Construction of a starch-inducible homologous expression system to produce cellulolytic enzymes from Acremonium cellulolyticus Hiroyuki Inoue, Tatsuya Fujii, Miho Yoshimi, Larry E. Taylor, Stephen R. Decker, Seiichiro Kishishita, Makoto Nakabayashi, et al. Journal of Industrial Microbiology & Biotechnology Official Journal of the Society for Industrial Microbiology and Biotechnology ISSN 1367-5435 J Ind Microbiol Biotechnol DOI 10.1007/s10295-013-1286-2
1 23
Your article is protected by copyright and all rights are held exclusively by Society for Industrial Microbiology and Biotechnology. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy J Ind Microbiol Biotechnol DOI 10.1007/s10295-013-1286-2
BIOENERGY/BIOFUELS/BIOCHEMICALS
Construction of a starch-inducible homologous expression system to produce cellulolytic enzymes from Acremonium cellulolyticus Hiroyuki Inoue • Tatsuya Fujii • Miho Yoshimi • Larry E. Taylor II Stephen R. Decker • Seiichiro Kishishita • Makoto Nakabayashi • Kazuhiko Ishikawa
•
Received: 28 February 2013 / Accepted: 7 May 2013 Ó Society for Industrial Microbiology and Biotechnology 2013
Abstract A starch-inducible homologous expression system in Acremonium cellulolyticus was constructed to successfully produce recombinant cellulolytic enzymes. A. cellulolyticus Y-94 produced amylolytic enzymes and cellulolytic enzymes as major proteins in the culture supernatant when grown with soluble starch (SS) and Solka–Flock cellulose (SF), respectively. To isolate a strong starch-inducible promoter, glucoamylase (GlaA), which belongs to glycoside hydrolase family 15, was purified from the SS culture of Y-94, and its gene was identified in the genome sequence. The 1.4-kb promoter and 0.4-kb terminator regions of glaA were amplified by polymerase chain reaction (PCR) and used in the construction of a plasmid that drives the expression of the cellobiohydrolase I (Cel7A) gene from A. cellulolyticus. The resultant expression plasmid, containing pyrF as a selection marker, was randomly integrated into the genome of the A. cellulolyticus Y-94 uracil auxotroph. The prototrophic transformant, Y203, produced recombinant Cel7A as an extracellular protein under control of the glaA promoter in the SS culture. Recombinant and wild-type Cel7A were purified from the SS culture of Y203 and the SF culture of A. cellulolyticus CF-2612, respectively. Both enzymes were found to have the same apparent molecular weight (60 kDa), thermostability (Tm 67.0 °C), and
H. Inoue (&) T. Fujii M. Yoshimi S. Kishishita M. Nakabayashi K. Ishikawa Biomass Refinery Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 3-11-32 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-0046, Japan e-mail:
[email protected] L. E. Taylor II S. R. Decker Biosciences Center, National Renewable Energy Laboratory, 15013 Denver West Parkway, Golden, CO 80401, USA
optimum pH (pH 4.5), and showed similar catalytic properties for soluble and insoluble substrates. These results suggest that the A. cellulolyticus starch-inducible expression system will be helpful for characterization and improvement of fungal cellulolytic enzymes. Keywords Acremonium cellulolyticus Protein expression Cellulase production Homologous expression Glucoamylase Cellobiohydrolase I
Introduction The development of lignocellulose conversion technology to produce alternative fuels and chemicals has advanced rapidly over the past few years. Cellulolytic enzymes, such as cellobiohydrolase I (CBHI; Cel7A), cellobiohydrolase II (CBHII), endo-1,4-b-glucanase, and endo-1,4-bxylanase, are key enzymes that hydrolyze cellulose and hemicellulose components in lignocellulosic biomass to glucose and other fermentable sugars, respectively [15, 16]. Filamentous fungi are the major source of industrial cellulolytic enzymes, which are abundantly produced in mutant strains of these fungi, such as in Trichoderma reesei [18]. Heterologous and homologous expression of cellulolytic enzymes have been widely used to develop effective cellulase systems, including strain improvement [25], protein engineering [17], and optimization of enzyme composition [3, 26]. Heterologous expression systems such as Schizosaccharomyces pombe, Pichia pastoris, and Aspergillus awamori have been used to produce Trichoderma cellulolytic enzymes, often with limited success. These expression systems often result in hyperglycosylation, which may negatively impact protein structure, function, and stability
123
Author's personal copy J Ind Microbiol Biotechnol
[2, 3, 9, 13, 23]; on the other hand, the performance of recombinant cellulolytic enzymes would not be impaired when using the homologous expression host [17]. Successful homologous expression of cellulolytic enzymes in T. reesei has been observed in a medium containing glucose, using the constitutive promoters of the tef1, pdc, and eno genes from T. reesei, and the gpdA promoter from Aspergillus nidulans [4, 19, 22]. Acremonium cellulolyticus is one of several fungi that are promising alternatives to T. reesei for use in industrial production of cellulolytic enzymes [10]. Cellulosic carbon sources, such as Solka–Flock cellulose (SF), pretreated rice straw, and waste paper sludge, are strong inducers of cellulase production in A. cellulolyticus [6, 11, 24]. In a previous study, we demonstrated homologous expression of b-xylosidase in A. cellulolyticus, using the cellulose-inducible cbh1 promoter, to improve xylan digestibility in the Acremonium cellulase system [14]. However, a cellulose-inducible expression system may not be suitable for improvement and characterization of recombinant cellulolytic enzymes, because a variety of cellulolytic enzymes that have similar enzymatic activities and molecular weights are simultaneously produced in cellulose cultures of A. cellulolyticus [29, 30]. These facts significantly increase the difficulties faced in detecting and purifying recombinant cellulolytic enzymes for further characterization. In this study, we developed a starch-inducible homologous expression system in A. cellulolyticus to express cellulolytic enzymes. Cel7A, which is recognized as the most important single enzyme component in the fungal cellulase system, was used as a model protein to evaluate this expression system. A gene encoding glucoamylase (GlaA), a major protein in starch culture, was identified in the A. cellulolyticus genome sequence. Using the glaA promoter and terminator regions, an expression plasmid
was constructed. Our results demonstrate that the recombinant Cel7A (rCel7A) purified from the soluble starch (SS) culture of A. cellulolyticus exhibits similar physicochemical and enzymatic properties to those of wild-type Cel7A (wtCel7A) purified from SF culture.
Materials and methods Fungal strains and plasmids The fungal strains and plasmids used in this study are summarized in Table 1. Acremonium cellulolyticus Y-94 wild type (FERM BP-5826) [28] and CF-2612 high-cellulase-producing mutant (FERM BP-10848) [6] were maintained on potato dextrose agar plates. The A. cellulolyticus YP-4 uracil autotroph mutant was isolated from Y-94 according to the method of Fujii et al. [7] in this study and maintained on potato dextrose agar plates containing uracil and uridine at final concentrations of 1 g/L each. Transformants of A. cellulolyticus YP-4 were maintained on MM agar plates [7]. Production of amylolytic and cellulolytic enzymes Y-94 and YP-4 transformants were grown on a medium (pH 4.0) containing, per liter: 20 g carbon source, 24 g KH2PO4, 1 g Tween 80, 5 g (NH4)2SO4, 1.2 g MgSO47H2O, 0.01 g ZnSO47H2O, 0.01 g MnSO46H2O, 0.01 g CuSO47H2O, and 0.8 g urea, at 30 °C, 200 rpm, for 96 h in an Erlenmeyer flask. SS (Wako Pure Chemical Industries, Osaka, Japan), SF (Fiber Sales & Development, Urbana, OH, USA), or glycerol was used as carbon source. CF-2612 was grown on the same medium containing 50 g of SF/L and 4.0 g of urea/L as described previously [6].
Table 1 Fungal strains and plasmids Strain or plasmid
Description
References
A. cellulolyticus Y-94
Wild type (FERM BP-5826)
[28]
CF-2612
High-cellulase-producing mutant (FERM BP-10848) to produce wtCel7A, source of cel7A and glaA promoter and terminator regions
[6]
YP-4
Host strain for homologous expression, uracil autotroph mutant of Y-94
This study
Y202
YP-4 prototrophic transformant harboring pANC202
This study
Y203
YP-4 prototrophic transformant harboring pANC203 to produce rCel7A
This study
Ampr PyrFr; pBluescript KS(?) derivative containing 2.7-kb fragment harboring pyrF from Y-94
[7]
Strain
Plasmid pbs-pyrF
r
r
pANC202
Amp PyrF ; expression vector, pbs-pyrF derivative containing 1.4-kb promoter and 0.4-kb terminator regions of glaA
This study
pANC203
Ampr PyrFr; expression vector of cel7A, pANC202 derivative containing cel7A
This study
123
Author's personal copy J Ind Microbiol Biotechnol
Construction of expression plasmid
Transformation of the A. cellulolyticus uracil auxotroph
A plasmid pbs-pylF [7], containing the A. cellulolyticus orotate phosphoribosyltransferase gene (pyrF) as a selection marker inserted into pBluescript KS(?), was used to construct the expression plasmid pANC202 (Fig. 1). A. cellulolyticus CF-2612 chromosomal DNA was used as the template to amplify genes that were then introduced into the expression vector. The chromosomal DNA was prepared using the QIAGEN Genomic-tip 100/G together with Genomic DNA Buffer Set (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The 1.4-kb promoter region of the glucoamylase gene (glaA) was amplified by PCR using the forward primer 50 -TAAGAATTCTGAA GATCGAAAGTATTTACATG with an EcoRI site (underlined) and the reverse primer 50 -TATGATATCAATA GACAGACTTCAAGGTTCGG with an EcoRV site (underlined). The 0.4-kb terminator region of glaA was amplified using the forward primer 50 -TTTGATATCCTG CAGGAGAATTACCGGGGTAGGATATG with EcoRV and SbfI sites (underlined) and the reverse primer 50 -TAAGTCGACTCGACTGATTACTAATCGTTTGAT AG with a SalI site (underlined). The primers for the promoter and terminator regions were designed based on information obtained from an A. cellulolyticus genome database (unpublished data). The Cel7A gene (cbh1) [21] was amplified using the forward primer 50 -ATTGTTAA CACAATGTCTGCCTTGAACTCTTTCA with an HpaI site (underlined) and the reverse primer 50 -AATCCTG CAGGTTACAAACATTGAGAGTAGTAAGG with an SbfI site (underlined). The 1.4-kb PCR fragment of the glaA promoter region was digested with EcoRI/EcoRV, and ligated into the EcoRI/EcoRV site of pbs-pylF. The 0.4-kb terminator fragment digested with EcoRV/SalI was ligated into EcoRV/SalI of the resulting plasmid to obtain pANC202 (Fig. 1). The cbh1 expression plasmid pANC203 was constructed by introducing the cbh1 fragment digested with HpaI/SbfI into the EcoRV/SbfI of pANC202. All ligated gene fragments and their ligation sites were verified by sequencing.
Protoplasts of A. cellulolyticus YP-4 were transformed with pANC202 or pANC203 by nonhomologous integration into the host chromosomal DNA [7]. The gene integrated into the prototrophic transformants was verified by genomic PCR, using the forward primer for the glaA promoter region and the reverse primer 50 -GAAACAGC TATGACCATGATTACGC within the downstream of the 30 -end of the glaA terminator on pANC202. The chromosomal DNA of the transformants was purified using the Gentra Puregene Yeast/Bact. Kit (Qiagen).
EcoRV
1 kb XbaI
pANC202
SbfI
GATATCCTGCAGG CTATAGGACGTCC Cloning site EcoRI
pyrF
SalI
PglaA
TglaA
Fig. 1 Restriction map of the expression vector pANC202. The 1.4kb promoter region (PglaA) and 0.4-kb terminator region (TglaA) from glaA and the pyrF gene containing its original promoter and terminator region were inserted into the XbaI–SalI site of the plasmid vector pBluescript KS(?)
Purification and identification of GlaA The Y-94 culture grown in medium containing 20 g SS/L was centrifuged, and the resulting supernatant was filtered through a 0.22-lm polyether sulfone membrane. The culture filtrate was loaded onto a HiPrep 26/10 desalting column (GE Healthcare, Buckinghamshire, UK) equilibrated with 20 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer, pH 6.5 (buffer A). The desalted sample was subjected to anion-exchange chromatography on a Source 15Q column (GE Healthcare) equilibrated with the same buffer, and the protein was eluted with a linear gradient of 0–0.25 M NaCl. Fractions with GlaA activity were pooled, brought to 1.4 M (NH4)SO4, and subjected to hydrophobic interaction chromatography on a Source 15ISO column (GE Healthcare) with a 1.4–0.8 M (NH4)SO4 gradient in 20 mM sodium acetate buffer, pH 5.5 (buffer B). The eluted GlaA fractions were pooled, desalted, and stored in buffer B containing 0.01 % NaN3 at 4 °C. The purity and size of the protein were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). SDS-PAGE clean-up kit (GE Healthcare) was used prior to SDS-PAGE analysis of the culture supernatant. The GlaA in the gel was digested by lysyl endopeptidase. The resulting peptide fragments were separated by reversed-phase high-performance liquid chromatography (HPLC) and collected, and the amino acid sequence was determined by using a Procise 494-HT protein sequencer (Applied Biosystems, Foster City, CA, USA). The glaA coding region in the genome sequence of A. cellulolyticus was searched using the gene analysis software in silico Molecular Cloning (in silico Biology, Yokohama, Japan) based on the internal amino acid sequence. The nucleotide sequence of glaA, including the promoter and terminator regions, was submitted to the DDBJ/EMBL/ GenBank database under accession number AB781686. Purification and identification of Cel7A wtCel7A was purified from a CF-2612 culture grown in the medium containing 50 g of SF/L. The culture filtrate was
123
Author's personal copy J Ind Microbiol Biotechnol
desalted with buffer A. The desalted sample was applied to a Source 15Q column equilibrated with the same buffer, and the protein was eluted with a linear gradient of 0–0.25 M NaCl. The presence of Cel7A in the eluted fractions was determined by assaying for activity on p-nitrophenyl b-D-lactoside (PNP-Lac) and Avicel PH101. The Cel7A fractions were pooled, brought to 1.2 M (NH4)SO4, and applied to a Source 15ISO column with a 1.2–0 M (NH4)SO4 gradient in buffer B. The eluted major Cel7A fractions were pooled and subjected to affinity chromatography on a 4-aminophenyl b-D-cellobiosideconjugated Affi-Gel 10 column (Bio-Rad, Hercules, CA, USA) [1] equilibrated with buffer B containing 20 mM gluconolactone. Cel7A was eluted with buffer B containing 20 mM gluconolactone and 40 mM cellobiose. Cel7A was once again bound to the Source 15Q column equilibrated with buffer A, washed with the same buffer, and eluted with a linear gradient of 0–0.5 M NaCl. The eluted enzyme was stored in buffer B containing 0.01 % NaN3 at 4 °C. The purity and size of Cel7A was analyzed by SDSPAGE. The identification of Cel7A was verified by analyzing the peptide fragment masses of the purified enzyme (Stanford Mass Spectrometry Services, Stanford University, Stanford, CA, USA). rCel7A was purified from a Y203 (YP-4 transformed with pANC203) culture grown in medium containing 20 g of SS/L. rCel7A was purified and stored by the same procedure used for wtCel7A. Enzyme assay Glucoamylase and a-glucosidase activities were measured using a glucoamylase/a-glucosidase assay kit (Kikkoman, Chiba, Japan), and a-amylase activity was determined using an a-amylase assay kit (Kikkoman) according to the manufacturer’s instructions. One unit of glucoamylase and a-glucosidase activity was defined as the amount of enzyme that catalyzed the formation of 1 lmol PNP per minute from PNP-b-D-maltoside (with b-glucosidase in the kit) and PNP-a-D-glucoside at 37 °C, respectively. One unit of a-amylase activity was defined as the amount of enzyme that catalyzed the formation of 1 lmol 2-chloro-4nitrophenol per minute from 2-chloro-4-nitrophenyl 65azido-65-deoxy-b-maltopentaose (with b-glucosidase in the kit) at 37 °C. Glucoamylase activity was also assessed by determining the amount of glucose released from 1 % SS, 10 mM maltoheptaose, or 10 mM maltose in 50 mM sodium acetate (pH 5.0) at 37 °C. The concentration of glucose was measured by using a BF-5 biosensor with a glucose oxidase electrode (Oji Scientific Instruments, Amagasaki, Japan). Carboxymethyl cellulase (CMCase) activity was measured by assaying the reducing sugars released after 30 min
123
of enzyme reaction with 1 % carboxymethyl cellulose (CMC, low viscosity) at pH 5.0 and 45 °C. b-Xylanase activity was measured using 1 % (w/v) birchwood xylan using the same method as for CMCase activity. Avicelase activity was determined by analyzing the reducing sugars released after 60 min in the reaction mixture with 20 mg of Avicel PH 101/mL at pH 5.0 and 45 °C. The reducing sugars were detected by reaction with 3,5-dinitrosalicylic acid. One unit of enzyme activity was defined as the amount of enzyme that catalyzed the formation of 1 lmol of reducing sugar per minute. b-Glucosidase and Cel7A activities were determined using PNP-b-D-glucoside and PNP-Lac, respectively, at pH 5.0 and 45 °C in reaction mixtures including 1 mM PNP substrate. One unit of these enzyme activities was defined as the amount of enzyme that catalyzed the formation of 1 lmol PNP per minute. Protein concentration was determined by using the BCA protein assay reagent (Pierce, Rockford, IL, USA), using bovine serum albumin as the protein standard. All measurements were performed in triplicate. Protein thermal shift assay The fluorescence-based thermal shift assay [20] was performed in a 96-well plate format, with a volume of 20 lL per well, using a real-time PCR detection system (CFX Connect, Bio-Rad). The protein sample was diluted to 0.1 mg/mL in 50 mM sodium acetate buffer, pH 5.0, and SYPRO orange dye [5,000-fold stock solution in dimethyl sulfoxide (DMSO); Invitrogen, Carlsbad, CA, USA] was added at fivefold final concentration. The sample was heated at 0.5 °C per 5 s from 25 to 85 °C. The fluorescence intensity (Ex/Em: 450–490 nm/560–580 nm) was measured every 0.5 °C. Protein melting temperatures (Tm) were determined by the CFX Manager Program (Bio-Rad) based on the calculation of the negative first derivative.
Results and discussion Production of amylolytic enzymes in A. cellulolyticus In a previous study, Yamanobe et al. [28] reported that A. cellulolyticus Y-94 displayed not only cellulolytic activity but also amylolytic activity for starch in culture grown with cellulose. We recently found that the Acremonium commercial cellulase preparation was highly efficient in saccharification of potato pulp starch [8]. Based on these observations, we examined the production of amylolytic enzymes (a-amylase, glucoamylase, a-glucosidase) using SS or SF as carbon source. A. cellulolyticus Y-94 was cultured in medium containing 20 g SS or 20 g SF by adding a 5 % culture
Author's personal copy J Ind Microbiol Biotechnol Table 2 Enzyme production of A. cellulolyticus Y-94 in starch and cellulose cultures Enzyme
Specific activity (U/mg) in SS culture (A)
a
SF culture (B)
Ratio (A/B) b
a-Amylase
1.143
0.036
31.8
Glucoamylase
0.865 ± 0.007
0.086 ± 0.001
10.1
a-Glucosidase Avicelase
0.136 0.09 ± 0.015
0.032 0.77 ± 0.09
4.25 0.12
CMCase
0.32 ± 0.018
4.79 ± 0.08
0.07
Xylanase
0.79 ± 0.03
4.79 ± 0.08
0.16
b-Glucosidase
2.59
2.11 ± 0.03
1.23
a
The enzymes were produced in a culture containing 20 g soluble starch/L as carbon source
b
The enzymes were produced in a culture containing 20 g Solka– Flock/L as carbon source
solution grown in medium containing 20 g glycerol, which is neither an inducer nor a repressor of the production of cellulolytic enzymes in A. cellulolyticus [12]. Y-94 produced 1.1 ± 0.03 and 3.1 ± 0.08 g/L of extracellular protein in the SS and SF culture conditions, respectively. A small quantity of amylolytic enzymes was observed in the SF culture (Table 2), supporting previous evidence for starch degradation. Furthermore, the activities of a-amylase and glucoamylase were significant in the SS culture (Table 2). These enzymes in the SS culture exhibited 10- to 30-fold higher specific activities than those in the SF culture, indicating that they are starch-inducible enzymes. On the other hand, cellulase (Avicelase and CMCase) and xylanase were hardly detectable in the SS culture (Table 2). These results suggest that A. cellulolyticus has different inducible systems for the production of cellulolytic and amylolytic enzymes. Therefore, a starch-inducible homologous expression system is expected to be effective in producing a recombinant cellulolytic enzyme, reducing the contamination from other cellulolytic enzymes induced in the SF culture. Interestingly, the same levels of b-glucosidase activity were observed in both cultures. b-Glucosidase plays an important role in cellulose degradation to produce glucose from cellobiose; however, its role in starch metabolism remains unknown.
glucoamylase based on preliminary analyses (SDS-PAGE and enzyme assay) of the fractions separated by anionexchange chromatography (data not shown), and was purified to homogeneity by further chromatography (Fig. 2, lane 2). The specific activity of the purified enzyme was 2.59 and 0.21 U/mg for PNP-b-D-maltoside and PNP-a-Dglucoside, respectively. Amylase activity using 2-chloro-4nitrophenyl 65-azido-65-deoxy-b-maltopentaose was not detected for the purified enzyme. Glucoamylase (a-l,4glucan glucohydrolase, EC 3.2.1.3) catalyzes hydrolysis of terminal a-1,4-linked D-glucose residues successively from the nonreducing ends of amylose chains with release of D-glucose. The production rates of glucose from SS (45.8 ± 0.39 lmol glucose min-1 mg-1 protein) and maltoheptaose (46.0 ± 0.33 lmol glucose min-1 mg-1 protein) were nearly identical, whereas the production rate from maltose (8.56 ± 0.10 lmol glucose min-1 mg-1 protein) was significantly lower, indicating that cleavage of the a-1,4 glycoside bond in maltose was 10-fold lower than in SS and maltoheptaose. This demonstrates that the purified enzyme is a glucoamylase, preferring the increased degree of polymerization of malto-oligosaccharides as substrates, rather than a-glucosidase [31]. A gene encoding the glucoamylase was discovered by searching the A. cellulolyticus genomic sequence for the internal amino acid (aa) residues TYADGYMSIAQT of the purified glucoamylase. The glucoamylase coding region (glaA) in the chromosome included three introns kDa
M
1
2
198
97
64 51
39
Purification and identification of A. cellulolyticus glucoamylase To obtain a strong promoter suitable for use in a starchinducible protein expression system, we identified the major protein induced in SS culture. SDS-PAGE analysis of the SS culture supernatant from Y-94 revealed the presence of a major protein with apparent molecular mass of 68 kDa (Fig. 2, lane 1). This protein was considered a
28
Fig. 2 SDS-PAGE analysis of glucoamylase from A. cellulolyticus Y-94. Lanes: M protein marker, 1 culture supernatant of Y-94 grown in SS culture, 2 purified glucoamylase
123
Author's personal copy J Ind Microbiol Biotechnol
(AB781686). The deduced open reading frame was 1,924 bp and encoded 638 aa. A BLAST search (blastp) and Conserved Domain Database search in the National Center for Biotechnology Information (NCBI) revealed that GlaA consists of an N-terminal domain of glycoside hydrolase family 15 (GH15) and a C-terminal carbohydrate-binding module 20 (CBM20) connected by a Ser/ Thr-rich linker region. GlaA exhibited high similarities with ascomycete GH15 glucoamylases, sharing the same domain architecture, with 66 % identity to Aspergillus awamori (640 aa, 1508161A) and 62 % identity to Rasamsonia emersonii (618 aa, CAC28076). Homologous expression of recombinant Cel7A in A. cellulolyticus The promoter and terminator regions of starch-inducible glaA were isolated and used to construct a new expression plasmid. The resultant plasmid pANC202 was designed to enable the expression of various cellulolytic enzymes under the control of the glaA promoter together with pyrF as a selection marker (Fig. 1). The various gene cassettes can be inserted into two specific cloning sites, namely EcoRV (blunt-end restriction site) and SbfI (8-base restriction site), in pANC202. In addition, the new host strain YP-4, which is a uracil autotroph mutant, was isolated from ultraviolet (UV)-irradiated protoplasts of wildtype A. cellulolyticus Y-94. The transformation efficiency of YP-4 was increased more than 20-fold (18.7 ± 3.8 transformants lg-1 pANC202), when compared with that of Y-94 using hph as the selective marker described previously [14]. This increased transformation efficiency is beneficial; because of the variability that occurs when using nonhomologous integration of the target gene, it is necessary to screen a number of transformants to identify clones with high expression levels. Most cellulolytic enzymes secreted by fungi are glycoproteins. Cel7A, which is the most abundant and important enzyme in industrially relevant fungal cellulolytic systems, has both O- and N-linked glycosylation sites, and its successful heterologous expression has been limited due to stringent co- and posttranslational requirements, including the formation of multiple disulfide bridges and native-like glycosylation [2]. Therefore, we selected A. cellulolyticus Cel7A as a model protein to verify successful homologous expression using the pANC202 expression system. A Y203 transformant harboring pANC203 has enabled the homologous expression of extracellular rCel7A under the 20 g SS/L culture condition, during which endogenous Cel7A is hardly produced. A 60-kDa protein was detected by SDS-PAGE analysis of the culture supernatant from Y203 (Fig. 3, lane 2). The protein band of similar size was also detected in the culture supernatant from Y202, a
123
kDa
M
1
2
3
4
5
M
198 97
64 51 39 28
Fig. 3 SDS-PAGE analysis of Cel7A. Lanes: M protein marker, 1 culture supernatant of A. cellulolyticus Y202 grown in SS culture (control), 2 culture supernatant of A. cellulolyticus Y203 grown in SS culture, 3 rCel7A purified from Y203, 4 wtCel7A purified from A. cellulolyticus CF-2612 grown in SF culture, 5 culture supernatant of A. cellulolyticus CF-2612 grown in SF culture
transformant harboring the pANC202 control plasmid lacking the cbh1 gene sequence (Fig. 3, lane 1). The Cel7A activities in the supernatant of Y203 and Y202 were 35.9 and 2.1 mU/mg, respectively, using PNP-Lac as substrate, strongly suggesting that the protein expressed in Y203 but not Y202 was rCel7A. The specific activities of amylolytic enzymes were similar between Y203 and Y202 regardless of the overexpression of rCel7A (data not shown). This observation implies that the production of amylolytic enzymes is not negatively influenced by the introduction of additional glucoamylase promoters. The culture supernatants of A. cellulolyticus in the SF and SS culture conditions showed different expression patterns on SDS-PAGE (Fig. 3, lanes 1, 2, 5). The protein corresponding to glucoamylase (68 kDa) was not observed in the SF culture supernatant. The 60-kDa protein, a major band in the SF culture supernatant, was expected to be wtCel7A; however, it should be noted that other cellulolytic enzymes having similar activity and molecular weights are also produced in cellulose culture of A. cellulolyticus [29, 30]. Characterization of recombinant and wild-type Cel7A wtCel7A was purified to an electrophoretically homogeneous form from the cellulose culture of A. cellulolyticus CF-2612. Cellobiose-conjugated affinity chromatography was found to be highly effective in removing b-glucosidase activity in the Cel7A fraction. Peptide fragment masses from purified wtCel7A were assigned to the primary structure of A. cellulolyticus Cel7A (Table 3), corresponding to 18 % amino acid sequence coverage for Cel7A. Although A. cellulolyticus Cel7A has been
Author's personal copy J Ind Microbiol Biotechnol
identified as the major protein in cellulose culture [21], to our knowledge, this is the first example of Cel7A purified from A. cellulolyticus. The purified wtCel7A displayed maximum activity at pH 4.5 and fourfold higher performance on PNP-Lac than on PNP-b-D-cellobioside (PNPCel) (Table 4). No activity was detected toward CMC and PNP-b-D-glucoside (data not shown). The purification of rCel7A was achieved using the same chromatography techniques. The yield of purified rCel7A was approximately 20 mg/L in the Y203 culture supernatant; this will be sufficient for detailed structural and kinetic studies in the future. The apparent molecular masses of rCel7A and wtCel7A on SDS-PAGE gel were nearly identical at about 60 kDa (Fig. 3, lanes 3, 4), and their SDS-PAGE bands seemed to be broader. The molecular weight of the purified proteins was higher than the calculated molecular mass (54,962 kDa) of Cel7A. These observations suggest that the molecular weights of the purified proteins were increased due to glycosylation. The band of wtCel7A appears more diffuse than that of rCel7A, probably due to increased microheterogeneity of glycosylation resulting from inherent differences in culture conditions, i.e., carbon source and urea concentration [5].
Table 3 Identification of peptides in purified A. cellulolyticus Cel7A Residues
MS/MS peptide sequence
46–64
K.SGGSCTTNSGAITLDANWR.W
117–129
R.LNFVTGSNVGSR.T
185–200
K.AGAQYGVGYCDSQCPR.D
274–289
R.YAGTCDPDGCDFNPYR.L
290–300
R.LGVTDFYGSGK.T
331–345
R.YYVQNGVVIPQPSSK.I
A. cellulolyticus Y-94 produced a large amount of extracellular proteins in the SF culture rather than in the SS culture. The differences in the protein expression level between the SF and SS cultures may also contribute to the microheterogeneity of glycosylation. These conditions should not be confused with the far more dramatic hyperglycosylation which occurs in heterologous expression. rCel7A and wtCel7A had identical protein melting temperature and optimum pH, and highly similar substrate specificity toward soluble and insoluble substrates (Table 4). These results demonstrate that both proteins undergo similar posttranslational events and protein folding during the secretion process in the SS and SF culture conditions, and are for all practical purposes, identical. The starch-inducible homologous expression system designed in this study will enable the construction and evaluation of various A. cellulolyticus cellulolytic enzymes: not only Cel7A but also CBHII, endo-1,4-bglucanase, and endo-1,4-b-xylanase, including mutant forms of these proteins and other putative enzymes of interest encoded in the genome. Cellulolytic enzymes produced in SS culture allow for much easier detection and purification, due to the clean cellulase background resulting from SS culture. Refinements to the designs of homologous expression systems for these enzymes are ongoing. Recently, analysis of transcripts from A. cellulolyticus has shown high similarity with putative genes from the genomic sequences of Talaromyces marneffei and Talaromyces stipitatus [12]. Some species of Talaromyces are known to produce highly effective cellulases [10, 27], thus the A. cellulolyticus protein expression system could also be applied for heterologous expression of cellulolytic enzymes from Talaromyces or other species of interest. Acknowledgments This work was supported by the Japan–US cooperation project for research and standardization of Clean Energy Technologies.
Table 4 Physicochemical and enzymatic properties of Cel7A from A. cellulolyticus Property
rCel7A
wtCel7A
60
60
Thermostability (°C)
67.0
67.0
Optimum pHc
4.5
4.5
Avicel (U/mg) PNP-Cel (U/mg)
0.222 ± 0.013 0.045 ± 0.001
0.204 ± 0.008 0.047
PNP-Lac (U/mg)
0.188 ± 0.001
0.186 ± 0.003
Molecular weight (kDa)a b
Substrate specificity
a
The apparent molecular weight of the protein was determined by SDS-PAGE
b
Thermostability was determined by thermal shift assay as described in ‘‘Materials and methods’’
c
Optimum pH of enzyme activity was determined using PNP-Lac as substrate in McIlvaine’s buffer (pH 3.0–6.0)
References 1. Adney WS, Chou YC, Decker SR, Ding SY, Baker JO, Kunkel G, Vinzant TB, Himmel ME (2003) Heterologous expression of Trichoderma reesei 1,4-b-D-glucan cellobiohydrolase (Cel 7A). In: Mansfield SD, Saddler J (eds) Applications of enzymes to lignocellulosics, vol 855. Amer Chemical Soc, Washington, pp 403–437 2. Adney WS, Jeoh T, Beckham GT, Chou YC, Baker JO, Michener W, Brunecky R, Himmel ME (2009) Probing the role of N-linked glycans in the stability and activity of fungal cellobiohydrolases by mutational analysis. Cellulose 16:699–709 3. Banerjee G, Car S, Scott-Craig JS, Borrusch MS, Aslam N, Walton JD (2010) Synthetic enzyme mixtures for biomass deconstruction: production and optimization of a core set. Biotechnol Bioeng 106:707–720 4. Colle´n A, Ward M, Tjerneld F, Sta˚lbrand H (2001) Genetic engineering of the Trichoderma reesei endoglucanase I (Cel7B)
123
Author's personal copy J Ind Microbiol Biotechnol
5.
6.
7.
8.
9.
10. 11.
12.
13.
14.
15.
16.
17.
18.
for enhanced partitioning in aqueous two-phase systems containing thermoseparating ethylene oxide–propylene oxide copolymers. J Biotechnol 87:179–191 Eriksson T, Stals I, Colle´n A, Tjerneld F, Claeyssens M, Sta˚lbrand H, Brumer H (2004) Heterogeneity of homologously expressed Hypocrea jecorina (Trichoderma reesei) Cel7B catalytic module. Eur J Biochem 271:1266–1276 Fang X, Yano S, Inoue H, Sawayama S (2009) Strain improvement of Acremonium cellulolyticus for cellulase production by mutation. J Biosci Bioeng 107:256–261 Fujii T, Iwata K, Murakami K, Yano S, Sawayama S (2012) Isolation of uracil auxotrophs of the fungus Acremonium cellulolyticus and the development of a transformation system with the pyrF gene. Biosci Biotechnol Biochem 76:245–249 Gao MT, Yano S, Inoue H, Sakanishi K (2012) Production of ethanol from potato pulp: investigation of the role of the enzyme from Acremonium cellulolyticus in conversion of potato pulp into ethanol. Process Biochem 47:2110–2115 Godbole S, Decker SR, Nieves RA, Adney WS, Vinzant TB, Baker JO, Thomas SR, Himmel ME (1999) Cloning and expression of Trichoderma reesei cellobiohydrolase I in Pichia pastoris. Biotechnol Prog 15:828–833 Gusakov AV (2011) Alternatives to Trichoderma reesei in biofuel production. Trends Biotechnol 29:419–425 Hideno A, Inoue H, Tsukahara K, Yano S, Fang X, Endo T, Sawayama S (2011) Production and characterization of cellulases and hemicellulases by Acremonium cellulolyticus using rice straw subjected to various pretreatments as the carbon source. Enzyme Microb Technol 48:162–168 Hideno A, Inoue H, Fujii T, Yano S, Tsukahara K, Murakami K, Yunokawa H, Sawayama S (2013) High-coverage gene expression profiling analysis of the cellulase-producing fungus Acremonium cellulolyticus cultured using different carbon sources. Appl Microbiol Biotechnol. doi:10.1007/s00253-013-4689-0 Jeoh T, Michener W, Himmel ME, Decker SR, Adney WS (2008) Implications of cellobiohydrolase glycosylation for use in biomass conversion. Biotechnol Biofuels 1:10 Kanna M, Yano S, Inoue H, Fujii T, Sawayama S (2011) Enhancement of b-xylosidase productivity in cellulase producing fungus Acremonium cellulolyticus. AMB Express 1:15 Karimi K, Emtiazi G, Taherzadeh MJ (2006) Ethanol production from dilute-acid pretreated rice straw by simultaneous saccharification and fermentation with Mucor indicus, Rhizopus oryzae, and Saccharomyces cerevisiae. Enzyme Microb Technol 40:138–144 Kim S, Dale BE (2004) Global potential bioethanol production from wasted crops and crop residues. Biomass Bioenergy 26:361–375 Lantz SE, Goedegebuur F, Hommes R, Kaper T, Kelemen BR, Mitchinson C, Wallace L, Stahlberg J, Larenas EA (2010) Hypocrea jecorina CEL6A protein engineering. Biotechnol Biofuels 3:20 Le-Crom S, Schackwitz W, Pennacchio L, Magnuson JK, Culley DE, Collett JR, Martin J, Druzhinina IS, Mathis H, Monot F,
123
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
Seiboth B, Cherry B, Rey M, Berka R, Kubicek CP, Baker SE, Margeot A (2009) Tracking the roots of cellulase hyperproduction by the fungus Trichoderma reesei using massively parallel DNA sequencing. Proc Natl Acad Sci USA 106:16151–16156 Li J, Wang J, Wang S, Xing M, Yu S, Liu G (2012) Achieving efficient protein expression in Trichoderma reesei by using strong constitutive promoters. Microb Cell Fact 11:84 Lo MC, Aulabaugh A, Jin G, Cowling R, Bard J, Malamas M, Ellestad G (2004) Evaluation of fluorescence-based thermal shift assays for hit identification in drug discovery. Anal Biochem 332:153–159 Midoh N, Sumida N, Okakura K, Murakami T, Yamanobe T (2009) New promoter for expressing protein products. Japanese patent JP4257759 Nakari-Setala T, Penttila M (1995) Production of Trichoderma reesei cellulases on glucose-containing media. Appl Environ Microbiol 61:3650–3655 Okada H, Sekiya T, Yokoyama K, Tohda H, Kumagai H, Morikawa Y (1998) Efficient secretion of Trichoderma reesei cellobiohydrolase II in Schizosaccharomyces pombe and characterization of its products. Appl Microbiol Biotech 49:301–308 Prasetyo J, Zhu J, Kato T, Park EY (2011) Efficient production of cellulase in the culture of Acremonium cellulolyticus using untreated waste paper sludge. Biotechnol Prog 27:104–110 Rahman Z, Shida Y, Furukawa T, Suzuki Y, Okada H, Ogasawara W, Morikawa Y (2009) Application of Trichoderma reesei cellulase and xylanase promoters through homologous recombination for enhanced production of extracellular b-glucosidase I. Biosci Biotech Biochem 73:1083–1089 Rosgaard L, Pedersen S, Langston J, Akerhielm D, Cherry JR, Meyer AS (2007) Evaluation of minimal Trichoderma reesei cellulase mixtures on differently pretreated barley straw substrates. Biotechnol Prog 23:1270–1276 Samson RA, Yilmaz N, Houbraken J, Spierenburg H, Seifert KA, Peterson SW, Varga J, Frisvad JC (2011) Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium. Stud Mycol 70:159–183 Yamanobe T, Mitsuishi Y, Takasaki Y (1987) Isolation of cellulolytic enzyme producing microorganism, culture conditions and some properties of the enzymes. Agric Biol Chem 51:65–74 Yamanobe T, Mitsuishi Y, Yagisawa M (1988) Purification and some properties of a microcrystalline cellulose-hydrolyzing enzyme (avicelase II) from fungal strain Y-94. Agric Biol Chem 52:2493–2501 Yamanobe T, Mitsuishi Y (1990) Purification of endo-1,4-bglucanase components from fungal strain Y-94. Agric Biol Chem 54:301–307 Yoon JJ, Igarashi K, Kajisa T, Samejima M (2006) Purification, identification and molecular cloning of glycoside hydrolase family 15 glucoamylase from the brown-rot basidiomycete Fomitopsis palustris. FEMS Microbiol Lett 259:288–294
