CWH41 encodes a novel endoplasmic reticulum membrane N-glycoprotein involved in beta 1, 6-glucan assembly

JOURNAL OF BACTERIOLOGY, Feb. 1996, p. 1162–1171 0021-9193/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 178, No. 4

CWH41 Encodes a Novel Endoplasmic Reticulum Membrane N-Glycoprotein Involved in b1,6-Glucan Assembly BO JIANG,1 JANE SHERATON,1 ARTHUR F. J. RAM,2 GERRIT J. P. DIJKGRAAF,3 FRANS M. KLIS,2 1 AND HOWARD BUSSEY * Department of Biology, McGill University, Montreal, Quebec, Canada H3A 1B1,1 and Institute for Molecular Cell Biology, BioCentrum Amsterdam, 1098 SM Amsterdam, The Netherlands2 Received 12 September 1995/Accepted 7 December 1995

KRE5 encodes a putative soluble endoplasmic reticulum (ER) protein that has extensive sequence homologies with a Drosophila ER glucosyltransferase (32, 37). The kre5D-null mutant failed to make any detectable amount of the polymer, indicating that Kre5p is essential for b1,6-glucan synthesis. Kre6p and Skn1p are a pair of functional homologs (43–45). They are both type II integral membrane glycoproteins, and the Kre6p protein has been localized in the Golgi apparatus. The C-terminal domains of Kre6p and Skn1p display significant sequence similarities to two glucan-binding proteins. Deletion of both KRE6 and SKN1 genes caused a major reduction (70 to 80%) in b1,6-glucan levels, consistent with both Kre6p and Skn1p playing direct functional roles in the synthesis of b1,6-glucan. KRE1 codes for a serine- and threonine-rich protein located on the cell surface (1). Disruption of the KRE1 gene leads to a 40% reduction in the level of b1,6-glucan. Polysaccharide structural analysis indicated that the b1,6-glucan made by the kre1D-null mutant had a reduced polymer size and contained fewer b1,6-linked residues than did the wildtype polymer. These results suggested that Kre1p may play a role to add or extend b1,6-linked side chains at the cell surface. KRE9 is the structural gene for a small serine- and/or threonine-rich protein (2, 3). Loss of function of the KRE9 gene led to a dramatic reduction (80%) in b1,6-glucan level, indicating that Kre9p plays an important role in the synthesis of the polymer. The Kre9p protein is O glycosylated, and when overproduced, it can be detected in the extracellular medium. KRE11 codes for a 63-kDa cytosolic protein, and disruption of the gene caused a 50% reduction in b1,6-glucan level (3). Based on the genetic analysis and molecular characterization of these KRE genes, a working model for b1,6-glucan synthesis has been proposed (3, 44). This model suggests that the polymer is made within the secretory pathway in a stepwise process which includes a Kre5p-dependent ER step involved in the initiation of the polymer synthesis, a Kre6p- and Skn1p-dependent Golgi step for further elaboration of the polymer, and a Kre1p-dependent cell surface step required for side chain addition and maturation of the b1,6-glucan polymer. Because the Kre11p protein is localized in the cytosol, it has been suggested that Kre11p plays a regulatory function in b1,6-glucan assembly. We have previously reported the isolation of the cwh41

The yeast cell wall is a complex structure essential for cell growth and viability. Situated between the plasma membrane and the environment, this extracellular matrix protects the cell from external hazards, provides osmotic stability, maintains the cellular shape, and acts as a filter, permitting the passage of some molecules while excluding others (12, 13, 23, 52). The cell wall of Saccharomyces cerevisiae is composed primarily of chitin, mannoproteins, and b-glucans. b-Glucans are glucose homopolymers that account for approximately 50% of the cell wall dry weight (12, 13, 23, 52). On the basis of their chemical linkage characteristics, b-glucans can be subdivided into b1,3-glucan and b1,6-glucan (29, 30). The b1,3-glucan is a predominantly 1,3-linked linear molecule with a degree of polymerization of approximately 1,500 glucose residues. Biochemical studies have indicated that the synthesis of b1,3glucan is carried out by a plasma membrane enzyme whose activity is regulated by a G protein (7, 33). Recently, a putative b1,3-glucan synthase subunit has been identified independently by several groups. The gene, FKS1 ETG1 CWH53, encodes a 215-kDa protein with multiple transmembrane domains (10, 42). Disruption of this gene resulted in pleiotropic phenotypes, which include a significant growth defect and a dramatic reduction in b1,3-glucan synthase activity in vitro. b1,6-Glucan is a highly branched molecule composed largely of 1,6-linked residues, with an average size of 140 to 200 glucose residues. In vivo, this polymer also serves as part of the cell wall receptor for K1 killer toxin (5, 19). K1 killer toxin is a secreted protein encoded by a double-stranded RNA virus. The toxin kills sensitive cells by first binding to a b1,6-glucanbased cell wall receptor, possibly a glucomannoprotein, and subsequently forming lethal cation channels in the plasma membrane (31). Thus, mutants with defects in b1,6-glucan synthesis often fail to bind the toxin and become toxin resistant. Studies of K1 killer toxin-resistant mutants have led to the identification of several KRE (killer-resistant) genes (4), which include a number of genes required for the synthesis of b1,6glucan.

* Corresponding author. Mailing address: Department of Biology, McGill University, 1205 Dr. Penfield Ave., Montreal, Quebec, Canada H3A 1B1. Phone: (514) 398-6439. Fax: (514) 398-2595. 1162

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

CWH41 encodes a novel type II integral membrane N-glycoprotein located in the endoplasmic reticulum. Disruption of the CWH41 gene leads to a K1 killer toxin-resistant phenotype and a 50% reduction in the cell wall b1,6-glucan level. CWH41 also displays strong genetic interactions with KRE1 and KRE6, two genes known to be involved in the b1,6-glucan biosynthetic pathway. The cwh41D kre6D double mutant is nonviable; and the cwh41D kre1D double mutation results in strong synergistic defects, with a severely slow-growth phenotype, a 75% reduction in b1,6-glucan level, and the secretion of a cell wall glucomannoprotein, Cwp1p. These results provide strong genetic evidence indicating that Cwh41p plays a functional role, possibly as a new synthetic component, in the assembly of cell wall b1,6-glucan.

A NOVEL ER PROTEIN INVOLVED IN b1,6-GLUCAN ASSEMBLY

VOL. 178, 1996

1163

TABLE 1. S. cerevisiae strains used in this study Strain

AR27 AR49 ARC75 SEY6210 HAB251-15B TA405 HAB635 TR92 TR179 YDK5-3B HAB855 HAB856

Genotype

MATa ura3-52 MATa lys2 MATa cwh41-1 ura3-52 lys2 MATa leu2-3,112 ura3-52 his3-D200 lys2-801 trp1-D901 suc2-D9 SEY6210 autodiploid Autodiploid MATa/MATa his3/his3 leu2/leu2 can1/can1 MATa kre1D::HIS3 in SEY6210 MATa kre6D::HIS3 in SEY6210 MATa skn1D::LEU2 in SEY6210 MATa kre5D::HIS3 in TA405 haploid MATa cwh41D::HIS3 in SEY6210 MATa cwh41D::HIS3 in TA405 haploid

41 41 41 S. D. Emr 42 M. Whiteway 3 43 44 32 This study This study

MATERIALS AND METHODS

the coding region of the CWH41 gene and replaced with a 1.8-kb BamHI fragment containing the HIS3 gene. After digestion by HindIII, the DNA fragment carrying the cwh41D::HIS3 deletion construct was gel purified and used to transform a wild-type diploid strain by selecting for histidine prototrophy. Southern blot analysis (51) of genomic DNA from the resulting transformants indicated that disruptions were at the CWH41 locus (data not shown). Isolation of cell walls. After breaking of the cells with glass beads in ice-cold lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1.5 mg of leupeptin per ml, and 3.0 mg of pepstatin A per ml), the cell wall fraction was collected by centrifugation at 1,000 3 g for 5 min at 48C. Cell walls were extracted twice with hot sodium dodecyl sulfate (SDS) by boiling in lysis buffer containing 2% SDS for 5 min each time, washed three times with cold 1 M NaCl–1 mM PMSF, and washed three times with 10 mM Tris-HCl (pH 7.5)–1 mM PMSF. Cell wall analysis. Alkali-insoluble glucans were extracted from isolated cell walls of stationary-phase cultures. After b1,3-glucanase (Zymolyase; ICN Pharmaceuticals, Inc., Irvine, Calif.) digestion and dialysis, the b1,6-glucan was collected and quantified as described by Boone et al. (1). The total alkali-insoluble glucan (b1,3- plus b1,6-glucan) was determined as the hexose content before dialysis (43), and the b1,3-glucan level was calculated by subtracting the b1,6glucan content from the total glucan level. The isolated cell wall preparations were used directly to quantify the cell wall total hexose level. Epitope tagging. Epitope tagging of Cwh41p was performed by inserting a 123-bp BglII fragment, which codes for three tandem copies of the influenza virus hemagglutinin (HA) epitope (24), into the unique BamHI site of the CWH41

Yeast and bacterial strains and growth media. The S. cerevisiae strains used in this study are listed in Table 1. Growth conditions and media for yeast cells were as described previously (6). Standard procedures were used for genetic crosses, sporulation of diploids, and dissection of tetrads (50). Yeast transformations were made by the lithium acetate method of Ito et al. (20). Seeded-plate tests for killer toxin sensitivity were performed as described previously (3). Escherichia coli XL1-Blue was used for the propagation of all plasmids. LB and 2YT media were used for bacterial culture (48). Plasmids. A pRS316-based yeast genomic DNA library (provided by C. Boone, Simon Fraser University, Burnaby, British Columbia, Canada) was used to clone the CWH41 gene. The centromeric vector pRS316 was used to subclone the CWH41 gene. The 2mm-based vector YEp351 was used to overexpress the native CWH41 gene or the epitope-tagged CWH41-HA gene. pBluescript II vectors were used for recombinant DNA constructions. DNA purification and recombinant DNA techniques. Yeast DNA was isolated by the procedure of Hoffman and Winston (18). Plasmid DNA was prepared from E. coli as described by Sambrook et al. (48). Restriction endonucleases, Klenow and T4 DNA polymerases, shrimp alkali phosphatase, and T4 DNA ligase were purchased from Bethesda Research Laboratories Inc. (Gaithersburg, Md.), Pharmacia LKB Biotechnology (Piscataway, N.J.), Boehringer Mannheim Biochemicals (Indianapolis, Ind.), Stratagene Cloning Systems (La Jolla, Calif.), or U.S. Biochemicals (Cleveland, Ohio) and were used according to the instructions of the manufacturers. Radioactive probes for DNA-DNA and RNA-DNA hybridizations were labeled with [a-32P]dCTP (Amersham Canada Limited, Oakville, Ontario) by using the Oligolabelling kit from Pharmacia. DNA sequencing. The CWH41 DNA sequence was determined by a combination of nested deletion and oligonucleotide primer walking. The 4.4-kb HindIII subclone was inserted into the pBluescript II KS1 vector, and nested deletions were constructed with the pBluescript II Exo/Mung kit from Stratagene Cloning Systems. The nucleotide sequence of both DNA strands was determined by the dideoxy-chain termination method of Sanger et al. (49) with the Sequenase kit (U.S. Biochemicals) with [a-35S]dATP as a substrate (Amersham Canada). Gene disruption. Deletion disruption mutants were constructed by the method of Rothstein (47). An internal 1,152-bp BamHI-XbaI fragment was deleted from

FIG. 1. Restriction map and cloning of the CWH41 gene. DNA fragments isolated from the yeast genomic DNA library are represented as thin lines. The open bars indicate various subclones derived from the original genomic DNA fragment. The ability (1) or inability (2) of each fragment to complement the cwh41 mutation is shown on the right. The arrows represent open reading frames. Abbreviations for restriction sites: B, BamHI; E, EcoRI; H, HindIII; S, SpeI; X, XbaI.

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

mutant and showed that the cwh41 strain displayed phenotypes characteristic of b1,6-glucan defects: it was resistant to K1 killer toxin and had a reduced glucose/mannose ratio, suggesting a lower cell wall glucose content (41). To gain a better understanding of its in vivo function, we cloned the CWH41 gene by functional complementation and examined the effects of the cwh41D-null mutation on cell wall b1,6-glucan assembly. Here we report that the CWH41 gene encodes a novel type II integral membrane N-glycoprotein located in the ER. Disruption of the CWH41 gene leads to a K1 killer-resistant phenotype and a 50% reduction in the cell wall b1,6-glucan level. We demonstrate that the cwh41D mutant displayed strong synergistic defects with kre1D- or kre6D-null mutations, and we also show that the cwh41D kre1D double mutation resulted in the secretion of Cwp1p, a glucomannoprotein usually anchored covalently within the cell wall matrix. Together, these results provide evidence indicating that CWH41 is involved in the assembly of cell wall b1,6-glucan.

Source or reference

1164

JIANG ET AL.

J. BACTERIOL.

coding region. Subclones carrying the inserted BglII fragment in the correct orientation were confirmed by DNA sequencing. To epitope tag the Cwp1p protein, two complementary oligonucleotides, oligonucleotide 1 (AATTCATGTACCCATACGACGTCCCAGACTACGCTA TGG) and oligonucleotide 2 (AATTCCATAGCGTAGTCTGGGACGTCGTA TGGGTACATG), were designed. In addition to containing the sequence encoding the HA epitope, these oligonucleotides also contain complementary EcoRI termini at their ends (underlined). The two oligonucleotides were phosphorylated, annealed, and ligated into the unique EcoRI site located between codons 24 and 25 of CWP1. Constructs containing the epitope insertion were screened by restriction mapping the AatII site (shown in boldface type) present in each of the oligonucleotides. After sequencing the DNA, we identified positive subclones carrying one, two, or four copies of the inserted fragment in the correct orientation. Thus, we obtained single-, double-, and quadruple-HA epitopetagged Cwp1p. All these tagged Cwp1p proteins are correctly targeted and anchored to the cell wall matrix, and we chose to use the quadruple-HA epitopetagged Cwp1p (Cwp1p-HA) in this study. Preparation of total cell lysates and extraction of membrane proteins. Expo-

nentially growing cells expressing Cwh41p-HA were harvested and broken with glass beads in ice-cold lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5 mM EDTA, 1 mM PMSF, 1.5 mg of leupeptin per ml, and 3.0 mg of pepstatin A per ml). After spinning at 1,000 3 g for 5 min at 48C to remove the cell walls and unbroken cells, the supernatant was collected as the total cell lysate. To determine the nature of Cwh41p-HA’s membrane association, 80 ml of total cell lysate was mixed with 20 ml of 0.5 M Na2CO3 (pH 11), 3 M NaCl, 8 M urea, 5% Triton X-100, or 2.5% SDS. These mixtures were incubated at 48C for 15 min and then subjected to a high-speed centrifugation of 150,000 3 g for 15 min at 48C. The resulting membrane pellets were resuspended in 100 ml of the appropriate extraction buffer, and supernatant and pellet fractions were diluted with SDSpolyacrylamide gel electrophoresis (PAGE) sample loading buffer, heated at 958C, and analyzed by Western blotting (immunoblotting). Western blotting analysis. Western blots were performed with a 1:2,500 dilution of anti-HA antibody (12CA5) and a 1:2,500 dilution of horseradish peroxidase-conjugated goat anti-mouse secondary antibody. The blots were developed with the ECL chemiluminescence detection kit (Amersham). Immunofluorescence. Log-phase (optical density at 600 nm ' 0.5; approxi-

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

FIG. 2. DNA and predicted amino acid sequences of CWH41. The nucleotide sequence of a 3.3-kb BclI-BglII fragment is shown. The predicted 833-amino-acid protein product is shown in the one-letter code below the nucleotide sequence. The stop codon is shown as an asterisk. The potential transmembrane domain is underlined. The predicted N-glycosylation sites are boxed.

A NOVEL ER PROTEIN INVOLVED IN b1,6-GLUCAN ASSEMBLY

VOL. 178, 1996

1165

TABLE 2. Phenotypes of CWH41 gene disruption Strain

Wild type cwh41D cwh41D a

Plasmid

HA-CWH41 in pRS316

Killer toxin zone size (mean 6 SD [mm])

16.9 6 0.5 11.8 6 0.4 17.0 6 0.6

Cell wall polymer levela (mean 6 SD [mg {dry wt}/ml]) Alkali-insoluble b1,6-glucan

Alkali-insoluble b1,3-glucan

Total hexose

118 6 3.4 56.7 6 6.0 105 6 10

228 6 37 208 6 3.0 210 6 37

592 6 92 568 6 46 537 6 22

Total cell walls were first isolated from stationary-phase cells, and then the major cell wall polymers were fractionated and measured as described by Boone et al.

(1).

RESULTS Cloning and sequencing of the CWH41 gene. The cwh41 mutant was originally isolated from a broad cell wall mutant screen based on the calcofluor white-hypersensitive phenotype. Initial studies indicated that cwh41 displayed a higher cell wall mannose-to-glucose ratio and was resistant to K1 killer toxin, suggesting that this mutant had defects in b1,6-glucan assembly (41). To further characterize the gene identified by this mutant allele, we cloned the CWH41 gene by functional complementation. Two overlapping genomic DNA fragments complementing the cwh41-1 calcofluor white-hypersensitive phenotype were isolated from a yeast genomic DNA library. Restriction mapping and subcloning analyses located the cwh41-1 complementing activity to a 4.4-kb HindIII fragment (Fig. 1). To determine if the cloned DNA fragments contained the CWH41 gene, we crossed the cwh41D::HIS3 deletion mutant (see below) with the original cwh41-1 allele. The resulting diploid strain was sporulated and analyzed by tetrad dissection. Of the 10 tetrads examined, all four spores from each tetrad were calcofluor white hypersensitive, with the HIS3 marker segregating 21:22. The diploid strain showed hypersensitivity to calcofluor white as well. These results demonstrate that the cwh41D::HIS3 deletion not only failed to complement but also

was tightly linked to the original cwh41-1 locus, indicating that the cloned DNA fragments contained the CWH41 gene. DNA sequence analysis of the 4.4-kb HindIII fragment revealed a single, 2.5-kb open reading frame encoding a protein of 833 amino acid residues (Fig. 2). The predicted Cwh41p protein sequence contains features characteristic of a type II integral membrane protein (16, 38): it has a positively charged N-terminal tail of 10 amino acid residues followed by a stretch of 16 hydrophobic residues that could form a potential membrane-spanning domain and a large 807-amino-acid C-terminal domain containing four potential N-linked glycosylation sites (Asn-X-Ser/Thr). Comparison of the Cwh41p sequence with those from GenBank, EMBL, PIR, and SwissProt sequence databases has not revealed any proteins with significant similarities to Cwh41p. A sequence search of the S. cerevisiae GenBank database revealed that the DNA sequence 59 to the CWH41 coding region was identical to the DNA sequence 39 to the TRP5 gene (57), thus demonstrating that the CWH41 gene is physically adjacent to TRP5 on the left arm of chromosome VII. Phenotypes of the cwh41D::HIS3-null mutant. To study its in vivo function, a deletion-null mutant of the CWH41 gene was constructed and the resulting phenotypes were examined by tetrad analysis. Disruption of the CWH41 gene did not give rise to any detectable growth defects under standard growth conditions, indicating that CWH41 is a nonessential gene. However, as found for the original cwh41-1 allele, the cwh41D:: HIS3-null mutant displayed cell wall-related defects: the mutant was hypersensitive to calcofluor white, more resistant to K1 killer toxin, and showed an approximately 50% reduction in cell wall b1,6-glucan levels (Table 2). The levels of the cell wall total hexose (glucans plus mannans) and b1,3-glucan were not affected by the cwh41D::HIS3 mutation. These phenotypes indicated that the CWH41 gene was involved in b1,6-glucan assembly. Immunodetection of Cwh41p. To facilitate detection and further characterization of the CWH41 gene product, we tagged the N terminus of CWH41 with a quadruple-HA epitope, which is recognized by the monoclonal antibody 12CA5 (see Materials and Methods). The epitope-tagged gene (CWH41-HA) remained fully functional, as judged by its ability to complement both the killer-resistant phenotype and the b1,6-glucan defect in the cwh41D strain (Table 2). Western blot analysis with 12CA5 antibody detected a single, 107-kDa polypeptide from a strain expressing a centromere-based CWH41-HA plasmid (Fig. 3). The 107-kDa protein was overproduced in cells containing a 2mm-based CWH41-HA plasmid but was absent from strains lacking the tagged CWH41 gene. These results showed that the 107-kDa protein is the product of the tagged CWH41 gene. Cwh41p appears to localize to the ER. Immunofluorescence microscopy was performed to determine the intracellular lo-

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

mately 2.8 3 106 cells per ml) homozygous cwh41D diploid cells expressing either Cwh41p-HA or native Cwh41p protein were fixed with 3.7% formaldehyde. Immunofluorescence microscopy was performed as described by Pringle et al. (40). For cells containing 2mm-based plasmids, anti-HA antibody (12CA5) was used at a dilution of 1:2,000 and Texas red-conjugated goat anti-mouse secondary antibody was diluted 1:1,000. For strains carrying centromere-based plasmids, one additional layer of secondary antibody was used to amplify the immunofluorescence signal. Antibody dilutions were 1:2,000 for anti-HA antibody (12CA5), 1:1,000 for Texas red-conjugated goat anti-mouse secondary antibody, and 1:500 for Texas red-conjugated donkey anti-goat secondary antibody. Images were recorded on Kodak T-Max 400 black-and-white film with an epifluorescence microscope (Zeiss Axiophot). Cell labeling and immunoprecipitation. Cells expressing Cwh41p-HA were grown in 10 ml of YNB (50) medium to log phase (optical density at 600 nm ' 0.5; approximately 2.8 3 106 cells per ml), harvested, resuspended in 2.5 ml of low-sulfate minimal medium, and grown for another 30 min in the presence or absence of tunicamycin (10 mg/ml). Labeling was initiated by adding 100 mCi of Trans-35S label (ICN Biochemicals) to the cell culture, continued for 20 min, and terminated by adding NaN3 to 10 mM and chilling the cells on ice. Labeled cells were lysed with glass beads and immunoprecipitated with anti-HA antibody (12CA5) as described by Roemer et al. (45). Cell wall b1,3-glucanase digestion and protein precipitation from growth media. Washed cell walls were digested with a recombinant b1,3-glucanase, Quantazyme ylg (Quantum Biotechnologies Inc., Montreal, Canada), at a concentration of 2.5 U/mg of cell wall (wet weight) in 100 ml of a solution containing 50 mM Tris-HCl (pH 7.5), 100 mM dithiothreitol, 1 mM PMSF, 1.5 mg of leupeptin per ml, and 3.0 mg of pepstatin A per ml at 378C for 18 h. After the digestion, the remaining insoluble material was removed by centrifugation at 15,000 3 g for 5 min and the supernatant was analyzed by Western blotting. Proteins secreted into the growth media were recovered by deoxycholate precipitation as described by Ozols (36). Nucleotide sequence accession number. The DNA sequence of the CWH41 gene has been entered in the GenBank database and assigned accession no. U35669.

1166

JIANG ET AL.

calization of Cwh41p-HA. Cells containing a 2mm-based CWH41-HA plasmid, but not those with the untagged CWH41 plasmid, showed clear perinuclear-rim staining, with some staining at the periphery of the cell (Fig. 4). This staining pattern resembles that observed for several known ER proteins, including Dpm1p, Kar2p, Sec62p, and Sec63p (9, 11, 39, 46). Since overproduction of a protein might lead to mislocalization in the ER, we also examined the subcellular location of Cwh41p-HA with a centromere-based plasmid. By standard experimental procedures we could not observe any detectable signals for Cwh41p-HA, probably because of its low abun-

dance. However, by using an antibody sandwiching method (40) we were able to detect a weak but highly reproducible perinuclear-staining pattern very similar to that seen from cells containing a 2mm-based CWH41-HA plasmid (data not shown). This showed that overexpression of Cwh41p-HA did not result in its mislocalization. Under the experimental conditions we used, approximately 47% of the cells counted (total counted ' 1,000) gave detectable fluorescence signals: 13% showed strong perinuclear-rim staining, and 34% displayed a weak perinuclear signal. No cells showed Golgi, vacuolar, or plasma membrane staining. These observations suggest that Cwh41p-HA is an ER protein. Cwh41p is an integral membrane N-glycoprotein. Examination of the predicted Cwh41p amino acid sequence revealed the presence of a putative transmembrane domain near the N terminus and four potential N-linked glycosylation sites (AsnX-Ser/Thr) in the C-terminal region. To test whether Cwh41p is an integral membrane protein, we extracted total cell lysates with various reagents and then fractionated the samples into membrane pellet and soluble supernatant by centrifugation at 100,000 3 g. Figure 5A shows that Cwh41p-HA fractionated exclusively to the membrane pellet after treatment with 0.1 M Na2CO3 (pH 11), 0.6 M NaCl, or 1.6 M urea, conditions commonly used to strip nonintegral proteins from membranes (14, 45). In contrast, 1% Triton X-100 released a fraction of the protein into the soluble fraction and treatment with 0.5% SDS almost completely solubilized the protein. Thus, Cwh41p behaved as an integral membrane protein. To determine whether the protein is N glycosylated, we immunoprecipitated 35S-labeled Cwh41p-HA proteins from tunicamycin-treated and nontreated cell cultures and examined their electrophoretic mobilities by SDS-PAGE (Fig. 5B). In the presence of tunicamycin, which specifically inhibits N

FIG. 4. Localization of epitope-tagged Cwh41p-HA. A cwh41D strain was transformed with a 2mm-based plasmid containing the epitope-tagged CWH41-HA gene (upper panels) or the native CWH41 gene (lower panels). Indirect immunofluorescence was performed as described in Materials and Methods. Anti-HA, Cwh41p-HA staining observed with 12CA5 anti-HA monoclonal antibody; DAPI, 49,6-diamidino-2-phenylindole staining to visualize DNA; Nomarski, Nomarski images of the cells.

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

FIG. 3. Immunodetection of the Cwh41-HA protein. Total cell lysates from strains expressing native or HA epitope-tagged CWH41 gene were analyzed by Western blot with the 12CA5 anti-HA monoclonal antibody. CEN, centromerebased low-copy-number plasmids; 2m, 2mm-based high-copy-number plasmids. Molecular masses (in kilodaltons) are indicated on the left.

J. BACTERIOL.

VOL. 178, 1996

A NOVEL ER PROTEIN INVOLVED IN b1,6-GLUCAN ASSEMBLY

1167

glycosylation (35), the apparent molecular mass of Cwh41p-HA decreased from 107 to 105 kDa. This demonstrated that Cwh41p was an N-glycoprotein. All N glycoproteins are initially modified by the attachment of a core oligosaccharide (GlcNAc2Man9Glc3) in the ER (17, 26, 53). As each core oligosaccharide contributes about 2 kDa to the molecular mass (35), the tunicamycin-induced 2-kDa shift suggested that the Cwh41p-HA was modified by a core oligosaccharide without outer-chain extensions. Genetic interactions between CWH41 and KRE genes. Previous studies suggested that b1,6-glucan is synthesized in a stepwise manner within the yeast secretory pathway (3, 44). At least three distinct steps were identified: a Kre5p-dependent ER step involved in the initiation of the polymer synthesis (32), a Kre6p- and Skn1p-dependent Golgi step required for further modification of the polymer (45), and a Kre1p-dependent cell surface step for b1,6-linked side chain addition or elongation (1). Having shown that Cwh41p is an ER membrane protein involved in cell wall b1,6-glucan assembly, we searched for possible genetic interactions between CWH41 and KRE1, KRE6, SKN1, and KRE5. We crossed the cwh41D mutant with each of these kre-null strains and examined the phenotypes of the double mutants by tetrad analysis (Fig. 6). The cwh41D kre1D double mutant displayed an extremely slow-growth phenotype and a large reduction (75%) in b1,6-glucan level (Fig. 7), and the spores with cwh41D kre6D double mutations were not viable (Fig. 6). These defects are considerably more severe than those displayed by either single mutant, indicating that simultaneous perturbations of the b1,6-glucan synthesis at different stages had cumulative effects on the cell growth and the polymer level. The skn1D mutant, which lacks detectable cell wall phenotypes (44), did not display an exaggerated growth defect with the cwh41D mutant (data not shown). Since the

kre5D mutation is lethal in the SEY6210 strain background, we investigated potential interactions between CWH41 and KRE5 in the TA405 strain background. Tetrad analysis indicated that the cwh41D kre5D double mutant grew at the same rate as the kre5D single mutant (data not shown), suggesting that the double mutations had no more severe effects than did the kre5D single mutation. Overexpressing the KRE5, KRE6, SKN1, or KRE1 genes from 2mm-based plasmids did not suppress the killer-resistant phenotype of the cwh41D mutation; reciprocally, overproduction of the CWH41 gene failed to suppress the defects associated with the kre5D, kre6D, or kre1D mutants (data not shown). The cwh41D kre1D double mutant displayed defects in cell wall anchorage of Cwp1p. It has recently been shown that some cell wall mannoproteins are covalently cross-linked to b1,6glucans, and these b1,6-glucan side chains have been suggested to play functional roles in the anchorage of mannoproteins to the cell wall matrix (28, 34, 56). To obtain additional insights about its in vivo function, we examined the effects of CWH41 deletion on the cell wall anchorage of Cwp1p, a known b1,6glucan-modified cell wall protein (55). In wild-type cells, as well as in the cwh41D and kre1D single mutants, the epitopetagged Cwp1p-HA protein was correctly anchored into the cell wall matrix (Fig. 8). In the cwh41D kre1D double mutant, however, little if any Cwp1p-HA protein could be detected in the cell wall fraction. Instead, the protein was secreted into the growth medium by the double mutant. To test whether the secretion of Cwp1p-HA is specific to the cwh41D kre1D mutant, we examined the kre5D mutant and found that the Cwp1p-HA protein was secreted by the kre5D mutant as well. These results showed that severe b1,6-glucan defects, caused either by the cwh41D kre1D double mutation or by a kre5D single mutation, resulted in the failure of Cwp1p-HA cell wall

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

FIG. 5. Membrane association and N glycosylation of Cwh41p-HA. (A) Cell lysates from a strain expressing the 2mm-based CWH41-HA plasmid were treated with H2O, 0.1 M Na2CO3 (pH 11), 0.6 M NaCl, 1.6 M urea, 1% Triton X-100, or 0.5% SDS and separated into supernatant (S) and pellet (P) fractions as described in Materials and Methods. These fractions were then analyzed by Western blot, with the 12CA5 anti-HA monoclonal antibody. (B) Cells expressing a 2mm-based native CWH41 plasmid or a 2mm-based CWH41-HA plasmid were labeled with Trans-35S label in the presence (1) or absence (2) of tunicamycin. The radiolabeled Cwh41p-HA protein was immunoprecipitated and analyzed by SDS-PAGE as described in Materials and Methods. Molecular masses (in kilodaltons) are indicated on both sides of the panel. (C) A schematic diagram of Cwh41p protein. The shaded box indicates the transmembrane domain. The arrow points to the insertion site of the HA epitope. The four potential N-glycosylation sites are indicated by asterisks.

1168

JIANG ET AL.

J. BACTERIOL.

FIG. 6. Germination and growth of tetrads from cwh41D/CWH41 kre1D/ KRE1 and cwh41D/CWH41 kre6D/KRE6 heterozygous diploids. Diploid strains were sporulated and dissected onto yeast extract-peptone-dextrose plates and incubated at 308C. Tetrad types shown are parental ditype (PD), nonparental ditype (NPD), and tetratype (TT). The four spore progeny derived from each tetrad are indicated by the letters A, B, C, and D to the left of each panel. (A) Tetrads from the cwh41D/CWH41 kre1D/KRE1 heterozygous diploid. The spore progeny containing the cwh41Dkre1D double mutation displayed a slow-growth phenotype. The tetrads were photographed after 2 days of incubation. (B) Tetrads from the cwh41D/CWH41 kre6D/KRE6 heterozygous diploid. Cells carrying the cwh41D kre6D double mutation were not viable. The tetrads were photographed after 4 days of incubation.

anchorage, indicating that b1,6-glucan plays a functional role in anchoring cell wall proteins within the extracellular matrix. DISCUSSION In this study, we report the cloning and characterization of the CWH41 gene from S. cerevisiae. Our gene deletion analysis revealed that the cwh41D-null mutant displayed phenotypes characteristic of cell wall defects: hypersensitivity to calcofluor white and resistance to K1 killer toxin. In addition, we showed that disruption of the CWH41 gene resulted in a 50% reduction of cell wall b1,6-glucan levels. The effects of CWH41 gene

deletion appeared to be specific for b1,6-glucan, since the b1,3-glucan level and the total cell wall hexose content were not altered by loss of the CWH41 gene. Furthermore, we demonstrated that a null mutation in the CWH41 gene displayed severe synergistic defects with null mutations in KRE1 and KRE6, two genes known to be involved in the b1,6-glucan biosynthetic pathway (1, 43). The cwh41D kre1D double mutant showed an extremely slow-growth phenotype and a 75% reduction in cell wall b1,6-glucan level. Cells carrying the cwh41D kre6D double mutation were not viable. Together, these results provide strong genetic evidence indicating that Cwh41p plays a functional role in the assembly of cell wall b1,6-glucan. The exact biochemical function of Cwh41p is not clear. It could function as a new component of the b1,6-glucan synthetic machinery. Alternatively, it could play a regulatory role, for example, as an activator of synthase components. DNA sequencing revealed that the CWH41 gene encodes a novel, 833-amino-acid-residue polypeptide. Using a functional epitope-tagged protein, we showed that Cwh41p-HA is an integral membrane N-glycoprotein, consistent with the structure predicted from the DNA sequence. Because all four potential N-glycosylation sites are located in the C-terminal region of Cwh41p, the presence of N-linked oligosaccharide on the protein also showed that the C-terminal domain was situated within the lumen of the secretory pathway. Assuming that the 16-amino-acid-residue transmembrane domain spans the membrane once, this would indicate that Cwh41p has a type II membrane protein topology. Immunofluorescent analysis of Cwh41p-HA revealed a perinuclear-rim staining pattern indicative of ER localization in yeast cells. Since it has been documented that some misfolded or overproduced proteins accumulate within the ER (15, 39), one has to interpret the ER localization of an epitope-tagged protein cautiously. We think the observed ER staining reflects the authentic subcellular location of Cwh41p for the following reasons. Firstly, a centromere-based CWH41-HA plasmid is

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

FIG. 7. Quantification of cell wall b1,6-glucan levels. Alkali-insoluble b1,6glucan was extracted from the cell wall preparations of various strains and quantified (in micrograms per milligram [dry weight]) of cell wall) as described in Materials and Methods. The data shown represent the results of at least three independent experiments. Error bars represent standard deviations. WT, wild type.

VOL. 178, 1996

A NOVEL ER PROTEIN INVOLVED IN b1,6-GLUCAN ASSEMBLY

able to completely complement the cwh41D-null mutation. This shows that the epitope-tagged protein is fully functional, thus making the possibility of misfolding very unlikely. Secondly, the centromere-based CWH41-HA plasmid and the 2mm-based CWH41-HA plasmid both showed similar perinuclear-rim staining patterns. These results indicate that overexpression of the Cwh41p-HA did not lead to mislocalization. Thirdly, the perinuclear-rim staining was the only staining pattern detected: no Golgi, vacuolar, or plasma membrane stain-

ing was seen. Collectively, these data indicate that the Cwh41p is an ER protein. Previous studies of the KRE genes have suggested that the b1,6-glucan is synthesized in a stepwise manner within the secretory pathway (3, 44). Our findings that Cwh41p is an ER integral membrane protein are consistent with and provide further support for this hypothesis. Furthermore, its ER localization suggests that Cwh41p is involved in an early step of b1,6-glucan assembly, upstream of the Kre6p-dependent Golgi event and the Kre1p-dependent cell surface event (1, 45). The strong genetic interactions observed, i.e., the synthetic lethality of cwh41D kre6D and the severe additive defects of cwh41D kre1D, are all in agreement with this assignment. Overexpression experiments revealed that simply overproducing the downstream Kre6p or Kre1p could not bypass the requirement for Cwh41p, suggesting that the functional role of Cwh41p is distinct from that of Kre6p or Kre1p. What is the relationship between Cwh41p and Kre5p, the two ER proteins involved in b1,6-glucan assembly? Several lines of evidence suggest that Cwh41p and Kre5p have distinct functions. Firstly, the phenotypes displayed by the two null mutants are very different. Disruption of the KRE5 gene gave rise to an extremely severe b1,6-glucan defect, with no detectable amount of polymer made (32). In comparison, the b1,6glucan defect caused by CWH41 gene disruption was quite modest. Secondly, the cwh41D kre5D double mutant displayed the same phenotype as the kre5D single mutant, indicating that KRE5 is epistatic to CWH41. Thirdly, we showed that overexpression of either gene cannot compensate for the defect caused by the loss of the other, suggesting that their functions are not interchangeable. On the basis of all these results, Cwh41p appears to play a distinct functional role either downstream of Kre5p or as an auxiliary component perhaps in a complex with Kre5p. Further biochemical characterizations will be needed to distinguish these possibilities. Our results also reveal a correlation between defects in b1,6glucan assembly and the anchorage of a glucomannoprotein in the cell wall matrix. Recently, a number of glucanase-extractable cell wall proteins have been identified (55). These proteins, Cwp1p, Cwp2p, Tip1p, and Srp1p, appeared to share some structural similarities: their C-terminal regions are very rich in serine and threonine residues and all contain putative glycosylphosphatidylinositol attachment sites. Cwp1p and Tip1p (25) proteins have been demonstrated to carry b1,6glucan side chains. Using the Cwp1p as a model cell wall glucomannoprotein, we investigated the effects of b1,6-glucan on the targeting of glucomannoproteins and their incorporation into the cell wall matrix. After examining the cwh41D and kre1D single mutants and the cwh41D kre1D double mutant, we detected an interesting correlation between the severity of the glucan defects and the efficiency of the Cwp1p cell wall anchorage. In the cwh41D and kre1D single mutants, strains with modest b1,6-glucan defects (40 to 50% reduction), Cwp1p-HA was efficiently incorporated into the cell wall. In contrast, the cwh41D kre1D double mutant and the kre5D single mutant, strains displaying severe b1,6-glucan defects, failed to efficiently anchor the Cwp1p-HA in the cell wall: the majority of the protein was secreted into the growth medium. Interestingly, Lu et al. (28) reported a similar correlation with a-agglutinin (27), another cell wall glucomannoprotein. They showed that the kre5D mutant secreted most of the a-agglutinin into the growth medium, whereas the majority of the protein was anchored in the cell wall by the kre1D mutant. Our analyses of Cwp1p, together with the a-agglutinin data from Lu et al. (28), suggest that severe b1,6-glucan defects lead to the secretion of the cell wall glucomannoproteins. Thus, these

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

FIG. 8. Western blot analysis of Cwp1p-HA. The epitope-tagged Cwp1p-HA proteins present in the cell wall Quantazyme digestions and growth media were analyzed by Western blot with the 12CA5 anti-HA monoclonal antibody. Each lane of the cell wall samples represents the Quantazyme digestion from approximately 4 mg (wet weight) of isolated cell walls. Each lane of the growth medium samples contains secreted proteins precipitated from the supernatant of approximately 3.5 ml of cell culture with an optical density at 600 nm of 1 (approximately 2.2 3 107 cells/ml). (A) Various strains containing a pRS305-based CWP1-HA plasmid integrated into the genome. Lanes: 1, wild-type strain; 2, cwh41D single mutant; 3, kre1D single mutant; 4, cwh41D kre1D double mutant. (B) The wild-type and kre5D strains were transformed with a 2mm-based plasmid containing either native or epitope-tagged CWP1 gene. Lanes: 1, wild-type strain carrying a native CWP1 plasmid (the negative control); 2, wild-type strain with an epitope-tagged CWP1-HA plasmid; 3, kre5D mutant containing an epitopetagged CWP1-HA plasmid.

1169

1170

JIANG ET AL.

results provide experimental evidence for the proposal that b1,6-glucan plays a functional role in anchoring glucomannoprotein in the cell wall, probably by covalently cross-linking the protein to the extracellular b1,3-glucan matrix (22, 34). How and where the b1,6-glucan side chain is attached onto the protein is not clear, although several possibilities, including that the b1,6-glucan is linked to the glycosylphosphatidylinositol anchor (8, 21, 28, 54), have been suggested. Detailed analyses of the glucosylation of Cwp1p in various kre mutants should provide insights on the in vivo functions of these KRE genes and on the molecular mechanisms underlying the processes of protein glucosylation and cell wall anchorage. ACKNOWLEDGMENTS

REFERENCES 1. Boone, C., S. S. Sommer, A. Hensel, and H. Bussey. 1990. Yeast KRE genes provide evidence for a pathway of cell wall b-glucan assembly. J. Cell Biol. 110:1833–1843. 2. Brown, J. L., and H. Bussey. 1993. The yeast KRE9 gene encodes an O glycoprotein involved in cell surface b-glucan assembly. Mol. Cell. Biol. 13:6346–6356. 3. Brown, J. L., Z. Kossaczka, B. Jiang, and H. Bussey. 1993. A mutational analysis of killer toxin resistance in Saccharomyces cerevisiae identifies new genes involved in cell wall 1-6-b-glucan synthesis. Genetics 133:837–849. 4. Brown, J. L., T. Roemer, M. Lussier, A.-M. Sdicu, and H. Bussey. 1994. The K1 killer toxin: molecular and genetic applications to secretion and cell surface assembly, p. 217–232. In J. R. Johnston (ed.), Molecular genetics of yeast: a practical approach. IRL Press, Oxford University Press, Oxford. 5. Bussey, H. 1991. K1 killer toxin, a pore-forming protein from yeast. Mol. Microbiol. 5:2339–2343. 6. Bussey, H., W. Sacks, D. Galley, and D. Saville. 1982. Yeast killer plasmid mutations affecting toxin secretion and activity and toxin immunity function. Mol. Cell. Biol. 2:346–354. 7. Cabib, E., and M. S. Kang. 1987. Fungal 1,3-b-glucan synthase. Methods Enzymol. 138:637–642. 8. De Nobel, H., and P. N. Lipke. 1994. Is there a role for GPIs in yeast cell-wall assembly? Trends Cell Biol. 4:42–45. 9. Deshaies, R. J., and R. Schekman. 1990. Structural and functional dissection of Sec62p, a membrane-bound component of the yeast endoplasmic reticulum protein import machinery. Mol. Cell. Biol. 10:6024–6035. 10. Douglas, C. M., F. Foor, J. A. Marrinan, N. Morin, J. B. Nielsen, A. M. Dahl, P. Mazur, W. Baginsky, W. Li, M. el-Sherbeini, J. A. Clemas, S. M. Mandala, B. R. Frommer, and M. B. Kurtz. 1994. The Saccharomyces cerevisiae FKS1 ETG1 gene encodes an integral membrane protein which is a subunit of 1,3-b-D-glucan synthase. Proc. Natl. Acad. Sci. USA 91:12907–12911. 11. Feldheim, D., J. Rothblatt, and R. Schekman. 1992. Topology and functional domains of Sec63p, an endoplasmic reticulum membrane protein required for secretory protein translocation. Mol. Cell. Biol. 12:3288–3296. 12. Fleet, G. H. 1991. Cell walls, p. 199–277. In A. H. Rose and J. S. Harrison (ed.), The yeasts, 2nd ed., vol. 4. Yeast organelles. Academic Press, London. 13. Fleet, G. H., and H. J. Phaff. 1981. Fungal glucans—structure and metabolism, p. 416–440. In W. Tanner and F. A. Loewus (ed.), Encyclopedia of plant physiology new series, vol. 13B. Plant carbohydrates II. SpringerVerlag, Berlin. 14. Fujiki, Y., A. L. Hubbard, S. Fowler, and P. B. Lazarow. 1982. Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum. J. Cell Biol. 93:97–102. 15. Gething, M. J., K. McCammon, and J. Sambrook. 1986. Expression of wild-type and mutant forms of influenza hemagglutinin: the role of folding in intracellular transport. Cell 46:939–950. 16. Hartmann, E., T. A. Rapoport, and H. F. Lodish. 1989. Predicting the orientation of eukaryotic membrane-spanning domains. Proc. Natl. Acad. Sci. USA 86:5786–5790. 17. Herscovics, A., and P. Orlean. 1993. Yeast glycoprotein synthesis. FASEB J. 7:540–550. 18. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267–272. 19. Hutchins, K., and H. Bussey. 1983. Cell wall receptor for yeast killer toxin: involvement of (136)-b-D-glucan. J. Bacteriol. 154:161–169. 20. Ito, H., Y. Fukuda, M. Murata, and A. Kimura. 1983. Transformations of

intact yeast cells with alkali cations. J. Bacteriol. 153:163–168. 21. Kapteyn, J. C., R. C. Montijn, G. J. P. Dijkgraaf, and F. M. Klis. 1994. Identification of b-1,6-glucosylated cell wall proteins in yeast and hyphal forms of Candida albicans. Eur. J. Cell Biol. 65:402–407. 22. Kapteyn, J. C., R. C. Montijn, G. J. P. Dijkgraaf, H. Van Den Ende, and F. M. Klis. 1995. Covalent association of b-1,3-glucan with b-1,6-glucosylated mannoproteins in cell walls of Candida albicans. J. Bacteriol. 177:3788– 3792. 23. Klis, F. 1994. Cell wall assembly in yeast. Yeast 10:851–869. 24. Kolodziej, P. A., and R. A. Young. 1991. Epitope tagging and protein surveillance. Methods Enzymol. 194:508–519. 25. Kondo, K., and M. Inouye. 1991. TIP1, a cold shock-inducible gene of Saccharomyces cerevisiae. J. Biol. Chem. 266:17537–17544. 26. Kukuruzinska, M. A., M. L. E. Bergh, and B. J. Jackson. 1987. Protein glycosylation in yeast. Annu. Rev. Biochem. 56:915–944. 27. Lipke, P., D. Wojciechowicz, and J. Kurjan. 1989. AGa1 is the structural gene for the Saccharomyces cerevisiae a-agglutinin, a cell surface glycoprotein involved in cell-cell interactions during mating. Mol. Cell. Biol. 9:3155–3165. 28. Lu, C. F., R. C. Montijn, J. L. Brown, F. Klis, J. Kurjan, H. Bussey, and P. N. Lipke. 1995. Glycosyl phosphatidylinositol-dependent cross-linking of a-agglutinin and b 1,6-glucan in the Saccharomyces cerevisiae cell wall. J. Cell Biol. 128:333–340. 29. Manners, D. J., A. J. Masson, and J. C. Patterson. 1973. The structure of a b-1-3-D-glucan from yeast cell walls. Biochem. J. 135:19–30. 30. Manners, D. J., A. J. Masson, and J. C. Patterson. 1973. The structure of a b-1-6-D-glucan from yeast cell walls. Biochem. J. 135:31–36. 31. Martinac, B., H. Zhu, A. Kubalski, X. L. Zhou, M. Culbertson, H. Bussey, and C. Kung. 1990. Yeast K1 killer toxin forms ion channels in sensitive yeast spheroplasts and in artificial liposomes. Proc. Natl. Acad. Sci. USA 87:6228– 6232. 32. Meaden, P., K. Hill, J. Wagner, D. Slipetz, S. S. Sommer, and H. Bussey. 1990. The yeast KRE5 encodes a probable endoplasmic reticulum protein required for (136)-b-D-glucan synthesis and normal cell growth. Mol. Cell. Biol. 10:3013–3019. 33. Mol, P. C., H. M. Park, J. T. Mullins, and E. Cabib. 1994. A GTP-binding protein regulates the activity of 133-b-glucan synthase, an enzyme directly involved in yeast cell wall morphogenesis. J. Biol. Chem. 269:31267–31274. 34. Montijn, R. C., J. Van Rinsum, F. A. Van Schagen, and F. M. Klis. 1994. Glucomannoproteins in the cell wall of Saccharomyces cerevisiae contain a novel type of carbohydrate side-chain. J. Biol. Chem. 269:19338–19342. 35. Orlean, P., M. J. Kuranda, and C. F. Albright. 1991. Analysis of glycoproteins from Saccharomyces cerevisiae. Methods Enzymol. 194:682–697. 36. Ozols, J. 1990. Amino acid analysis. Methods Enzymol. 182:587–601. 37. Parker, C. G., L. I. Fessler, R. E. Nelson, and J. H. Fessler. 1995. Drosophila UDP-glucose:glycoprotein glucosyltransferase: sequence and characterization of an enzyme that distinguishes between denatured and native proteins. EMBO J. 14:1294–1303. 38. Parks, G. D., and R. A. Lamb. 1991. Topology of eukaryote type II membrane proteins: importance of N-terminal positively charged residues flanking the hydrophobic domain. Cell 64:777–787. 39. Preuss, D., J. Mulholland, C. A. Kaiser, P. Orlean, C. Albright, M. D. Rose, P. W. Robbins, and D. Botstein. 1991. Structure of the yeast endoplasmic reticulum: localization of ER proteins using immunofluorescence and immunoelectron microscopy. Yeast 7:891–911. 40. Pringle, J. R., A. E. M. Adams, D. G. Drubin, and B. K. Haarer. 1991. Immunofluorescence methods for yeast. Methods Enzymol. 194:565–601. 41. Ram, A. F. J., A. Wolters, R. ten Hoopen, and F. M. Klis. 1994. A new approach for isolating cell wall mutants in Saccharomyces cerevisiae by screening for hypersensitivity to calcofluor white. Yeast 10:1019–1030. 42. Ram, A. F. J., S. S. C. Brekelmans, L. J. W. M. Oehlen, and F. M. Klis. 1995. Identification of two cell cycle regulated genes affecting the b1,3-glucan content of cell walls in Saccharomyces cerevisiae. FEBS Lett. 358:165–170. 43. Roemer, T., and H. Bussey. 1991. Yeast b-glucan synthesis: KRE6 encodes a predicted type II membrane protein required for glucan synthesis in vivo and for glucan synthase activity in vitro. Proc. Natl. Acad. Sci. USA 88:11295– 11299. 44. Roemer, T., S. Delaney, and H. Bussey. 1993. SKN1 and KRE6 define a pair of functional homologs encoding putative membrane proteins involved in b-glucan synthesis. Mol. Cell. Biol. 13:4039–4048. 45. Roemer, T., G. Paravicini, M. A. Payton, and H. Bussey. 1994. Characterization of the yeast 1-6-b-glucan biosynthetic components, Kre6p and Skn1p; and genetic interactions between the PKC1 pathway and extracellular matrix assembly. J. Cell Biol. 127:567–579. 46. Rose, M. D., L. M. Misra, and J. P. Vogel. 1989. KAR2, a karyogamy gene, is the yeast homolog of the mammalian BiP/GRP78 gene. Cell 57:1211–1221. 47. Rothstein, R. J. 1983. One step gene disruption in yeast. Methods Enzymol. 101:202–211. 48. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 49. Sanger, F. G., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest

We thank members of the Bussey laboratory for advice and discussions, Charlie Boone for his great yeast library, and Diane Oki for manuscript preparation. This work was supported by Operating and Strategic grants from the Natural Sciences and Engineering Research Council of Canada.

J. BACTERIOL.

VOL. 178, 1996

A NOVEL ER PROTEIN INVOLVED IN b1,6-GLUCAN ASSEMBLY

50. Sherman, F., G. R. Fink, and J. B. Hicks. 1982. Methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 51. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503–517. 52. Stratford, M. 1994. Another brick in the wall? Recent developments concerning the yeast cell envelope. Yeast 10:1741–1752. 53. Tanner, W., and L. Lehle. 1987. Protein glycosylation in yeast. Biochim. Biophys. Acta 906:81–99. 54. Van Berkel, M. A. A., L. H. P. Caro, R. C. Montijn, and F. M. Klis. 1994.

1171

Glucosylation of chimeric proteins in the cell wall of Saccharomyces cerevisiae. FEBS Lett. 349:135–138. 55. Van Der Vaart, J. M., L. H. P. Caro, J. W. Chapman, F. M. Klis, and C. T. Verrips. 1995. Identification of three mannoproteins in the cell wall of Saccharomyces cerevisiae. J. Bacteriol. 177:3104–3110. 56. Van Rinsum, J., F. M. Klis, and H. Van Den End. 1991. Cell wall glucomannoproteins of Saccharomyces cerevisiae mnn9. Yeast 7:717–726. 57. Zalkin, H., and C. Yanofsky. 1982. Yeast gene TRP5: structure, function, regulation. J. Biol. Chem. 257:1491–1500.

Downloaded from http://jb.asm.org/ on August 25, 2015 by guest