion of pDC in vivo had only minor effects on a blood-stage P. chabaudi infection. Despite up-regulation of CD40, CD86 and MHC class II on pDC in vivo, MSP1 peptides were only presented on CD11chigh DC. pDC did not phagocytose iRBC and failed to process P. chabaudiiRBC or parasite material in vitro sufficiently to activate MSP1specfic CD4 T cell hybridomas or Tg CD4 T cells. pDC have often

been described as poor inducers of T cell proliferation, but activation of pDC does allow presentation of endogenous antigens, which leads to expansion of memory CD8 T cells (Salio et al., 2004) and naïve CD4 T cells (Krug et al., 2003). However, pDC do not internalise exogenous antigens or load them onto MHC molecules efficiently (Grouard et al., 1997; Salio et al., 2004; Di Pucchio et al., 2008) and enzymes such as cathepsins S and D in the MHC class II compartments are expressed only at low levels in pDC (Fiebiger et al., 2001). Moreover, pDC are unable to accumulate long-lived MHCII–peptide complexes necessary for stimulation of naïve CD4 T cells (Young et al., 2008). Our data contrast with those from an infection with a related protozoa, Toxoplasma gondii, where pDC were activated and presented antigens to naïve CD4 T cells (Bierly et al., 2008). The differ-

718

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

Fig. 5. Lack of the IFNab receptor or depletion of plasmacytoid dendritic cells (pDC) in vivo have only minor impact on a Plasmodium chabaudi infection and accompanying pathology. (A) (a): The course of a P. chabaudi infection in 129 Sv mice (open square) and IFNa/bR / mice (black square); (b): course of a P. chabaudi infection in 129 Sv mice treated with the anti-pDC antibody 120G8 (black triangles) or control Rat IgG (open triangles) as described in Section 2. iRBC,infected red blood cell. (B) The graphs show the percentage loss of weight compared with uninfected mice (day 0). (a): IFNabR / (black bars) and 129 Sv (white bars), (b) 120G8-treated mice (hatched bars) and control Igtreated mice (white bars). (C) Loss of body temperature in IFNabR / (black bars) and 129 Sv mice (white bars, a), and 120G8-treated (hatched bars, b) and control Ig-treated mice (white bars, b). Each graph shows one representative experiment of two performed, and the values are the means and S.E.M. from six mice.  indicates significant differences (P < 0.05), and ns is not significant (Mann Whitney test).

ence may lie in the different locations of the two parasites within DC. Toxoplasma gondii actively infects any cell and develops within a parasitophorous vacuole in the cytoplasm, and therefore could be presented as endogenous antigen on the continuously newly synthesised MHC class II in pDC (Young et al., 2008). By contrast, P. chabaudi cannot infect pDC and only enters by uptake of parasite material; an inefficient process in pDC. Despite the inability to internalise iRBC or activate CD4 T cells, pDC were activated by iRBC to produce TLR9-dependent IFNa in agreement with previous observations on human pDC after culture with P. falciparum in vitro (Pichyangkul et al., 2004). A key question is how Plasmodium induces IFNa production in pDC via intracellular TLR9 when pDC cannot ingest iRBC. The phagocytosis assays, however, only measured uptake of iRBC, and although pDC are not as efficient as CD11high DC in endocytosis, it may be that small fragments or soluble DNA or other soluble parasite ligands not

detectable by our assay are endocytosed in sufficient amounts to ligate TLR9. In support of this, Pichyangkul et al. (2004) demonstrated that pDC up-regulate co-stimulatory molecules in response to soluble P. falciparum extracts in a TLR9-dependent manner (Pichyangkul et al., 2004), suggesting that parasite material does access the TLR9 compartment. However, since TLR9, as reported also by others (Franklin et al., 2007), is not required either for parasite clearance or for regulating acute stage pathology in vivo, we conclude that TLR9 ligation is not a major player in the host response to P. chabaudi. Since pDC were activated by iRBC, we asked whether pDC and signalling through the IFNab receptor were important for protective immunity or pathology. Although IFNa promotes B cell differentiation into mature plasma cells (Poeck et al., 2004), and clearance of parasites depends on antibody in P. chabaudi infections, (Langhorne et al., 1998), parasitemia was not substantially

C. Voisine et al. / International Journal for Parasitology 40 (2010) 711–719

affected by the absence of a functioning IFNabR or the lack of pDC, suggesting that IFNa does not have a major role in clearing parasites but may contribute to early parasite control. The stronger effect on acute stage pathology in IFNabR / mice compared with pDC-depleted mice indicates that IFNab produced early in infection may come from sources in addition to pDC, and/ or that depletion of pDC was not complete, although as observed here and described previously (Asselin-Paturel et al., 2003) these doses of the 120G8 antibody are effective in removing greater than 95–98% of pDC. IFNa is a potent inhibitor of IL-12 and is implicated in regulation of myeloid DC, such as the CD11chigh DC (Montoya et al., 2002). It is possible that without IFNab receptor signalling, increased IL-12 and IFNc induce a greater degree of inflammatory pathology. There is very little information on the importance of IFNab in malaria. However, since our data agree with previous observations that IFNa inhibits cerebral malaria in P. berghei infection (Vigario et al., 2007), and polymorphisms in IFNa Receptor 1 are associated with protection against cerebral malaria in humans (Aucan et al., 2003), a more detailed study of the interaction of Type I IFNs with host inflammatory responses in malaria is warranted. Acknowledgements This work was supported by the Medical Research Council (MRC), UK, (reference U117584248), and is part of the activities of the BioMalPar European Network of Excellence supported by a European Grant (LSHP-CT-2004-503578) from the Priority 1 ‘‘Life Sciences, Genomics and Biotechnology for Health” in the 6th Framework Programme. Beatris Mastelic is in receipt of an MRC Ph.D. studentship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ijpara.2009.11.005. References Ahmad-Nejad, P., Hacker, H., Rutz, M., Bauer, S., Vabulas, R.M., Wagner, H., 2002. Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments. Eur. J. Immunol. 32, 1958–1968. Asselin-Paturel, C., Boonstra, A., Dalod, M., Durand, I., Yessaad, N., DezutterDambuyant, C., Vicari, A., O’Garra, A., Biron, C., Briere, F., Trinchieri, G., 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2, 1144–1150. Asselin-Paturel, C., Brizard, G., Pin, J.J., Briere, F., Trinchieri, G., 2003. Mouse strain differences in plasmacytoid dendritic cell frequency and function revealed by a novel monoclonal antibody. J. Immunol. 171, 6466–6477. Aucan, C., Walley, A.J., Hennig, B.J., Fitness, J., Frodsham, A., Zhang, L., Kwiatkowski, D., Hill, A.V., 2003. Interferon-alpha receptor-1 (IFNAR1) variants are associated with protection against cerebral malaria in the Gambia. Genes Immun. 4, 275– 282. Banchereau, J., Steinman, R.M., 1998. Dendritic cells and the control of immunity. Nature 392, 245–252. Bierly, A.L., Shufesky, W.J., Sukhumavasi, W., Morelli, A.E., Denkers, E.Y., 2008. Dendritic cells expressing plasmacytoid marker PDCA-1 are Trojan horses during Toxoplasma gondii infection. J. Immunol. 181, 8485–8491. Di Pucchio, T., Chatterjee, B., Smed-Sorensen, A., Clayton, S., Palazzo, A., Montes, M., Xue, Y., Mellman, I., Banchereau, J., Connolly, J.E., 2008. Direct proteasomeindependent cross-presentation of viral antigen by plasmacytoid dendritic cells on major histocompatibility complex class I. Nat. Immunol. 9, 551–557. Fiebiger, E., Meraner, P., Weber, E., Fang, I.F., Stingl, G., Ploegh, H., Maurer, D., 2001. Cytokines regulate proteolysis in major histocompatibility complex class IIdependent antigen presentation by dendritic cells. J. Exp. Med. 193, 881–892. Franklin, B.S., Rodrigues, S.O., Antonelli, L.R., Oliveira, R.V., Goncalves, A.M., SalesJunior, P.A., Valente, E.P., Alvarez-Leite, J.I., Ropert, C., Golenbock, D.T., Gazzinelli, R.T., 2007. MyD88-dependent activation of dendritic cells and CD4(+) T lymphocytes mediates symptoms, but is not required for the

719

immunological control of parasites during rodent malaria. Microbes Infect. 9, 881–890. Grouard, G., Rissoan, M.C., Filgueira, L., Durand, I., Banchereau, J., Liu, Y.J., 1997. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)3 and CD40-ligand. J. Exp. Med. 185, 1101–1111. Hoeffel, G., Ripoche, A.C., Matheoud, D., Nascimbeni, M., Escriou, N., Lebon, P., Heshmati, F., Guillet, J.G., Gannage, M., Caillat-Zucman, S., Casartelli, N., Schwartz, O., De la Salle, H., Hanau, D., Hosmalin, A., Maranon, C., 2007. Antigen crosspresentation by human plasmacytoid dendritic cells. Immunity 27, 481–492. Krug, A., Veeraswamy, R., Pekosz, A., Kanagawa, O., Unanue, E.R., Colonna, M., Cella, M., 2003. Interferon-producing cells fail to induce proliferation of naive T cells but can promote expansion and T helper 1 differentiation of antigenexperienced unpolarized T cells. J. Exp. Med. 197, 899–906. Langhorne, J., Cross, C., Seixas, E., Li, C., von der Weid, T., 1998. A role for B cells in the development of T cell helper function in a malaria infection in mice. Proc. Natl. Acad. Sci. USA 95, 1730–1734. Langhorne, J., Ndungu, F.M., Sponaas, A.M., Marsh, K., 2008. Immunity to malaria: more questions than answers. Nat. Immunol. 9, 725–732. Li, C., Sanni, L.A., Omer, F., Riley, E., Langhorne, J., 2003. Pathology of Plasmodium chabaudi chabaudi infection and mortality in interleukin-10-deficient mice are ameliorated by anti-tumor necrosis factor alpha and exacerbated by antitransforming growth factor beta antibodies. Infect. Immun. 71, 4850–4856. Montoya, M., Schiavoni, G., Mattei, F., Gresser, I., Belardelli, F., Borrow, P., Tough, D.F., 2002. Type I interferons produced by dendritic cells promote their phenotypic and functional activation. Blood 99, 3263–3271. Ocana-Morgner, C., Mota, M.M., Rodriguez, A., 2003. Malaria blood stage suppression of liver stage immunity by dendritic cells. J. Exp. Med. 197, 143– 151. Parroche, P., Lauw, F.N., Goutagny, N., Latz, E., Monks, B.G., Visintin, A., Halmen, K.A., Lamphier, M., Olivier, M., Bartholomeu, D.C., Gazzinelli, R.T., Golenbock, D.T., 2007. Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9. Proc. Natl. Acad. Sci. USA 104, 1919–1924. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Pichyangkul, S., Yongvanitchit, K., Kum-arb, U., Hemmi, H., Akira, S., Krieg, A.M., Heppner, D.G., Stewart, V.A., Hasegawa, H., Looareesuwan, S., Shanks, G.D., Miller, R.S., 2004. Malaria blood stage parasites activate human plasmacytoid dendritic cells and murine dendritic cells through a Toll-like receptor 9dependent pathway. J. Immunol. 172, 4926–4933. Poeck, H., Wagner, M., Battiany, J., Rothenfusser, S., Wellisch, D., Hornung, V., Jahrsdorfer, B., Giese, T., Endres, S., Hartmann, G., 2004. Plasmacytoid dendritic cells, antigen, and CpG-C license human B cells for plasma cell differentiation and immunoglobulin production in the absence of T-cell help. Blood 103, 3058– 3064. Quin, S.J., Seixas, E.M., Cross, C.A., Berg, M., Lindo, V., Stockinger, B., Langhorne, J., 2001. Low CD4(+) T cell responses to the C-terminal region of the malaria merozoite surface protein-1 may be attributed to processing within distinct MHC class II pathways. Eur. J. Immunol. 31, 72–81. Salio, M., Palmowski, M.J., Atzberger, A., Hermans, I.F., Cerundolo, V., 2004. CpGmatured murine plasmacytoid dendritic cells are capable of in vivo priming of functional CD8 T cell responses to endogenous but not exogenous antigens. J. Exp. Med. 199, 567–579. Sponaas, A.M., Cadman, E.T., Voisine, C., Harrison, V., Boonstra, A., O’Garra, A., Langhorne, J., 2006. Malaria infection changes the ability of splenic dendritic cell populations to stimulate antigen-specific T cells. J. Exp. Med. 203, 1427– 1433. Stephens, R., Albano, F.R., Quin, S., Pascal, B.J., Harrison, V., Stockinger, B., Kioussis, D., Weltzien, H.U., Langhorne, J., 2005. Malaria-specific transgenic CD4(+) T cells protect immunodeficient mice from lethal infection and demonstrate requirement for a protective threshold of antibody production for parasite clearance. Blood 106, 1676–1684. Trinchieri, G., Sher, A., 2007. Cooperation of Toll-like receptor signals in innate immune defence. Nat. Rev. Immunol. 7, 179–190. Urban, B.C., Ferguson, D.J., Pain, A., Willcox, N., Plebanski, M., Austyn, J.M., Roberts, D.J., 1999. Plasmodium falciparum-infected erythrocytes modulate the maturation of dendritic cells. Nature 400, 73–77. Vigario, A.M., Belnoue, E., Cumano, A., Marussig, M., Miltgen, F., Landau, I., Mazier, D., Gresser, I., Renia, L., 2001. Inhibition of Plasmodium yoelii blood-stage malaria by interferon alpha through the inhibition of the production of its target cell, the reticulocyte. Blood 97, 3966–3971. Vigario, A.M., Belnoue, E., Gruner, A.C., Mauduit, M., Kayibanda, M., Deschemin, J.C., Marussig, M., Snounou, G., Mazier, D., Gresser, I., Renia, L., 2007. Recombinant human IFN-alpha inhibits cerebral malaria and reduces parasite burden in mice. J. Immunol. 178, 6416–6425. Young, L.J., Wilson, N.S., Schnorrer, P., Proietto, A., ten Broeke, T., Matsuki, Y., Mount, A.M., Belz, G.T., O’Keeffe, M., Ohmura-Hoshino, M., Ishido, S., Stoorvogel, W., Heath, W.R., Shortman, K., Villadangos, J.A., 2008. Differential MHC class II synthesis and ubiquitination confers distinct antigen-presenting properties on conventional and plasmacytoid dendritic cells. Nat. Immunol. 9, 1244–1252.