Designing of putative siRNA against geminiviral suppressors of RNAi to develop geminivirus-resistant papaya crop

Int. J. Bioinformatics Research and Applications, Vol. 9, No. 1, 2013

3

Designing of putative siRNA against geminiviral suppressors of RNAi to develop geminivirus-resistant papaya crop Sangeeta Saxena*, Rupesh K. Kesharwani and Vinayak Singh Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow 226025, Uttar Pradesh, India E-mail: [email protected] E-mail: [email protected] E-mail: [email protected] *Corresponding author

Sarita Singh Bioinformatics Division, Biotech Park, Janakipuram, Lucknow 226021, India E-mail: [email protected] Abstract: Geminiviruses are single-stranded circular DNA viruses causing leaf curl disease in papaya crop. Post-Transcriptional Gene Silencing (PTGS), also known as RNAi, acts as a natural antiviral defence mechanism and plays a role in genome maintenance and development in plants. PTGS suppression by viruses makes the plant RNA silencing machinery inefficient. Three geminiviral genes namely AV2, AC2 and AC4 are found to play the role in suppression of RNA silencing. siRNA degrades the target mRNA in a homology-dependent manner. In-silico designing of siRNA against these three genes of geminiviruses infecting Carica papaya was done using bioinformatics tools. This strategy may provide PTGS by specifically targeting the viral genes involved in suppression of plant RNA silencing machinery. Keywords: MSA; multiple sequence alignment; siRNA; short interfering RNA; phylogenetic; BLAST; geminivirus; pre-coat protein gene; replicase gene; suppressors. Reference to this paper should be made as follows: Saxena, S., Kesharwani, R.K., Singh, V. and Singh, S. (2013) ‘Designing of putative siRNA against geminiviral suppressors of RNAi to develop geminivirus-resistant papaya crop’, Int. J. Bioinformatics Research and Applications, Vol. 9, No. 1, pp.3–12. Biographical notes: Sangeeta Saxena is an Assistant Professor at the Department of Biotechnology, School for Biosciences and Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India. Her research interests include molecular plant virology, genetic engineering, bioinformatics, etc. She has extensive experience in molecular biology and agricultural biotechnology. Currently, she is concentrating on papaya viruses and siRNA designing. Copyright © 2013 Inderscience Enterprises Ltd.

4

S. Saxena et al. Rupesh K. Kesharwani is a Research Fellow at the Department of Biotechnology, School for Biosciences and Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India. His research interests include applied statistics, bioinformatics, machine learning and structural bioinformatics. Vinayak Singh is a student of the Department of Biotechnology, School for Biosciences and Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India. His research interests include biotechnology, biochemistry and bioinformatics. Sarita Singh is a Doctoral Fellow at the Bioinformatics Division, Biotech Park, Jankipuram, Lucknow, India. Her current research is focusing on bioinformatics-related applied works.

1

Introduction

Papaya found abundantly in India almost throughout the year is a nutritional goldmine. It is considered an exotic tropical treat in most countries. Medicinal importance of papaya is enormous; it provides the required daily levels of A, C and E vitamins, giving an additional antioxidant property. The fibre-rich papaya helps to keep the cholesterol levels down and folic acid found in it keeps the arteries in good shape (http://www.nisargafood.com/papaya.html). Enzymes like papain and chemopapain in papaya are believed to have anti-inflammatory effects. Apart from above, papaya is used in many pharmaceutical and cosmetic industries (http://www.menshealth.intoday; Krishna et al., 2008). The major limiting factor in the cultivation of papaya is its susceptibility to viral diseases, papaya leaf curl disease being a major one (Saxena et al., 1998). Geminiviruses of Carica papaya are single-stranded, circular DNA viruses bipartite in nature. They replicate via the rolling circle mechanism in plant nucleus (Hanley-Bowdoin et al., 1999). Papaya leaf curl disease first reported by Thomas and Krishnaswamy (1939) is caused by a begomovirus namely Papaya leaf Curl Virus (PaLCuV) (Saxena et al., 1998), transmitted through whitefly species, Bemisia tabaci (Gennadius) (Markham et al., 2004). Infected papaya developed symptoms such as downward curling of leaves, twisted petioles and stunting. It has been reported that apart from PaLCuV, isolates of chilli leaf curl virus and tomato leaf curl virus also infect papaya (Pandey and Mukherjee, 2006; Singh et al., 2006). Geminiviruses are characterised by small geminate particles (18–20 nm) containing either one or two single-stranded circular DNA molecules of around 2.6 kb (Stanley and Gay, 1983). These two DNA molecules DNA-A and DNA-B consist of six and two genes, respectively (Stanley, 1983). It is assumed that on infection by a geminivirus a natural defence system of the plant, PTGS or RNAi is activated (Pooggin and Hohn, 2004). Three geminiviral genes namely AV2 (suppressor of RNA silencing), AC2 (transactivator of viral transcription and a suppressor of RNA silencing) and AC4 (suppressor of host defence mechanism) are found to play the role in suppression of RNA silencing (Chowda-Reddy et al., 2008; Trinks et al., 2005; Vanitharani et al., 2004).

Designing of putative siRNA against geminiviral suppressors

5

RNA interference (RNAi) technology is a powerful methodology recently developed for the specific knockout of targeted genes. It is a process in which the double-stranded short interfering RNA (siRNA) induces the posttranscriptional degradation of homologous transcripts. Short interfering RNAs (siRNA) are 21–23 nucleotide long RNA duplexes, known to silence gene expression by specific cleavage of target RNA it is homologous to (Elbashir et al., 2001). This strategy utilises the potential of a natural, evolutionary conserved mechanism known as RNA interference (RNAi), to silence the expression of desired viral gene and disrupt its life cycle. siRNA acts as a mediator of RNAi by selectively knocking down the expression of desired gene in a highly homology dependent manner and play a variety of roles in biological system. Apart from siRNA involvement in the RNAi pathway, where it interferes with the expression of a specific gene, it acts in RNAi-related pathways, e.g., as an antiviral mechanism or in shaping the chromatin structure of a genome (http://en.wikipedia.org/wiki/Small_interfering_RNA). DNA geminiviruses are thought to be targets of RNA silencing and so it was natural to think geminiviruses, infecting papaya, can be putative targets of RNA silencing using siRNA. As AC2, AC4 and AV2 genes are reported to be involved in suppression of RNA silencing machinery of the plants (Chowda-Reddy et al., 2008; Trinks et al., 2005; Vanitharani et al., 2004), it was thought to design siRNA against these very genes not only to knock out the virus but also to manage the suppression of the plant RNA silencing machinery thus introduced by our in-silico designed siRNA. This small interfering RNA was first discovered by David Baulcombe’s group (www.plantsci.cam.ac.uk/research/baulcombe/rna-research.html) in Norwich, England, as a part of PTGS in plant that forms a part of antiviral defence response to provide innate immunity against viruses. The unifying feature of this mechanism is generation of 21–23 nucleotide long siRNA with 2 nucleotide 3’overhang to knockdown the expression of any gene having complementary sequence to that of siRNA. The cleavage of long double stranded RNA by Ribonuclease III enzyme Dicer produces 21–23 nucleotide long siRNA and this step is known as dicing (Matzke and Birchler, 2005). The siRNA then associate with a protein assembly having endoribonuclease activity RNA-induced silencing complex (RISC) where unwinding of siRNA takes place. Activated RISC is then guided to cognate mRNA by antisense of siRNA and bind to complementary transcript by base pairing interactions between the siRNA antisense strand and homologous mRNA. Further bound mRNA is cleaved during effecter step known as slicing by Argonaut protein (Gupta et al., 2010). It has been reported that the AC2, AC4 and AV2 genes might be involved in suppression of RNA silencing pathway to infect the plant (Trinks et al., 2005; Vanitharani et al., 2004). So we selected the most conserved AC2, AC4 and AV2 gene from different geminivirus isolates infecting papaya to further design siRNA. Conservedness among these genes was identified using ClustalX (http://www. clustal.org) and siRNA was designed against the selected conserved sequence using and Jemboss tool (http://emboss.sourceforge.net/jemboss). siRNA-based strategy may provide a plausible solution to this problem of major significance without having any risks associated with the currently followed practices including transgenic approach. As there are no reports on any specific suppressors genes, which may be working in case of geminiviruses infecting papaya, we have adopted an approach to design siRNA against the reported three suppressors, i.e., AV2, AC2 and AC4, presuming thus designed siRNA may also work to silence the suppressors in geminiviruses infecting papaya, giving resistance to papaya crop.

6

2

S. Saxena et al.

Methods

2.1 Retrieval of essential viral genome sequence of AC2, AC4 and AV2 genes among different geminiviruses infecting papaya Sequence search from NCBI database (www.ncbi.nlm.nih.gov) and Geminidetective database (http://gemini.biosci.arizona.edu) was done. Geminidetective database is a collaborative effort of the laboratories of Dr. Judith Brown (University of Arizona) and Dr. Stephen D. Wyatt (Washington State University) (http://gemini.biosci.arizona.edu). This website serves as a hub of information on whitefly-transmitted geminiviruses. Resources provided at the site include Begomovirus descriptive information (general information; worldwide distribution; a hyperlinked list of Begomovirus and a searchable database of begomovirus isolates by geographic location, virus/isolate name, symptom and host) and Core Coat Protein Sequence Database (including PCR sequence technical information and Mini-Blast search). From the above-mentioned sites, among four isolates (namely papaya leaf curl virus, chilli leaf curl virus and tomato leaf curl virus) of geminiviruses infecting papaya, sequences of RNA silencing suppressor genes, i.e., AC2, AC4 and AV2, were selected as detailed in Table 1. The above-mentioned geminivirus isolates were selected as all these virus isolates were infecting papaya crop and their full-length genome sequence was available in database for further analysis. Table 1

Details of RNA silencing suppressor genes, i.e., AC2, AC4, AV2 sequences retrieved from different geminivirus isolates infecting papaya

Description of genome sequencesa

Accession no.b

Detail about genes with gi numberc

Start and end positiond

Chilli leaf curl virus-India

DQ989326

AC2 i|116282587

1624 – 1220

segment A, complete sequence

AC4 gi|116282587

2455 – 2162

(papaya leaf curl New Delhi virus isolate)

AV2 gi|116282587

148 – 504

AC2 gi|116282578

1199 – 1603

segment A, complete sequence

AC4 gi|116282578

2440 – 2264

(papaya leaf curl New Delhi virus isolate)

AV2 gi|116282578

127 – 465

AC2 gi|22726208

1626 – 1222

AC4 gi|22726208

2457 – 2200

AV2 gi|22726208

150 –506

Tomato leaf curl virus-India

Papaya leaf curl virus

DQ989325

NC_004147

segment A, complete sequence Papaya leaf curl virus segment A complete sequence (Tomato leaf curl virus isolate ToLCND-PRM) a

DQ629103

AC2 gi|102638601

1623 – 1219

AC4 gi|102638601

2460 – 2161

AV2 gi|102638601

147 – 503

Description of genome sequences of geminivirus isolates infecting papaya. Accession numbers of genome sequences, i.e., searched from NCBI. c Gene identification (gi no.) of RNA silencing suppressor gene of AC2, AC4, AV2. d Start and end position of nucleotide for respective gene in the complete genomic sequence. b

Designing of putative siRNA against geminiviral suppressors

7

2.2 Multiple Sequence Alignment of viral genome sequence of AC2, AC4 and AV2 gene among different geminiviruses infecting Papaya ClustalX software was used for Multiple Sequence Alignment (MSA) of each gene, i.e., AC2, AC4 and AV2 from all the four above-selected geminiviruses infecting papaya (Table 1) and to further identify the most conserved sequence, based on alignment analysis and tree view (http://www.clustal.org; http://taxonomy.zoology.gla.ac.uk/rod/ treeview.html). ClustalX and ClustalW provide a major increase in the accuracy and speed with which users could build MSA. ClustalX provides a graphical user interface to the ClustalW MSA algorithm (Larkin et al., 2007).

2.3 Phylogenetic Tree based on above MSA TreeView was used to display phylogenies according to our MSA results. The program reads most NEXUS, PHYLIP, Hennig86, Clustal, or other format tree style (http://tax onomy.zoology.gla.ac.uk/rod/treeview.html).

2.4 Designing of siRNA Finally, Jemboss software (http://emboss.sourceforge.net/Jemboss/) was used for designing siRNA against conserved sequences of each gene. Jemboss, i.e., JAVA emboss, is offline software for designing of siRNA. It is based on Tuschl rule (Elbashir et al., 2001). All the parameters were taken into account while designing siRNA against target sequence, e.g., thermodynamics, etc., as laid by the software based on the work of Tuschl, Elbashir rule (Chellapan et al., 2005).

2.5 Following parameters (algorithm) were considered while designing siRNA duplexes (Tom Tuschl’s rule) •

broadly targeted region from a given mRNA sequence beginning 50–100 nt downstream of start codon were selected

•

first for 23-nt sequence motif AA(N19)TT were searched

•

after it, 23-nt sequence motif NA(N21) were searched and the 3’ end of the sense siRNA was converted to TT

•

finally, search was made for NAR(N17)YNN, where R = {A, G} and Y = {C, T}

•

target sequence considered were having a GC content of around 50%

2.6 Analysing putative siRNAs by BLAST A cross-homology search using NCBI, blastn (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was also made on the selected 21–25 nt sequence to screen them (if at all, by chance the selected siRNA bears homology to any plant gene) to avoid gene silencing of any plant gene, i.e., off-target cleavage.

8

3

S. Saxena et al.

Results

3.1 Retrieval of sequence Viral sequences of RNA silencing suppressor gene, i.e., AC2, AC4 and AV2, from four different geminivirus isolates infecting papaya were retrieved as detailed in Table 1 using the NCBI and Geminidetective database as given in methods.

3.2 Multiple Sequence Alignment MSA using ClustalX software to see conserved regions in AC2, AC4 and AV2 gene sequences of the above-mentioned different geminiviruses infecting papaya was done (result not shown). On the basis of MSA result, phylogenetic tree of these genes was created to assess evolutionary conservedness as depicted as Figures 1–3, respectively. Figure 1

Phylip phylogenetic tree build on Multiple Sequence Alignment of AC2 using ClustalX (1.81)

Figure 2

Phylip phylogenetic tree build on Multiple Sequence Alignment of AC4 using ClustalX (1.81)

Figure 3

Phylip phylogenetic tree build on Multiple Sequence Alignment of AV2 using ClustalX (1.81)

Designing of putative siRNA against geminiviral suppressors

9

The above-mentioned analysis resulted in the identification of sequences having most conserved regions present in each gene, i.e., AC2, AC4 and AV2, among different isolates taken into study. Then, each isolate was critically analysed for having most conserved region and the best isolate representing the respective gene was subjected to designing of siRNA. Table 2 shows best representing geminivirus isolate infecting papaya, thus selected on the basis of having most conserved regions for AC2, AC4, AV2 genes among different isolates, which were further subjected to siRNA designing for each gene. Table 2

Most conserved isolate of AC2, AC4 and AV2 genes

Genesa

Selected isolates with gi numberb

Start and end positionc

AC2 gene

gi|22726208

1626 – 1222

AC4 gene

gi|116282578

2440 – 2264

AV2 gene

gi|22726208

150 – 506

a

Most conserved genes for geminivirus are selected from phylogenetic analysis. Sequence details with gi number from NCBI, with respective conserved genes. c Start and end position of genes. b

3.3 Designing siRNA A number of siRNAs were identified against these genes of selected genome sequence as mentioned in Table 2, using Jemboss package, out of which most appropriate with respect to fulfilling various parameters were selected as putative siRNA. The various parameters including thermodynamics and GC content between 45 and 55% for designing of siRNA were used, as laid down by software Jemboss following Tuschl rule as given in methods. The resultant ds siRNAs (sense and antisense), their target region in genes and GC% are mentioned in Table 3. Table 3

Designing of siRNAs on the basis of conserved sequences

Name of genes

GC (%) Target site and their sequence

AC2

50

siRNA

302 Sense (5’–3’) AACTACAACCTGAGGAAAGCGTT CUACAACCUGAGGAAAGCGdTdT Antisense (5’–3’) CGCUUUCCUCAGGUUGUAGdTdT

50

79 Sense (5’–3’) AACAGACGTCGTCGTGTTGATCT CAGACGUCGUCGUGUUGAUdTdT Antisense (5’–3’) AUCAACACGACGACGUCUGdTdT

AC4

45

126 Sense (5’–3’) AAGTCCAGCTCAGATGTCAAAAT GUCCAGCUCAGAUGUCAAAdTdT Antisense (5’–3’) UUUGACAUCUGAGCUGGACdTdT

10

S. Saxena et al.

Table 3 Name of genes

Designing of siRNAs on the basis of conserved sequences (continued) GC (%) Target site and their sequence 45

siRNA

37 Sense (5’–3’) AAGGGAAATTCCAGTGCAAGAAT GGGAAAUUCCAGUGCAAGAdTdT Antisense (5’–3’) UCUUGCACUGGAAUUUCCCdTdT

AV2

45

167 Sense (5’–3’) AAGCGACCAGCAGATATATTCAT GCGACCAGCAGAUAUAUUCdTdT Antisense (5’–3’) GAAUAUAUCUGCUGGUCGCdTdT

50

313 Sense (5’–3’) AAAGCCCAGGATGTACAGGATGT AGCCCAGGAUGUACAGGAUdTdT Antisense (5’–3’) AUCCUGUACAUCCUGGGCUdTdT

3.4 Analysing putative siRNAs by BLAST A cross-homology search using NCBI, BLAST was also made on the above-selected sequences to avoid silencing of any host plant gene (if at all, by chance the selected siRNA bears any homology to any plant gene including papaya), i.e., off-target cleavage. The results showed a similarity of 95–100% to various geminiviruses but not to any gene of the plant genome, thus assuring the silencing of only geminiviral genes. It is very important to compare the potential target sites to appropriate genome database (human, Arabidopsis, etc.) using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and eliminate any sequence showing more than 16–17 bp contiguous base pairs of homology to other coding sequence.

4

Discussion

PTGS in plants is a natural defence mechanism against virus infection. It is known that this silencing machinery can be suppressed by three geminiviral genes namely AV2 (suppressor of RNA silencing), AC2 (transactivator of viral transcription and a suppressor of RNA silencing) and AC4 (suppressor of host defence mechanism) (Chowda-Reddy et al., 2008; Trinks et al., 2005; Vanitharani et al., 2004). So it was speculated that designing siRNA against these suppressor genes may not only target geminiviruses infecting papaya but also help plant to maintain its PTGS function as we are specifically targeting suppressors of plant silencing machinery. It is reported that papaya crop is infected by papaya leaf curl virus, and also few isolates of other geminiviruses (Pandey and Mukherjee, 2006; Saxena and Hallan, 2002; Singh et al., 2006). Here, we are emphasising on a strategy to make papaya crop resistant to leaf curl disease, so four isolates of geminivirus infecting papaya namely chilli leaf curl virus (papaya isolate), tomato leaf curl virus (papaya isolate), papaya leaf curl virus and papaya leaf curl virus (tomato isolate) were selected for this study as these were the only isolates with full length sequence available in database for analysis and also are reported to infect papaya. Since siRNA is highly homology dependent strategy, to design

Designing of putative siRNA against geminiviral suppressors

11

the siRNA against these three genes, it was decided to first find out the most conserved and best representing sequence among all the four geminivirus isolates infecting papaya taken into study with respect to these three genes. This makes sure that siRNA thus designed may work against more or less all the geminivirus isolates infecting papaya in field. Although lesser conserved regions of the three viral genes were also putative candidates as potential siRNA but owing to their limited target, i.e., homology against one or two isolates only, we decided not to consider them as we were looking for generic or broad resistance against geminiviruses infecting papaya. Indeed, we could find some conserved regions in all the three genes, and the isolate best representing the gene sequences as far as conservedness was concerned was chosen to further subjecting for siRNA designing. To have a substantial guarantee of the success of these siRNA, from a large pool of putative siRNA only those siRNA were picked up, which fulfilled various stringent criteria as mentioned in methods apart from being chosen from the most conserved and best representing sequence only. Also only those siRNA from conserved region were selected, which did not show any homology to plant genes by BLAST search. This is important as we wish to avoid cross silencing of the plant gene especially papaya while attempting silencing of viral genes. Because of the pathogenicity and ability to suppress RNA silencing machinery, siRNA thus designed targeting and degrading these suppressor genes namely AV2, AC2 and AC4 may make papaya plant resistance against geminiviruses infecting them.

Acknowledgements The authors are thankful to Babasaheb Bhimrao Ambedkar University, Lucknow India, and Department of Biotechnology, Govt. of India, for providing infrastructural facility and financial support, respectively.

References Chellapan, P., Vanitharani, R., Ogebe, F. and Fauquet, C.M. (2005) ‘Effect of temperature on geminivirus induced RNA silencing in plant’, Plant Physiology, Vol. 138, pp.1828–1841. Chowda-Reddy, R.V., Achenjang, F., Felton, C., Etarock, M.T., Anangfac, M.T., Nugent, P. and Fondong, V.N. (2008) ‘Role of a geminivirus AV2 protein putative protein kinase C motif on subcellular localization and pathogenicity’, Virus Res., Vol. 135, pp.115–124. Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T. (2001) ‘Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells’, Nature, Vol. 411, pp.494–498. Gupta, S.K., Akhoon, B.A., Srivastava, M. and Gupta, S.K. (2010) ‘A novel algorithm to design an efficient siRNA by combining the pre proposed rules of siRNA designing’, Journal of Computer Science & Systems Biology, Vol. 3, No.1, pp.005–009. Hanley-Bowdoin, L., Settlage, S.B., Orozco, M.B., Nagar, S. and Robertson, D. (1999) ‘Geminiviruses: models for plant DNA replication, transcription and cell cycle regulation’, Plant Sci., Vol. 18, pp.71–106. Krishna, K.L., Paridhavi, M. and Patel, J.A. (2008) ‘Review on nutritional, medicinal and pharmacological properties of papaya (Carica papaya Linn.)’, Natural Product Radiance, Vol. 7, pp.364–373.

12

S. Saxena et al.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. and Higgins, D.G. (2007) ‘ClustalW and ClustalX version 2.0’, Bioinformatics, Vol. 23, pp.2947–2948. Markham, P.G., Bedford, I.D., Liu, S. and Pinner, M.S. (1994) ‘The transmission of geminiviruses by Bemisia tabaci’, Pesticide Science, Vol. 42, No. 2, pp.123–128. Matzke, M.A. and Birchler, J.A. (2005) ‘RNAi-mediated pathways in the nucleus’, Nature Reviews Genetics, Vol. 6, pp.24–35. Pandey, P. and Mukherjee, S.K. (2006) Nucleotide Sequence of Tomato Leaf Curl Virus DNA A Isolate ToLCND-PRM, NCBI Database; Plant Molecular Biology ICGEB, Aruna Asaf Ali Marg, New Delhi, Delhi 110067, India, Accession No. DQ629103. Pooggin, M.M. and Hohn, T. (2004) ‘Fighting geminiviruses by RNAi and vice versa’, Plant Molecular Biology, Springer, Netherlands, Vol. 55, pp.149–152. Saxena, S. and Hallan,V. (2002) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA, Accession No. NC_004147. Saxena, S., Hallan, V., Singh, B.P. and Sane, P.V. (1998) ‘Leaf curl disease of carica papaya from India may be caused by a bipartite geminivirus’, Plant Dis., Vol. 82, p.126. Singh, P., Mazumdar-Leighton, S. and Mukherjee, S.K. (2006) Papaya, Leaf Curl New Delhi Virus Isolate Genome Sequence, NCBI Database; Plant Molecular Biology ICGEB, Aruna Asaf Ali Marg, New Delhi, Delhi 110067, India, Accession No. DQ989325 and DQ989326. Stanley, J. (1983) ‘Infectivity of the cloned geminivirus genome requires sequences from both DNAs’, Nature, Vol. 305, pp.643–645. Stanley, J. and Gay, R.M. (1983) ‘Nucleotide sequence of cassava latent virus DNA’, Nature, Vol. 301, pp.260–262. Thomas, K.M. and Krishnaswamy, C.S. (1939) ‘First report of papaya leaf curl virus infecting papaya plants’, Curr. Sci., Vol. 8, p.316. Trinks, D., Rajeswaran, R., Shivaprasad, P.V., Akbergenov, R., Oakeley, E.J., Veluthambi, K., Hohn, T. and Pooggin, M.M. (2005) ‘Suppression of RNA silencing by a geminivirus nuclear protein, AC2, correlates with transactivation of host genes’, Journal of Virology, Vol. 79, No. 4, pp.2517–2527. Vanitharani, R., Chellappan, P., Pita, J.S. and Fauquet, C.M. (2004) ‘Differential roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and suppression of posttranscriptional gene silencing’, Journal of Virology, Vol. 78, pp.9487–9498.

Websites MENSHEALTH, The Magazine of India Today Group, Obtained through the internet: http://www.menshealth.intoday.in [accessed date 15/11/2010] NISARGAFOOD, Nisarga Enterprises, Obtained through the internet: http://www. nisargafood.com/papaya.html [accessed date 15/11/2010]. PLANT SCIENCE, Department of Plant Science, University of Cambridge, Obtained through the internet: www.plantsci.cam.ac.uk/research/baulcombe/rna-research WIKIPEDIA, The Free Encyclopedia, Obtained through the internet: http://en.wikipedia.org/ wiki/Small_interfering_RNA [accessed date 15/11/2010].