DAMB, a Novel Dopamine Receptor Expressed Specifically in Drosophila Mushroom Bodies

Neuron, Vol. 16, 1127–1135, June, 1996, Copyright 1996 by Cell Press

DAMB, a Novel Dopamine Receptor Expressed Specifically in Drosophila Mushroom Bodies Kyung-An Han,* Neil S. Millar, † Michael S. Grotewiel,* and Ronald L. Davis*‡ *Department of Cell Biology ‡ Department of Neurology Baylor College of Medicine Houston, Texas 77030 † Wellcome Laboratory of Molecular Pharmacology Department of Pharmacology University College London London WC1E 6BT United Kingdom

Summary The modulatory neurotransmitters that trigger biochemical cascades underlying olfactory learning in Drosophila mushroom bodies have remained unknown. To identify molecules that may perform this role, putative biogenic amine receptors were cloned using the polymerase chain reaction (PCR) and singlestrand conformation polymorphism analysis. One new receptor, DAMB, was identified as a dopamine D1 receptor by sequence analysis and pharmacological characterization. In situ hybridization and immunohistochemical analyses revealed highly enriched expression of DAMB in mushroom bodies, in a pattern coincident with the rutabaga-encoded adenylyl cyclase. The spatial coexpression of DAMB and the cyclase, along with DAMB’s capacity to mediate dopamine-induced increases in cAMP make this receptor an attractive candidate for initiating biochemical cascades underlying learning. Introduction Learning and memory are behavioral modifications believed to be mediated by complex biochemical processes triggered by neurotransmitters and neuromodulators (Davis, 1996; Bailey et al., 1994; Byrne et al., 1993). The advanced genetics and molecular biology of Drosophila have provided powerful experimental tools to understand the molecular mechanisms underlying learning and memory. Behavioral screens of flies mutagenized with ethylmethane sulfonate or with transposable elements have produced mutants defective in olfactory learning (Davis, 1996). The dunce (dnc) mutant, first isolated as a poor learner with a reduced short-term memory in olfactory conditioning (Dudai et al., 1976; Dudai, 1983), has a defect in the gene coding for cAMP-specific phosphodiesterase (Nighorn et al., 1994). Flies with reduced cAMP-dependent PKA activity (DCO) also fail at olfactory conditioning (Drain et al., 1991; Skoulakis et al., 1993). Furthermore, the learning/memory mutant, rutabaga (rut), has an impaired adenylyl cyclase (AC), an enzyme known to be normally activated by Ca21/ calmodulin and G-proteins (Livingstone et al., 1984; Levin et al., 1992). Thus, a cAMP-mediated signaling

pathway, activated by a neurotransmitter or neuromodulator of unknown nature upon binding to its receptor/ G-protein complex coupled to the rut-AC, is critical for olfactory conditioning in Drosophila. A similar signal transduction pathway utilizing the cAMP cascade has also been shown to be responsible for synaptic plasticity underlying sensitization of reflex responses of the sea snail, Aplysia californica (Bailey et al., 1994; Byrne et al., 1993). Further characterization of these three learning and memory genes at the cellular level revealed a strikingly common feature. RNA in situ hybridization and immunohistochemical studies of DCO, dnc, and rut indicated that their RNAs are predominantly present in the perikarya of mushroom body neurons, while their protein products are concentrated in the dendritic or axonal processes of these cells (Nighorn et al., 1991; Han et al., 1992; Skoulakis et al., 1993). These observations suggest that these gene products may be critical for mushroom body cell physiology. Drosophila has approximately 5000 mushroom body cells, comprising about 2% of the total brain neurons (Davis and Han, 1996; Technau and Heisenberg, 1982). Neuroanatomical analyses of several insect species have demonstrated that mushroom bodies are part of one major pathway of olfactory information flow and that they receive multiple inputs from mechanical, olfactory, gustatory, and visual sensory systems (Schu¨ rmann, 1987). The role of mushroom bodies as an integration site during behavioral conditioning is further supported by studies of two structural mutants, mushroom body miniature and mushroom body deranged, and flies with chemically-ablated mushroom bodies (Heisenberg et al., 1985; de Belle and Heisenberg, 1994). Although these animals are able to sense the cues used during training, they fail at olfactory conditioning. Altogether, these studies indicate that mushroom bodies are principal neuroanatomical substrates for olfactory learning and memory and that they utilize a cAMP-mediated signaling pathway for their physiological modulation (Davis, 1996). Biogenic amines play important roles in learning and memory in both vertebrates and invertebrates (Restifo and White, 1990). Drosophila fed with formamidines, drugs that interfere with octopamine metabolism, display impaired learning after classical conditioning (Dudai et al., 1987). Ddc mutants have defects in the enzyme dopa-decarboxylase, which is necessary for the biosynthesis of serotonin and dopamine. These mutants are deficient in associative learning (Tempel et al., 1984). Injection of different biogenic amines into the honeybee brain prior to or during classical conditioning alters learning and memory processes (Bicker and Menzel, 1989). In vertebrates, local injection of dopamine D1 receptor antagonists into the prefrontal cortex of rhesus monkeys suggests a selective role of the D1 receptor for working memory during oculomotor-delayed response tasks (Sawaguchi and Goldman-Rakic, 1994). Moreover, both a and b adrenergic receptor systems have been shown to be involved in modulating selective forms of memory in animal model systems and human subjects

Neuron 1128

Figure 1. Deduced Amino Acid Sequence of DAMB The seven putative TM domains are indicated by overlining and roman numerals. Circles, triangles, and a square mark putative N-linked glycosylation sites, protein kinase C phosphorylation sites, and a Ca2 1/calmodulin- dependent protein kinase II phosphorylation site, respectively. A cysteine residue for potential palmitoylation near the carboxy-terminus is marked with an asterisk. The aspartic acid residue (D) in TM3 and two serine residues (S) in TM5 for dopamine binding are indicated in bold type.

(Stephenson and Andrew, 1994; Cahill et al., 1994; McGaugh et al., 1993). We report here the isolation of a novel dopamine D1 receptor named DAMB (dopamine receptor in mushroom bodies). This receptor is capable of activating AC to stimulate cAMP accumulation, and is expressed preferentially in the mushroom bodies. The roles for biogenic amines in conditioned behavior and the spatial coexpression of DAMB with the rut-AC in axons of the mushroom body cells make this receptor an attractive candidate for initiating the signal transduction processes leading to learning and memory in Drosophila. Results DAMB Sequence Predicts a Biogenic Amine Receptor To identify new biogenic amine receptors that may modulate the physiology of mushroom body cells for conditioned behavior, we carried out the reverse transcriptase (RT)-polymerase chain reaction (PCR) with fly head RNA

and primers made from conserved amino acids in transmembrane domains (TM) 6 and 7 of a Drosophila octopamine/tyramine receptor (Arakawa et al., 1990; Saudou et al., 1990). Approximately 100 cloned RT-PCR products were screened by single-strand conformation polymorphism (SSCP) analysis, which resolves singlestranded DNA species by length and by secondary structure (Orita et al., 1989). A 100 bp RT-PCR product identified by its distinct mobility from known biogenic amine receptors from SSCP analysis (K. -A. H. and R. L. D., unpublished data) was used to screen a head cDNA library. A cDNA clone of 3151 bp was isolated with a long open reading frame predicting a protein (DAMB) of 537 amino acids (Figure 1). Hydropathy profiles revealed seven hydrophobic domains with striking similarity to the putative TM of G-protein-coupled receptors. In addition, a hydrophobic stretch that may serve as a signal sequence existed at the amino-terminus. An aspartic acid residue was found in TM3 and two serine residues in TM5 (Figure 1). These residues comprise part of the binding site for biogenic

A Novel Dopamine Receptor in Mushroom Bodies 1129

Figure 2. Sequence Relationship of DAMB with Other Biogenic Amine Receptors (A) The deduced amino acid sequence of DAMB is aligned with the human dopamine D1 receptor (DADR_HUMAN; Genbank accesion number P21728), the Drosophila dopamine D1 receptor (D1DR_DROME; S44275), the human dopamine D2 receptor (D2DR_ HUMAN; P14416), the human a1a adrenergic receptor (A1AA_HUMAN; P25100), the human b2 adrenergic receptor (B2AR_HUMAN; P07750), the Drosophila octopamine/tyramine receptor (OAR_DROME; P22270), and the human 5-HT2C receptor (5H2C_HUMAN; P28335). Predicted TM domains are overlined and numbered. The amino acids conserved in all receptors being compared are shaded. Numbers in parentheses correspond to the number of amino acids at the amino- and the carboxy- termini and in the third cytoplasmic loop that are not represented in the figure. (B) Dendrogram of Drosophila biogenic amine receptors and human dopamine and adrenergic receptors. The amino acid sequences shown in Figure 2A were used for the phylogenetic analysis. The numbers at the forks are a measure of variation of the branch (100 5 no variation) in the estimated tree constructed from 1000 bootstrap data sets (see Experimental Procedures). These numbers are related to a confidence limit for the positions of the branches. This is an unrooted tree. Genbank accession numbers for the receptors not shown in Figure 2A are D3DR_ HUMAN, P35462; D4DR_HUMAN, P21917; D5DR_HUMAN, P21918; 5HT1_DROME, P20905; 5HTA_DROME, P28285; 5HTB_ DROME, P28286.

amines of other receptors (Vernier et al., 1993), implying that DAMB belongs to the biogenic amine receptor superfamily. DAMB also contained putative sites (Figure 1) for N-linked glycosylation, phosphorylation by protein kinase C, and Ca21/calmodulin-dependent protein kinase II, and palmitoylation that may function in desensitization of biogenic amine receptors (Ng et al., 1994). Comparison of the predicted amino acid sequence of DAMB with protein data banks (Swiss Protein and Protein Identification Resource) revealed the highest sequence identity with biogenic amine receptors, confined primarily to the seven TMs. To identify the most closely related receptors, the divergent sequences among biogenic amine receptors including the third cytoplasmic loop and the amino- and carboxy-tails were removed for a similarity search. Surprisingly, the remaining core sequence of DAMB failed to show significantly higher identity to any one particular receptor subfamily (Figures 2A and 2B). The degree of sequence identity within the TM domains ranged from 53% (human a1a adrenergic receptor) to 48% (human dopamine D2 receptor). Phylogenetic parsimony analysis revealed that DAMB is

divergent evolutionarily from other Drosophila biogenic amine receptors and mammalian dopamine receptors (Figure 2B). Nevertheless, DAMB was closer to a common ancestor of human dopamine D1 and adrenergic receptors than those of human dopamine D2 and other Drosophila biogenic amine receptors.

Dopamine-Induced cAMP Accumulation through DAMB To investigate the functional properties of DAMB, Drosophila S2 cells stably transfected with the DAMB cDNA were assayed for cAMP accumulation in the presence of various neuromodulators. Serotonin (5-HT) or histamine at 10 mM produced no elevation of cAMP, while dopamine stimulated cAMP accumulation approximately 10-fold. This effect was blocked by the D1 receptor antagonist, flupenthixol (Figure 3). There was no increase in cAMP upon dopamine application at the same concentration in untransfected cells (data not shown). The dopamine-induced cAMP increase was concentration-dependent and was saturable, with an EC50 of 3.5 3

Neuron 1130

Figure 3. Agonist Modulation of cAMP Levels in Drosophila S2 Cells and Human HEK Cells The left insert shows dopamine-induced increase in cAMP levels (D) in S2 cells transfected with DAMB (S2-DAMB) over basal levels (B). This increase was blocked by the D1-antagonist flupenthixol (D1F). The right insert shows the effect of dopamine (D), octopamine (O) and tyramine (T) in transiently transfected HEK cells. All ligands were applied at 10 mM. The data for the inserts are the means of between two and five independent experiments, each performed in duplicate. Also shown are the dose-response curves for agonist-induced elevation in cAMP levels in S2 cells transfected with DAMB. All data points are the means of duplicate samples and have been normalized to the response with dopamine at 1023 M. The curve for dopamine is derived from a single experiment, but is typical of three independent experiments, and is fitted by least-squares method. The cAMP accumulation observed with tyramine and octopamine was also observed in untransfected cells (see Results), and was therefore not dependent upon DAMB.

1027 M (Figure 3). Norepinephrine also produced significant elevations of cAMP in transfected cells, though it was about 100-fold less potent than dopamine. Octopamine and tyramine produced a modest accumulation of cAMP. However, this was observed in transfected (Figure 3) and untransfected S2 cells (data not shown). The effects of these neuromodulators on DAMB were therefore assessed after expression in human embryonic kidney (HEK) cells. When transiently expressing DAMB, these cells responded to 10 mM of dopamine with an 18-fold increase in cAMP, while neither octopamine nor tyramine produced any significant accumulation (Figure 3). Untransfected HEK cells also failed to respond to dopamine, octopamine, or tyramine (data not shown). Together, these results indicate that DAMB represents a functional dopamine receptor. Dopamine receptors have been classified into two types, D1 and D2, based upon biochemical and pharmacological criteria. D1 receptors stimulate AC through Gs to increase cAMP, while D2 receptors inhibit the activation of AC through Gi (O’Dowd, 1993). The ability of DAMB to stimulate cAMP production upon dopamine application, and the blockade of this effect by flupenthixol, indicated that DAMB is a dopamine D1 receptor. The DAMB Receptor Is Preferentially Expressed in Mushroom Bodies To examine the tissue distribution of DAMB, RNA blots of head and body fractions were probed with the DAMB

cDNA clone. A single mRNA species of 5.2 Kb was detected in the head fraction, but not in the body fraction (data not shown), indicating that the DAMB RNA was highly enriched in fly heads. In situ hybridization was performed to determine the cell types that expressed DAMB RNA. The DAMB transcripts, detected with antisense (Figures 4B and 4D) but not sense (Figure 4E) RNA probes, were expressed preferentially in the perikarya of mushroom body cells. These cells are situated in the dorsal and posterior portion of the brain cortex (Figure 4F). No significant signal was detectable elsewhere in the heads, thoracic, or abdominal ganglia, or in other body tissues (Figure 4D). Furthermore, in situ hybridization to whole mounts of the brains of third instar larvae also revealed highly preferential expression of the receptor in dorsal regions of brain lobes where mushroom body cells reside (Figure 4H). Thus, the DAMB receptor gene is expressed quite specifically in mushroom body neurons, and this expression pattern is observed before and after metamorphosis, a time during which mushroom bodies undergo pronounced morphological changes (Technau and Heisenberg, 1982). To determine the distribution of DAMB within mushroom body cells, a polyclonal antibody was generated against the third cytoplasmic loop of the receptor, affinity-purified, and used to stain head sections. Strong immunoreactivity was detected in the neuropil that house the mushroom body axons, including the pedunculi (Figures 4C and 4G), a, b, and g lobes (Figures 4A and 4G). Staining of higher intensity was consistently

(Legend for figure 4 continued from next page) (C) A frontal section at the level of the pedunculi (p). (F) A schematic view of a sagittal section of a fly brain showing the approximate planes of sections shown in Figures (4A)–(4C). The mushroom body perikarya are colored in dark purple, the calyx in light pink, the pedunculus in green, and the lobes in blue. The orientation of the fly brain is indicated by dorsal (D), up and anterior (A), to the left. The outer outline is of the brain and the two inner outlines delimit regions of neuropil from the overlying cortex of cell bodies. (G) Sagittal head section. c 5 calyx, p 5 pedunculus. (I) Whole mount of a third instar larval brain and ventral ganglion. The anti-DAMB antibody was applied to head sections (A, C, G) or whole mount larval CNS (I). The grainy staining of the cellular cortex in (G) is nonspecific, since cortex staining in sections incubated with preimmune serum (data not shown) was similar and this varied from experiment to experiment (see Figures 4A and 4C). For all sections, dorsal is up. Anterior is to the left in sagittal sections.

A Novel Dopamine Receptor in Mushroom Bodies 1131

Figure 4. Expression of DAMB in Mushroom Bodies In Situ Hybridization: Cryosections of heads or whole flies were hybridized with digoxigenin-labeled antisense riboprobes representing the 59 half of the DAMB cDNA. (B) A frontal head section at the level of the calyx, K5mushroom body cells. (D) A sagittal section of a whole fly. T5thoracic ganglia, A5abdominal ganglion. (E) A sagittal section of a whole fly hybridized with a sense DAMB probe. (H) Whole mount of a third instar larval brain hybridized with an antisense DAMB probe. The diffuse signals in the optic lobes represent background as evidenced by the presence of similar signals with sense probes (data not shown) and the failure to see any corresponding signal by immunohistochemistry (see Figure 4I). Immunohistochemistry: (A) A frontal head section at the level of a, b and g lobes. The insert shows immunostaining in b and g lobes from a medial sagittal section. For the insert, anterior is to the left and dorsal is at the top. (Legend for figure 4 continued on previous page)

Neuron 1132

observed in the a and b lobes compared with the pedunculi and g lobes. The g lobes wrap around the anterior face of the b lobes (Strausfeld, 1976; Figure 4A, inset). In contrast, immunoreactivity in the calyces, which house the dendritic elements of mushroom bodies, was absent (Figure 4G). Immunostaining to whole mounts of the central nervous system of third instar larvae also revealed highly specific expression of the receptor in the mushroom body lobes and pedunculi (Figure 4I). These observations suggested that the receptor functions primarily in the axons of mushroom body cells. This pattern of immunoreactivity bears a striking similarity to the rut-encoded AC (Han et al., 1992). This cyclase also accumulates in the axons of mushroom body cells and is nearly absent from the calyces. In contrast, the dnc-encoded phosphodiesterase and the DCOencoded catalytic subunit of protein kinase A (PKA) accumulate in both the axons and the dendrites of mushroom body cells (Nighorn et al., 1991; Skoulakis et al., 1993). The superior arch of the central complex displayed very weak immunoreactivity for DAMB (Figure 4C), but no other regions of heads or bodies displayed consistent staining with the anti-DAMB antibody. Thus, we conclude that the novel dopamine D1 receptor, DAMB, is highly enriched in the axonal tracts of mushroom body cells. Discussion In the present study, we have identified a novel dopamine D1 receptor, DAMB, by a unique approach utilizing RT-PCR and SSCP, which allows the discrimination of novel members of a large gene family (K.-A. H. and R. C. D., unpublished data). DAMB and a DAMB variant with an alternative carboxy-terminus (Feng et al., in press) are distinct in sequence from mammalian dopamine D1 receptors and another recently cloned Drosophila D1 receptor (Gotzes et al., 1994; Sugamori et al., 1995). Nevertheless, the interaction sites with Gs proteins for second messenger signaling appear to be conserved, since DAMB is capable of activating the second messenger cascade in mammalian cells. The low sequence identity of DAMB with other dopamine D1 receptors indicated that DAMB is the prototypic member of a new family of dopamine D1 receptors. This new family may be unique to invertebrates, or there may be DAMB orthologs in vertebrates that are yet to be identified. Most vertebrate dopamine receptors were obtained by sequence similarity with already identified adrenergic or dopamine receptors, leading to a biased selection based upon sequence homology. Nevertheless, unique mammalian receptor genes have been isolated using invertebrate probes. A novel 5-HT receptor from the human (5-HT7) was isolated by sequence homology with the Drosophila 5-HT receptor DRO1 as a probe (Bard et al., 1993). Thus, it would be intriguing to determine whether there is a DAMB counterpart in mammalian cells. The accumulated evidence indicates that the biogenic amines play essential roles in behavioral plasticity. In Aplysia, a serotonin receptor mediates the signal generated by the reinforcer in sensory neurons during conditioning (Bailey et al., 1994; Emptage and Carew, 1993;

Figure 5. Model for the cAMP Cascade Triggered by DAMB during Olfactory Conditioning Olfactory information received at the antennae is conveyed through the olfactory lobes to the calyces of mushroom body neurons. The actions of reinforcers received during training are mediated by dopaminergic (DA) modulatory neurons to activate the dopamine receptor, DAMB, on the mushroom body axons. Activated DAMB stimulates the rut-encoded AC, leading to increased cAMP production. The elevated cAMP then modulates the synaptic output of mushroom body neurons to motor circuits, either directly through cyclic nucleotide-sensitive potassium channels (Davis, 1996) or indirectly through PKA, which in turn, phosphorylates ion channels and other molecules for short-term memory or the nuclear transcription factor CREB for long-term memory.

Abrams et al., 1991). The selective antagonist for 5-HT1B receptors, 21–009, produces amnesia in the chick when injected at the time of learning during passive avoidance training (Stephenson and Andrew, 1994). Dopamine D1 receptors play a selective role in the mnemonic process during oculomotor-delayed response tasks in primates (Sawaguchi and Goldman-Rakic, 1991). Most importantly, in considering DAMB function, Drosophila mutants deficient in the enzyme dopa decarboxylase (Ddc) have reduced dopamine content and can perceive normally the conditioned and unconditioned stimuli presented during training, but are deficient in olfactory learning (Tempel et al., 1984). The requirement for dopaminergic modulation for normal Drosophila conditioning, along with three other observations, lead to a parsimonious model (Figure 5) that places DAMB as a receptor for dopaminergic modulatory input during conditioning. First, DAMB displays an intriguing expression pattern in the Drosophila central nervous system. In situ hybridization to fly sections demonstrated that DAMB transcripts were highly preferential to the perikarya of mushroom body neurons. Immunohistochemical analysis corroborated the in situ data and further revealed that DAMB receptors were highly enriched in the axonal elements of mushroom bodies. Given the importance of mushroom bodies in insect behavior (Davis, 1993), these findings strongly suggest

A Novel Dopamine Receptor in Mushroom Bodies 1133

a role for DAMB in mediating physiological changes underlying behavior in mushroom bodies. Second, the distribution of DAMB in the mushroom body neuropil is strikingly similar to the rut-AC (Han et al., 1992). The rut-AC is enriched in the lobes and pedunculi of the mushroom bodies, but not the calyces. This AC has been posited to serve as a coincidental detector during conditioning in Drosophila (Davis, 1993) and in Aplysia (Bourne and Nicoll, 1993; Abrams et al., 1991), integrating the signals mediated by G-protein activation and Ca2 1/calmodulin complexes. The a subunit of Gs proteins is also expressed at a higher level in the mushroom body neuropil (Forte et al., 1993). Therefore, the colocalization of DAMB with the rut-AC in axonal structures of the mushroom bodies and the ability of DAMB to activate AC make this receptor an exceptionally attractive candidate for mediating the effects of reinforcers during associative conditioning. Third, the mushroom body lobes, but not the calyces, are densely innervated by two distinct clusters of dopamine- and tyrosine hydroxylase-immunoactive neurons (Na¨ssel and Elekes, 1992). These cells are large field interneurons connecting different regions of the mushroom bodies to each other and to other neuropils. Dopaminergic neurons from both clusters, one located in the anterior protocerebrum and the other at the level of the central body, as well as neurons from other scattered regions, innervate the mushroom body neuropil in which DAMB resides. Thus, the brain neuroanatomy is arranged such that dopaminergic inputs, potentially carrying information from different sensory modalities utilized during learning, converge upon the lobes of the mushroom bodies. Therefore, dopamine, synthesized in modulatory neurons, may convey the information from the unconditioned stimulus or reinforcer by activating the DAMB receptor localized on the mushroom body axons (Figure 5). The activated DAMB then stimulates the rut-encoded AC to increase cAMP production. Elevated cAMP modulates the synaptic output of mushroom body neurons that carry the information from the conditioned stimulus, that is, odor information for olfactory conditioning, to motor circuits. The physiological modulation of mushroom bodies by dopamine engages PKA, which phosphorylates ion channels, nuclear transcription factors, or other substrates to encode memory (Figure 5). The dnc-encoded phosphodiesterase also plays a role by regulating the effective level of cAMP in mushroom body processes. The spatial colocalization of the DAMB, rut, dnc, and DCO gene products, as well as dopaminergic terminals in the mushroom body lobes, satisfy the constraints of this model. Furthermore, olfactory learning deficits of Ddc, rut, dnc, and DCO are consistent with such a model. Two predictions of the model, that DAMB mutants are defective in olfactory learning and that DAMB mutation is epistatic to rut , are currently under test. Experimental Procedures Isolation of DAMB cDNA Total RNA from heads was isolated from CsCl gradients (Davis and Davidson, 1986) and used to make cDNA, using random hexamers

(Pharmacia) and AMV reverse transcriptase (Promega). PCR was carried out with 100 ng of cDNA, as described (Han and KuleszMartin, 1992). Primers used for PCR were 59TTCGTCATCTGCTGGC TGCCCTTCTTC39 and 59TGGCTGGGCTACATCAACTCG39, corresponding to sequences in TM 6 and 7, respectively, of the Drosophila tyramine receptor (Saudou et al., 1990). PCR products cloned into pBluescript SK (Stratagene) were screened by SSCP (Spinardi et al., 1991) to select novel sequences from already known biogenic amine receptors of Drosophila (K. A. H. and R. L. D., unpublished data). K13sc, one of the novel clones, was used to screen a cDNA library made from Canton-S head poly(A 1) RNA (a gift from Dr. P. Salvaterra [City of Hope]), as described (Davis and Davidson, 1986). The DAMB cDNA was subcloned and both strands were sequenced using the Sequenase kit (USB) after timed exonuclease III reactions to generate nested deletions (Sambrook et al., 1989). Phylogenetic Analysis Drosophila biogenic amine receptors and human adrenergic and dopamine receptors were aligned using the PIMA program (Smith and Smith, 1992), and optimized manually. Parsimonious trees were constructed by the Protpars program run on 1000 bootstrap data sets using PHYLIP (Phylogeny Inference Package) version 3.53c, 1993, distributed by the author J. Felsenstein (University of Washington, Seattle). The order of input sequences was jumbled ten times. The consensus tree was generated by the Consense program using the Majority-rule method to determine the most parsimonious tree. Pharmacology A 1645 bp Pvu II fragment (nt 569–2214) of DAMB cDNA that contains the open reading frame was subcloned into the Drosophila expression vector pRmHa3 (a gift from Dr. Thomas Bunch, University of Arizona) and cotransfected with a hygromycin-selection plasmid, pCoHygro, into the Drosophila S2 cell line as described (Millar et al., 1994). A polyclonal stable cell population was established by selecting transfected cells in M3 medium containing 300 mg/ml hygromycin B. Expression of the DAMB cDNA was induced by 0.6 mM CuSO4 for 24 hr. Cells were incubated with ligands in the presence of 0.1 mM 3-isobutyl-1-methyl xanthine for 15 min at 258C, then harvested in 0.5 ml ice-cold ethanol. Antagonists were added to the cells 15 min prior to the addition of agonists. Cyclic AMP assays were carried out using a cAMP [3H] assay system (Amersham) according to the instructions of the manufacturer. The Pvu II fragment of the DAMB cDNA was also subcloned into pcDNA3 (Invitrogen). HEK cells were transiently transfected with pcDNA3-DAMB (about 3 mg/well) using a modified Ca21 phosphate DNA coprecipitation method (Chen and Okayama, 1987). The transfected HEK cells were washed once in phosphate buffered saline (PBS) (pH 7.2), 24 hr after transfection, and processed for cAMP assays. In Situ Hybridization Sense and antisense riboprobes were synthesized from a clone containing the 59 half of the DAMB cDNA (nt 1–1276) in the presence of digoxigenin-UTP (Boehringer) using either T7 or T3 RNA polymerase, according to the instructions of the manufacturer (Promega). After two cycles of ethanol precipitation, digoxigenin-labeled riboprobes were resuspended in 50% formamide/5X SSC. We placed 10 mm frontal or sagittal cryosections from Canton-S fly heads or whole flies on 3-aminopropyltriethoxy-silane-treated slides and air-dried them before fixation in 4% paraformaldehyde in PBS for 10 min. After two washes in PBS for 10 min each, the sections were treated with 0.2 N HCl for 20 min, washed in 2X SSC for 30 min, and treated with Pronase (117 mg/ml in 50 mM TisHCl [pH 7.5], 5 mM EDTA) for 5 min. The sections were re-fixed in 4% paraformaldehyde and acetylated in PBS containing 0.1M triethanolamine and 0.25% acetic anhydride for 10 min. After washing in 2X SSC, the sections were prehybridized in hybridization buffer (50% formamide, 5X SSC, 5% dextran sulfate, 1X Denhardt’s solution, 0.65 mg/ml sonicated salmon sperm DNA, 0.1% SDS), followed by hybridization in the same buffer containing digoxigenin-labeled riboprobes at 428C overnight. The sections were treated with RNAse A (20 mg/ml in 3X SSC, 10 mM TrisHCl [pH 7.5], 5 mM EDTA) and

Neuron 1134

unbound probe was washed away in 0.1X SSC at 658C for 10 min. The immunological detection of hybridized probe was carried out as described previously (Nighorn et al., 1991). Immunohistochemistry A Bgl II-Bst XI fragment (nt 1496–1815) of the DAMB cDNA coding for the third cytoplasmic loop was subcloned in pGEX-KT to generate a fusion protein in bacteria. The cloning site was sequenced to confirm the in-frame insertion with glutathione-S-transferase. The fusion protein was produced after induction with isopropyl b-thiogalactopyranoside for 4 hr, purified using glutathione-agarose (Frangioni and Neel, 1993), and injected intradermally into SPF New Zealand white rabbits (Harlow and Lane, 1988). After the second boost, the antiserum was collected and anti-DAMB antibody was affinity-purified (Tejedor et al., 1995) using the fusion protein. Canton-S flies were fixed in 4% paraformaldehyde in PBS containing 40 mM lysine for 3 hr, and soaked in 25% sucrose solution in PBS overnight at 48C. We prepared 10 mm cryosections on gelatincoated slides. After washing in PBS and PBHT (20 mM sodium phosphate, [pH 7.4], 0.5 M NaCl, 0.2% Triton X-100), the sections were preincubated with PBHT containing 5% goat serum for 3 hr, and incubated with the affinity-purified anti-DAMB antibody, or the preimmune serum, at room temperature overnight. This was followed by 3 washes in PBHT for 10 min each. The sections were then incubated with biotinylated goat anti-rabbit IgG antibody for 3 hr followed by 3 washes in PBHT for 10 min each. Endogenous peroxidase activity was blocked by treating the sections with 3% hydrogen peroxide for 10 min and horseradish peroxidase-conjugated biotin-avidin complex (ABC Vector kit) was applied according to the instructions of the manufacturer. The immunoreactivity was visualized after staining with 1 mg/ml diaminobenzidine and 0.03% hydrogen peroxide in PBHT. Acknowledgments We thank S. Swanson, S. Ahmed, T.-M. Chen and E. Chen for expert technical assistance, and Dr. David Wheeler for assistance on phylogenetic analysis. We thank L. Hall and colleagues for communicating unpublished results. This work was supported by grants from the Human Frontiers Science Project, the National Institutes of Health, and an endowed chair from the Welch Foundation to R. L. D., and by the Wellcome Trust to N. S. M. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received January 15, 1996; revised May 17, 1996. References Abrams, T.W., Karl, K.A., and Kandel, E.R. (1991). Biochemical studies of stimulus convergence during classical conditioning in Aplysia: dual regulation of adenylate cyclase by Ca21/calmodulin and transmitter. J. Neurosci. 11, 2655–2665. Arakawa, S., Gocayne, J.D., McCombie, W.R., Urquhar, T.D. A., Hall, L.M., Fraser, C.M., and Venter, J.C. (1990). Cloning, localization, and permanent expression of a Drosophila octopamine receptor. Neuron 4, 343–354. Bailey, C.H., Alberini, C., Ghirardi, M., and Kandel, E.R. (1994). Molecular and structural changes underlying long-term memory storage in Aplysia. Adv. Second Messenger Phosphoprotein Res. 29, 529–544. Bard, J.A., Zgombick, J., Adham, N., Vaysse, P., Branchek, T.A., and Weinshank, R.L. (1993). Cloning of a novel human serotonin receptor (5-HT7) positively linked to adenylate cyclase. J. Biol. Chem. 268, 23422–23426. Bicker, G., and Menzel, R. (1989). Chemical codes for the control of behaviour in arthropods. Nature 337, 33–39.

(1993). Roles of second messenger pathways in neuronal plasticity and in learning and memory. Insights gained from Aplysia. Adv. Second Messenger Phosphoprotein Res. 27, 47–108. Cahill, L., Prins, B., Weber, M., and McGaugh, J.L. (1994). Betaadrenergic activation and memory for emotional events. Nature 371, 702–704. Chen, C., and Okayama, H. (1987). High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745–2752. Davis, R.L., and Davidson, N. (1986). The memory gene dunce1 encodes a remarkable set of RNAs with internal heterogeneity. Mol. Cell. Biol. 6, 1464–1470. Davis, R.L. (1993). Mushroom bodies and Drosophila learning. Neuron 11, 1–14. Davis, R.L., and Han, K.-A. (1996). Mushrooming mushroom bodies. Current Biol. 6, 146–148. Davis, R.L. (1996). Physiology and biochemistry of Drosophila learning mutants. Physiol. Rev. 76, in press. de Belle, J.S., and Heisenberg, M. (1994). Associative odor learning in Drosophila abolished by chemical ablation of mushroom bodies. Science 263, 692–695. Drain, P., Folkers, E., and Quinn, W.G. (1991). cAMP-dependent protein kinase and the disruption of learning in transgenic flies. Neuron 6, 71–82. Dudai, Y., Jan, Y.-N., Byers, D., Quinn, W., and Benzer, S. (1976). dunce, a mutant of Drosophila deficient in learning. Proc. Natl. Acad. Sci. USA 73, 1684–1688. Dudai, Y. (1983). Mutations affect storage and use of memory differentially in Drosophila. Proc. Natl. Acad. Sci. USA 80, 5445–5448. Dudai, Y., Buxbaum, J., Corfas, G., and Ofarim, M. (1987). Formamidines interact with Drosophila octopamine receptors, alter the flies’ behavior and reduce their learning ability. J. Comp. Physiol. A 161, 739–746. Emptage, N.J., and Carew, T.J. (1993). Long-term synaptic facilitation in the absence of short-term facilitation in Aplysia neurons. Science 262, 253–256. Feng, G., Hannan, F., Reale, V., Hon, Y.Y., Kousky, C.T., Evans, P.D., and Hall, L.M. (1996). Cloning and functional chracterization of a novel dopamine receptor from Drosophila melanogaster. J. Neurosci., in press. Forte, M., Quan, F., Hyde, D., and Wolfgang, W. (1993). Ga proteins in Drosophila: structure and developmental expression. In GTPase in Biology. B. Dickey and L. Birnbaumer, eds. (Heidelberg, Federal Republic of Germany: Springer-Verlag), pp. 319–334. Frangioni, J.V., and Neel, B.G. (1993). Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal. Biochem. 210, 179–187. Gotzes, F., Balfanz, S., and Baumann, A. (1994). Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors. Receptors and Channels 2, 131–141. Han, K.-A., and Kulesz-Martin, M.F. (1992). Altered expression of wild-type p53 tumor suppressor gene during murine epithelial cell transformation. Cancer Res. 52, 749–753. Han, P.-L., Levin, L.R., Reed, R.R., and Davis, R.L. (1992). Preferential expression of the Drosophila rutabaga gene in mushroom bodies, neural centers for learning in insects. Neuron 9, 619–627. Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Heisenberg, M., Borst, A., Wagner, S., and Byers, D. (1985). Drosophila mushroom body mutants are deficient in olfactory learning. J. Neurogenet. 2, 1–30.

Bourne, H.R., and Nicoll, R. (1993). Molecular machines integrate coincident synaptic signals. Cell 72, 65–75.

Levin, L.R., Han, P.-L., Hwang, P.M., Feinstein, P.G., Davis, R.L., and Reed, R.R. (1992). The Drosophila learning and memory gene rutabaga encodes a Ca21/calmodulin-responsive adenylyl cyclase. Cell 68, 479–489.

Byrne, J.H., Zwartjes, R., Homayouni, R., Critz, S.D., and Eskin, A.

Livingstone, M.S., Sziber, P.P., and Quinn, W.G. (1984). Loss of

A Novel Dopamine Receptor in Mushroom Bodies 1135

calcium/calmodulin responsiveness in adenylate cyclase of rutabaga, a Drosophila learning mutant. Cell 37, 205–215.

minibrain: a new protein kinase family involved in postembryonic neurogenesis in Drosophila. Neuron 14, 287–301.

McGaugh, J.L., Introini-Collison, I.B., Cahill, L.F., Castellano, C., Dalmaz, C., Parent, M.B., and Williams, C.L. (1993). Neuromodulatory systems and memory storage: role of the amygdala. Behav. Brain Res. 58, 81–90.

Tempel, B.L., Livingstone, M.S., and Quinn, W.G. (1984). Mutations in the dopa decarboxylase gene affect learning in Drosophila. Proc. Natl. Acad. Sci. USA 81, 3577–3581.

Millar, N.S., Buckingham, S.D., and Sattelle, D.B. (1994). Stable expression of a functional homo-oligomeric Drosophila GABA receptor in a Drosophila cell line. Proc. R. Soc. Lond. (B) 258, 307–314. Na¨ssel, D.R., and Elekes, K. (1992). Aminergic neurons in the brain of blowflies and Drosophila: dopamine- and tyrosine hydroxylaseimmunoreactive neurons and their relationship with putative histaminergic neurons. Cell Tissue Res. 267, 147–167. Ng, G.Y., Mouillac, B., George, S.R., Caron, M., Dennis, M., Bouvier, M., and O’Dowd, B.F. (1994). Desensitization, phosphorylation and palmitoylation of the human dopamine D1 receptor. Eur. J. Pharmacol. 267, 7–19. Nighorn, A., Healy, M.J., and Davis, R.L. (1991). The cyclic AMP phosphodiesterase encoded by the Drosophila dunce gene is concentrated in the mushroom body neuropil. Neuron 6, 455–467. Nighorn, A., Qiu, Y., and Davis, R.L. (1994). Progress in understanding the Drosophila dnc locus. Comp. Biochem. Physiol. 108, 1–9. O’Dowd, B.F. (1993). Structures of dopamine receptors. J. Neurochem. 60, 804–816. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874–879. Restifo, L.L., and White, K. (1990). Molecular and genetic approaches to neurotransmitter and neuromodulator systems in Drosophila. Adv. Insect Physiol. 22, 115–219. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Saudou, F., Amlaiky, N., Plassat, J.L., Borrelli, E., and Hen, R. (1990). Cloning and characterization of a Drosophila tyramine receptor. EMBO J. 9, 3611–3617. Sawaguchi, T., and Goldman-Rakic, P.S. (1994). The role of D1dopamine receptor in working memory: local injections of dopamine antagonists into the prefrontal cortex of rhesus monkeys performing an oculomotor delayed-response task. J. Neurophysiol. 71, 515–528. Schu¨rmann, F.-W. (1987). The architecture of the mushroom bodies and related neuropils in the insect brain. In Arthropod Brain, A.P. Gupta, ed. (New York: Wiley-Interscience), pp. 231–264. Skoulakis, E.M., Kalderon, D., and Davis, R.L. (1993). Preferential expression in mushroom bodies of the catalytic subunit of protein kinase A and its role in learning and memory. Neuron 11, 197–208. Smith, R.F., and Smith, T.F. (1992). Pattern-Induced Multi-sequence Alignment (PIMA) algorithm employing secondary structure-dependent gap penalties for comparitive protein modeling. Protein Eng. 5, 35–41. Spinardi, L., Mazars, R., and Theillet, C. (1991). Protocols for an improved detection of point mutations by SSCP. Nucl. Acids Res. 19, 4009. Stephenson, R.M., and Andrew, R.J. (1994). The effects of 5-HT receptor blockade on memory formation in the chick: possible interactions between b-adrenergic, and serotonergic systems. Pharmacol. Biochem. Behav. 48, 971–975. Strausfeld, N. (1976). Atlas of an Insect Brain (Heidelberg, Federal Republic of Germany: Springer-Verlag), p. 69. Sugamori, K.S., Demchyshyn, L.L., McConkey, F., Forte, M.A., and Niznik, H.B. (1995). A primordial dopamine D1-like adenylyl cyclaselinked receptor from Drosophila melanogaster displaying poor affinity for benzazepines. FEBS Lett. 362, 131–138. Technau, G., and Heisenberg, M. (1982). Neural reorganization during metamorphosis of the corpora pedunculata in Drosophila melanogaster. Nature 295, 405–407. Tejedor, F., Zhu, X.R., Kaltenbach, E., Ackermann, A., Baumann, A., Canal, I., Heisenberg, M., Fischbach, K.F., and Pongs, O. (1995).

Vernier, P., Philippe, H., Samama, P., and Mallet, J. (1993). Bioamine receptors: evolutionary and functional variations of a structural leitmotiv. EXS 13, 297–337.