Diabetic ketosis activates lymphomonocyte-inducible nitric oxide synthase

DME_787.fm Page 777 Friday, August 23, 2002 9:56 PM

Diabetic ketosis activates lymphomonocyte-inducible nitric oxide synthase Nitric Original oxide article and diabetic ketosis E. Iori et al. Oxford, Diabetic DME Blackwell 0742-3071 19 UK Article Medicine Science, Science Ltd, Ltd 2002

E. Iori, L. Calò, D. Valbusa, G. Ceolotto, M. Milani, V. Pengo, S. V. de Kreutzenberg, A. Tiengo and A. Avogaro

Abstract Department of Clinical and Experimental Medicine, University of Padova, Padova, Italy Accepted 16 March 2002

Aims Inappropriate production of nitric oxide (NO) may be responsible for the haemodynamic disturbances of diabetic ketoacidosis. We investigated whether this metabolic condition is associated with increased plasma nitrate (the stable oxidation product of NO) levels and NO synthase gene expression in lymphomonocytes. Research design and methods Plasma nitrate concentrations, lymphomonocyteinducible nitric oxide synthase (iNOS) gene expression, tumour necrosis factor-alpha (TNF-α) and soluble thrombomodulin were measured in 11 Type 1 diabetic patients at baseline, during mild ketosis and after euglycaemia was re-established. Results During diabetic ketosis plasma nitrate concentrations were higher (18 (16 –21) vs. 9 (7–11) µmol /l; (95% lower-upper confidence interval) P < 0.05) than at baseline. At baseline lymphomonocyte iNOS mRNA expression and iNOS protein levels were undetectable, but in ketosis both were increased (both at P < 0.0001). After recovery from ketosis, NO3 concentration, iNOS mRNA, and iNOS expression (270 ± 36%, mean ± SD) decreased but not significantly. No significant changes were observed in either TNF-α or soluble thrombomodulin levels between the three conditions. Conclusions Diabetic ketosis is associated with increased nitrate levels and the activation of iNOS expression in circulating lymphomonocytes, but it does not affect either the proinflammatory cytokine TNF-α or a marker of endothelial dysfunction such as thrombomodulin. Our data support the hypothesis that, during diabetic ketosis, alterations in NO homeostasis are present in circulating lymphomonocytes.

Diabet. Med. 19, 777 –783 (2002) Keywords nitric oxide, iNOS, Type 1 diabetes, ketoacidosis, lymphomonocyte, vasodilatation, insulin

Introduction Insulin deficiency and excessive secretion of counterregulatory hormones lead to increased blood concentrations of glucose and ketone bodies (KB) in Type 1 diabetic patients [1–3]. Acute impairment of metabolic control is associated with marked vasodilatation [4] and probably reflects widespread vascular

Correspondence to: Angelo Avogaro MD, Department of Clinical and Experimental Medicine, University of Padova, School of Medicine, Via Giustiniani 2, 35128 Padova, Italy. E-mail: [email protected]

© 2002 Diabetes UK. Diabetic Medicine, 19, 777 –783

damage due to endothelial dysfunction [5]. Nitric oxide (NO), a potent modulator of vascular response, may be responsible for the inappropriate vasodilatation and hyperaemia in these conditions [6]. In terms of overproduction of NO, it is the inducible nitric oxide synthase (iNOS) that has received most attention. This isoform can be expressed in macrophages, vascular smooth muscle cells, as well as in endothelial cells upon cytokine induction [7]. Expression of iNOS is thought to be beneficial in some conditions but it may be detrimental in others [8]. In most cases acidosis occurs along with NO generation. Recent

777

DME_787.fm Page 778 Friday, August 23, 2002 9:56 PM

778

Nitric oxide and diabetic ketosis • E. Iori et al.

Table 1 Clinical characteristics of the study subjects Type 1 diabetic patients Body mass index (kg/m2) Serum cholesterol (mmol/l) Serum triglycerides (mmol /l) Daily albumin excretion (mg/day) HbA1c (%)

21.8 (20.4–23.5) 4.8 (4.4–5.4) 1.1 (0.9–1.5) 8 (6–15) 8.1 (7.1–9.5)

Data are expressed as geometric mean (lower 95% CI–upper 95% CI).

analyses have shown that the exposure of macrophages to acidic microenvironments leads to up-regulation of iNOS activity through the activation of nuclear factor κB [9]. The aim of the present study was to investigate whether there is elevated production of nitrates in diabetic ketosis, an index of in vivo NO production, and if circulating lymphomonocytes might be the source of NO.

Research design and methods Subjects

Eleven Type 1 diabetic patients (five males) (Table 1), with no long-term micro- or macrovascular complications with a mean ± SD age of 32 ± 9 years and a duration of the disease of 13 ± 5 years, were recruited from the Diabetic Clinic of the Padova University Hospital. All were C-peptide-negative and had had at least one episode of diabetic ketoacidosis in the past. Their mean daily insulin dose was 35 ± 6 U. All 11 participants underwent a full medical history and physical examination. None showed evidence of ongoing infections, hepatic, renal or myocardial dysfunction or other endocrine diseases. In particular, all had normal ankle-brachial pressure index, and no atherosclerotic involvement of the carotid vessels, as assessed by echo-Doppler. Diabetic retinopathy was excluded by retinal photography. A creatinine clearance of 106 ± 16 ml /min (mean ± SD) confirmed normal renal function in all patients. None had a urinary albumin excretion > 20 µg /min in two consecutive measurements. Autonomic neuropathy was excluded by standard tests. To rule out pre-existing factors known to affect endothelial function, only subjects with no history of hypertension (sitting blood pressure < 140/85 mmHg on three occasions) or hyperlipidaemia (total cholesterol < 6 mmol/ l and with triglycerides < 2.2 mmol/l) were recruited. All patients were instructed to follow an isocaloric diet with three daily meals (50% of carbohydrate, 35% fat, and 15% protein) for at least 30 days before the study. Foods with a high nitrate content were prohibited for at least 24 h prior to the study. Informed, written consent was obtained from each patient after the purpose, nature, and potential risks of the study were explained. The protocol was approved by the Ethical Committee of the School of Medicine, University of Padova. The patients were scheduled in random order for the two appointments necessary to carry out the tests. At the first appointment the patient was admitted to the Metabolic Unit at 8.00 a.m., in fasting state, at his/ her spontaneous morning plasma glucose level.

Arterialized blood samples were obtained for hormone, substrate, tumour necrosis factor-alpha (TNF- α), nitrate, soluble thrombomodulin assays, and for the determination of iNOS expression in circulating lymphomonocytes. At the second appointment, scheduled 7 days later, the patient was admitted to the Metabolic Unit at 6.00 p.m. Before supper, two-thirds of their usual dose of soluble insulin and no intermediate or long-acting insulin were given. This was done to induce mild ketosis by the following morning [2,10]. No patient reported hypoglycaemic episodes the day before. Arterialized blood samples were obtained at 8:00 a.m. the following morning, for hormone, substrate, TNF-α, nitrate, soluble thrombomodulin assays, and for the determination of iNOS expression in circulating lymphomonocytes in the ketotic condition. After blood was taken, euglycaemia was re-established with a continuous insulin infusion at a rate of 1 mU/ kg per min. Once normoglycaemia was restored, 5.2 ± 0.3 h later, blood samples were repeated.

Biochemical assays

Plasma glucose was measured with a glucose oxidase method on a Beckman Glucose analyser (Glucose II analyser; Beckman, Brea, CA, USA), and HbA 1c by a chromatographic technique (normal range 4 – 6.5%). Insulin and C-peptide were assayed using conventional monoclonal radioimmunoassay (RIA) [11]. Plasma glucagon was measured by double antibody RIA [12]. FFA concentration was determined using a micro enzymatic technique [13]. 3-hydroxybutyrate and acetoacetate (AcAc) were measured by a fluorimetric technique [14]: interand intra-assay coefficient of variation was 10 ± 4% and 5 ± 3%, respectively. TNF-α and soluble thrombomodulin were determined by ELISA [15,16]: their inter- and intra-assay coefficients of variation were 8 ± 2% and 6 ± 3%, respectively. Blood pH and PCO2 were determined using an automatic method (Instrumentation Labs, Warrington, UK) 413 blood gas analyser (Instrumentation Labs).

Nitrate determination

Nitrates were assayed by isotopic dilution using 15N-labelled nitrates as the internal standard according to the method of Green et al. [17]. The determination of nitrates in plasma was carried out as follows. 15N-nitrate (100 µM) was added to 500 µl of plasma: mixture was added to 1 ml of benzene and 1 ml of H2SO4. Samples were gently vortexed for 15 min. These were centrifuged and the organic phase transferred and filtered through Silica Sep-Pack Cartridges (Water Corporation S.p.A. Milford, MA, USA). The eluates were then dried under nitrogen stream until a final amount of 100 µl was obtained. This allowed the analysis of 15N- to 14N-nitrobenzene. The residue was injected onto a gas chromatograph isotope ratio mass-spectrometry (IRMS) (Delta Plus Thermo Finnigan, Rodano, Milan, Italy). The gas chromatographic separation was on a Hewlett Packard 5MS capillary column (length 30 m, internal diameter 0.25 mm) using a carrier flow of helium of 25 ml/min and an oven temperature program from 60° to 120° at 16°/min. Retention time was 4.8 min. 15N- to 14N-nitrobenzene were eluted and converted to nitrogen gas by combustion at 1000 °C and analysed by

© 2002 Diabetes UK. Diabetic Medicine, 19, 777– 783

DME_787.fm Page 779 Friday, August 23, 2002 9:56 PM

Original article

continuous-flow gas IRMS. The precision of the 15N/14N ratio measurement was ± 0.0003%. A calibration curve was prepared by spiking plasma containing a known amount of 14N nitrates with various amounts of 15N nitrate. Nitrate concentration in the samples was calculated from the respective ion ratio as previously outlined [18]: the inter- and intra-assay coefficients of variation were 4 ± 2% and 2 ± 2%.

iNOS expression in human lymphomonocytes Isolation of lymphomonocytes

Heparinized whole blood was stratified onto Histopaque-1077 (Sigma-Aldrich Co. Ltd., Irvine, UK). The sample was centrifuged at 400 g for 30 min at room temperature. The opaque interface, containing mononuclear cells, was transferred after centrifugation to a clean conical centrifuge tube. PBS (10 ml) was added and the sample centrifuged at 400 g for 20 min at room temperature. The supernatant was discarded and the pellet (lymphomonocytes fraction) used for iNOS expression. iNOS RNA extraction by RT-PCR

Total cellular RNA from human lymphomonocytes was extracted using the guanidium thiocyanate-phenol-chloroform method with TRI Reagent (Molecular Research Center Inc, Cincinnati, OH, USA). PCR amplification of the cDNA was carried out essentially as described by the manufacturer (Perkin Elmer Gene Arnp RNA PCR Kit; Perkin Elmer, Foster City CA, USA). Amplification was executed in an automatic DNA thermal Cycler (Perkin Elmer 2400 thermocycler) using oligonucleotide primers, specific to iNOS obtained using the software ‘Primer3’ (Whitehead Institute for Medical Research, MIT, Boston, MA, USA) 5–3′: TGTGCTCTTTGCCTGTATGCTGAT and CTGAATGTGCTGTTTGCCTCGGAC. β-actin was used as a control and amplified using commercially available primers: 5–3′: ATCTGGCACCACACCTTCTACAATGAGCTGCG and CGTCATACTCCTGCTTGCTGATCCACATCTGC (Clontech, San Diego, CA, USA) [19]. The reaction mixture contained 20 µl

779

cDNA and 0.4 µM for iNOS sense and antisense primer, 2.5 U Taq DNA polymerase (Perkin Elmer) in a final volume of 100 µl. The conditions of amplification were: denature at 94 °C for 1 min, anneal at 59°C for 1 min and extended at 72°C for 1 min, for a total of 35 cycles of amplification. PCR products (iNOS product size 517 bp) were separated by electrophoresis on 1.4% agarose gel (NuSieve 3:1 agarose, FMC) and stained with ethidium bromide and by electrophoresis on 7% polyacrylamide gel and stained by silver staining. Molecular weight marker IX (ΦX174 Hae III; Boehringer Mannheim, Mannheim, Germany) was included on the gels. The PCR products were also sequenced to identify the amplified products using sequencing facilities at Primm s.r.l. (San Raffaele Biomedical Science Park, Milano, Italy). Automated sequencing was performed using PRISM Taq Polymerase Dye Terminator fluorescent sequencing kit (Perkin Elmer) and analysed using an ABI 373 automated sequencer and ABI Prism analysis software. iNOS detection by Western blot analysis

Lymphomonocytes were lysed by the addition of an icecold extraction buffer containing 20 mM HEPES pH 7.5, 2 mM EGTA, 1 mM dithiothreitol, 1 mM PMFS, 40 mM βglycerophosphate, 2.5 mM MgCl2, 2 mM sodium orthovanadate, 20 µg / ml aprotinin and 20 µg/ ml leupeptin. The suspension was sonicated for 20 s × 3 and centrifuged at 35 000 g for 60 min at 4°C (Beckman centrifuge TI 50). The supernatant, containing cytosolic fraction, was concentrated by Centricon Centrifugal Filter Devices (Amicon Millipore) and the pellet (membrane fraction) was raised with 200 µl of lysis buffer and 1% Triton X (Sigma-Aldrich). Protein content was measured using the Lowry method. Cytosolic and membrane protein extracts (100 µg) were separated by 8% SDS–PAGE and transferred to nitrocellulose filter (Hybond ECL; Amersham Pharmacia Biotech, Arlington Heights, IL, USA). The membrane was blocked with 5% powdered milk in PBS containing 0.1% Tween 20 (PBS–T) for 3 h at room temperature and incubated overnight at 4 °C with rabbit polyclonal anti-iNOS (Santa Cruz Biotechnology, Santa Cruz,

Table 2 Plasma forearm-drained venous biochemistry values

Blood pH Plasma osmolality (mOsmol/kg) Plasma glucose (mmol /l) Plasma insulin (pmol/l) Plasma glucagon (pg /l) Blood 3-BOH (µmol /l) Blood AcAc (µmol/l) Plasma FFA (µmol/l) Tumor necrosis factor-alpha (pg /ml) Soluble thrombomodulin (ng/ml)

Baseline

Ketosis

Euglycaemia

7.42 (7.40–7.43) 286 (282–290) 13.4 (12.3–14.7) 97 (81–123) 71 (63–80) 65 (24–312) 92 (71–157) 522 (321–1177) 2.08 (1.81–2.47) 40 (35–47)

7.30 (7.28–7.33)** 299 (295–304)** 24.5 (23.4 –25.8)** 32 (24–47)* 79 (61–109) 1957 (1600–2519)** 595 (360–1276)** 1141 (834–1686)* 2.40 (1.93–3.31) 41 (30–62)

7.42 (7.41–7.43) 287 (283–290)† 6.6 (6.2–7.1)††‡ 478 (381–652)†‡ 63 (54–76) 91 (47–359)†† 91 (74–132)†† 234 (90–1016)†‡ 2.68 (1.99 –4.37) 40 (33–54)

Data are expressed as geometric mean (lower 95% CI–upper 95% CI). †P < 0.05 vs. ketosis vs. euglycaemia. ††P < 0.01 vs. ketosis vs. euglycaemia. *P < 0.05 vs. baseline vs. ketosis. **P < 0.01 vs. baseline vs. ketosis. ‡P < 0.05 baseline vs. euglycaemia. Values of insulin, 3-BOH, AcAc, and FFA were log transformed before being entered into repeated measures ANOVA.

© 2002 Diabetes UK. Diabetic Medicine, 19, 777 –783

DME_787.fm Page 780 Friday, August 23, 2002 9:56 PM

780

Nitric oxide and diabetic ketosis • E. Iori et al.

Figure 1 Box and whiskers plots of plasma nitrate concentrations from 11 Type 1 diabetic patients at baseline, during ketosis and after euglycaemia was reestablished with saline and insulin 1 mU/kg per min infusion. The horizontal line in the middle shows the median of the sample, the top and the bottom of the box the 75th and 25th percentiles, respectively.

CA, USA) diluted 1:200 in PBS–T containing 0.5% powdered milk. The nitrocellulose membrane was washed four times for 5 min each with PBS–T and incubated with a 1:2500 dilution of horseradish peroxidase-conjugated anti-rabbit antibody (Amersham Int.). After washing with PBS–T the membrane was treated with enhanced chemiluminescent reagent (ECL Western blotting analysis system; Amersham Int.) according to the manufacturer and immunoreactive bands were visualized by autoradiography. The expression of iNOS protein was quantified by densitometric scanning (BioRad Laboratories, Hercules, CA, USA). Intra- and interassay variabilities of iNOS protein were 4.1% and 7.6%, respectively. These results were obtained using a standard of iNOS protein recombinant (Calbiochem-Biochemicals, LA Jolla, CA, USA) tested by Western Blot analysis in triplicate in three different experiments for intra-assay variability and in ten different experiments for interassay variability. Statistical analysis

Statistical comparisons within the groups were performed using a one-way repeated measure analysis of variance. The Tukey test was chosen as the post test to compare all pairs of columns. Multivariate regression analysis, weighted for metabolic setting, between plasma nitrates and blood ketone bodies, TNF-α, and insulin circulating concentrations was performed to assess whether correlations existed between NO production and these parameters. All values are reported as geometric mean (95% lower CI − 95% upper CI). P < 0.05 was considered statistically significant for two-tailed analysis.

Results Hormonal and metabolic parameters

After overnight partial insulin withdrawal, Type 1 diabetic patients were moderately ketotic and acidotic (Table 2). No

Figure 2 Correlations between nitrate concentrations and plasma insulin (a), plasma tumour necrosis factor-alpha (TNF-α) (b) and blood total ketone bodies (c). , baseline condition; , ketosis; , euglycaemia.

differences were observed in plasma glucagon levels, TNF-α or soluble thrombomodulin concentrations. Nitrate concentration

During ketosis, plasma nitrate concentrations (Fig. 1) were significantly higher than in baseline conditions (18 (16–21), geometric mean (lower 95% CI–upper 95% CI) vs. 7 (5– 11) µmol/l; P < 0.05). Once metabolic control was restored, there was a slight but not significant decrease in nitrate concentrations. As shown in Fig. 2, the regression analysis,

© 2002 Diabetes UK. Diabetic Medicine, 19, 777– 783

DME_787.fm Page 781 Friday, August 23, 2002 9:56 PM

Original article

781

Figure 3 Effect of ketosis and euglycaemia on iNOS mRNA expression followed by RNA isolation and RT-PCR analysis of iNOS mRNA expression in circulating lymphomonocytes. βactin mRNA expression was also measured in the same samples. Data are mean ± SD of 11 Type 1 diabetics. *Significance vs. baseline both at P < 0.001.

Figure 4 Top. Representative Western blot analysis of iNOS protein expression in the cytosolic fraction of circulating lymphomonocytes from one Type 1 diabetic patient in baseline condition, during ketosis and after metabolic control was re-established. Bottom. Mean ± SD of lymphomonocyte iNOS relative densitometric changes from baseline.

between plasma nitrates and blood ketone bodies, TNF-α, and insulin circulating concentrations showed a significant relationship between plasma nitrate and total ketone bodies concentration (β coefficient 0.793, P < 0.0001), a weak relationship with TNF-α (β coefficient 1.738, P = 0.093) and no relationship between insulin (β coefficient 1.738, P = 0.555) concentrations. INOS mRNA and protein expression

As shown in Fig. 3, mRNA and protein for iNOS were barely detectable in circulating lymphomonocytes at baseline. However, during ketosis there was a substantial increase in both mRNA and protein for this enzyme. The optical pixel density for the iNOS mRNA was 0.38 (0.30 – 0.61) d.u. during ketosis and decreased (NS) in euglycaemia 0.23 (0.17– 0.41) (NS vs. ketosis).

© 2002 Diabetes UK. Diabetic Medicine, 19, 777 –783

Similarly, iNOS protein expression determined by Western Blot in circulating lymphomonocytes was activated during ketosis (Fig. 4), but not significantly reversed by insulininduced euglycaemia (−16 ± 12%, NS vs. ketosis).

Discussion This study shows that: (i) there is a substantial increase in plasma nitrate concentration in diabetic patients during ketosis; (ii) iNOS expression in circulating lymphomonocytes is significantly stimulated; (iii) acute restoration of metabolic control only partially reverses these abnormalities. This experimental model differs from clinical ketoacidosis in the relatively limited rises in glucagon and catecholamine levels as observed in our previous studies [2,10]. Thus caution must be adopted in extrapolating the present findings into a clinical setting. Hyperperfusion, which is frequently detected

DME_787.fm Page 782 Friday, August 23, 2002 9:56 PM

782

Nitric oxide and diabetic ketosis • E. Iori et al.

during the loss of metabolic control, is determined by precapillary vasodilatation, a lack of compensatory decrease in the post-capillary resistance, and an increase in capillary pressure [20,21]. Inappropriate prostaglandin [22] and NO production are thought to mediate these vascular abnormalities. This was recently confirmed by our group [10] and by Benjamin et al., who observed a higher NO production even in well-controlled diabetic patients [23]. In the present study nitrate levels as determined by a spectrometric assay were increased when ketones developed. The hypothesis that lymphomonocytes are one site of active NO release stems from a recent report that immunocompetent cells can produce large amounts of NO in an acidotic setting [9]. The present study shows that the acute loss of metabolic control is associated with an increased gene and protein expression of iNOS in lymphomonocytes. The finding of a significant increase in iNOS expression in circulating lymphomonocytes makes the diabetic ketotic state resemble other clinical conditions, such as sepsis, which are associated with inappropriate NO production determined by an overactivity of iNOS isoform [24]. It appears from our data that the enhanced expression of iNOS in lymphomonocytes takes place without any significant variation in circulating TNF-α or soluble thrombomodulin levels, although the former increases by 25% during ketosis: thus a role of proinflammatory cytokines in the pathogenesis of iNOS expression cannot be excluded. However, it is possible that other circulating biomarkers of endothelial dysfunction, such as von Willebrand factor or soluble cellular adhesion molecules, might be increased as well. The restoration of metabolic control only partially reversed these abnormalities, suggesting that, despite euglycaemia, more time is necessary to normalize NO production. Alternatively, the persistently higher NO levels could be ascribed to the insulin infusion necessary to normalize the metabolic situation as shown by Baron and colleagues [25]. The pathophysiological mechanisms underlying increased NO production during diabetic ketosis have not been explored in this study: beside a low blood pH, increased concentrations of ketone bodies may trigger inappropriate NO production, as shown in endothelial cells from bovine aorta [26]. The correlation between the concentration of ketone bodies and plasma nitrates supports the hypothesis that these substances may be implicated in increasing NO production and may be the mechanism underlying the increase in iNOS expression and protein seen in lymphomonocytes. It is interesting that, as hypothesized by Zdzisinska et al., enhancement of NO synthesis in the presence of elevated ketone body concentrations can be considered a mechanism causing a predisposition to microbial infections [26]. Clearly inactivation of NO takes place in the erythrocytes and is brought about by the incorporation of molecular oxygen from HbO2 [27]. Therefore NO production from lymphomonocytes may not have haemodynamic effects but may modulate their function to teleologically endow these cells against microorganisms [28] or to regulate their apoptosis [29]. However, it is indisputable that inappropriate NO production may take place also

from other cells: further studies are needed to clarify this issue. In conclusion, it has been shown that there is an increased content of iNOS expression in lymphomonocytes and an elevated nitrate concentration during diabetic ketosis. These abnormalities are only partially reversed by the acute normalization of metabolic control. These data support the hypothesis that alterations in NO homeostasis are present even in circulating lymphomonocytes during diabetic ketosis. Acknowledgements

The authors are indebted to Mrs Linda Inverso Moretti for assistant in editing this manuscript. This work has been supported by a Grant of Regione Veneto ‘Progetto invecchiamento nell’anziano’.

References 1 Miles JM, Gerich JE. Glucose and ketone body kinetics in diabetic ketoacidosis. Clin Endocrinol Metab 1983; 12: 303–319. 2 Avogaro A, Doria A, Gnudi L, Carraro A, Duner E, Brocco E et al. Forearm ketone body metabolism in normal and insulin-dependent diabetic patients. Am J Physiol 1992; 263: E261–267. 3 Avogaro A, Gnudi L, Valerio A, Maran A, Miola M, Opportuno A et al. Effects of different plasma glucose concentrations on lipolytic and ketogenic responsiveness to epinephrine in type I (insulin-dependent) diabetic subjects. J Clin Endocinol Metab 1993; 76: 845–850. 4 Kohner EM, Patel V, Rassam SM. Role of blood flow and impaired autoregulation in the pathogenesis of diabetic retinopathy. Diabetes 1995; 44: 603–607. 5 Tooke JE. Microvasculature in diabetes. Cardiovasc Res 1996; 32: 764–771. 6 Meier M, King G. Protein kinase C activation and its pharmacological inhibition in vascular disease. Vasc Med 2000; 5: 173–175. 7 Vallance P, Calver A, Collier J. The vascular endothelium in diabetes and hypertension. J Hypertens 1992; (Suppl. 10): S25–29. 8 Okamoto H, Ito O, Roman RJ, Hudetz AG. Role of the inducible nitric oxide synthase and cyclooxygenase-2 in endotoxin-induced cerebral hyperemia. Stroke 1998; 29: 1209–1218. 9 Bellocq A, Suberville S, Philippe C, Bertrand F, Perez J, Fouqueray B et al. Low environmental pH is responsible for the induction of nitric-oxide synthase in macrophages. Evidence for involvement of nuclear factor-kappaB activation. J Biol Chem 1998; 273: 5086–5092. 10 Avogaro A, Calò L, Piarulli F, Miola M, deKreutzenberg S, Maran A et al. Effect of acute ketosis on the endothelial function of type 1 diabetic patients. The role of nitric oxide. Diabetes 1999; 48: 391–397. 11 Kuzuya H, Blix PM, Horowitz DL, Steiner DF, Rubenstein AH. Determination of free and total insulin and C-peptide in insulin treated diabetics. Diabetes 1977; 26: 22–29. 12 Faloona GR, Hunger R. Glucagon, Methods of Hormone Radioimmunoassay. Jaffe BM, Behrman HR, eds. New York: Academic Press, 1974: 317–330. 13 Shimuzu S, Inque K, Tani Y, Yamada H. Enzymatic microdetermination of serum free fatty acids. Anal Biochem 1978; 98: 341–345. 14 Lloyd B, Burrin J, Smythe P, Alberti KGMM. Enzymatic fluorimetric continuous-low assays for blood glucose, lactate, pyruvate, alanine, glycerol and 3-hydroxybutyrate. Clin Chem 1978; 24: 1724–1729. 15 Lechleitner M, Koch T, Herold M, Dzien A, Hoppichler F. Tumor necrosis factor-alpha plasma level in patients with type 1 diabetes mellitus and its association with glycaemic control and cardiovascular risk factors. J Int Med 2000; 248: 67–76.

© 2002 Diabetes UK. Diabetic Medicine, 19, 777– 783

DME_787.fm Page 783 Friday, August 23, 2002 9:56 PM

Original article

16 Amiral J, Adam M, Mimilla F, Larrivaz I, Chambrette B, Boffa MC. Design and validation of a new immunoassay for soluble forms of thrombomodulin and studies on plasma. Hybridoma 1994; 13: 205–213. 17 Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem 1982; 126: 131–138. 18 Avogaro A, Bier DM. Contribution of 3-hydroxyisobutyrate to the measurement of 3-hydroxybutyrate in human plasma: comparison of enzymatic and gas-liquid chormatography-mass spectrography assays in normal and in diabetic subjects. J Lipid Res 1989; 30: 1811–1817. 19 Asano K, Chee CB, Gaston B, Lilly CM, Gerard C, Drazen JM et al. Constitutive and inducible nitric oxide synthase gene expression, regulation, and activity in human lung epithelial cells. Proc Natl Acad Sci USA 1994; 91: 10089–10093. 20 Kohner EM. The effect of diabetic control on diabetic retinopathy. Eye 1993; 7: 309–311. 21 Stehouwer CD, Schaper NC. The pathogenesis of vascular complications of diabetes mellitus: one voice or many? Eur J Clin Invest 1996; 26: 535–543. 22 Bassi A, Avogaro A, Crepaldi C, Pavan P, Zambon S, Martin R et al. Short term diabetic ketosis alters n-6 polyunsaturated fatty acid content in plama phospholipids. J Clin Endocrinol Metab 1996; 81: 1650–1653.

© 2002 Diabetes UK. Diabetic Medicine, 19, 777 –783

783

23 O’Byrne S, Forte P, Roberts LJ, Morrow JD, Johnston A, Anggard E et al. Nitric oxide synthesis and isoprostane production in subjects with type 1 diabetes and normal urinary albumin excretion. Diabetes 2000; 49: 857–862. 24 Kirkeboen KA, Strand OA. The role of nitric oxide in sepsis—an overview. Acta Anaesthesiol Scand 1999; 43: 275–288. 25 Baron AD. The coupling of glucose metabolism and perfusion in human skeletal muscle. The potential role of endothelium-derived nitric oxide. Diabetes 1996; 45 (Suppl. 1): S105–109. 26 Zdzisinska B, Filar J, Paduch R, Kaczor J, Lokaj I, Kandefer-Szerszen M. The influence of ketone bodies and glucose on interferon, tumor necrosis factor production and NO release in bovine aorta endothelial cells. Vet Immunol Immunopathol 2000; 74: 237–247. 27 Jungersten L, Edlund A, Petersson AS, Wennmalm A. Plasma nitrate as an index of nitric oxide formation in man: analyses of kinetics and confounding factors. Clin Physiol 1996; 16: 369–379. 28 MacMicking J, Xie QW, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol 1997; 15: 323–350. 29 Rouzaut A, Subira ML, de Miguel C, Domingo-de-Miguel E, Gonzalez A, Santiago E et al. Co-expression of inducible nitric oxide synthase and arginases in different human monocyte subsets. Apoptosis regulated by endogenous NO. Biochim Biophys Acta 1999; 1451: 319–333.