Expression of dopamine-associated genes on conjunctiva stromal-derived human mesenchymal stem cells
Descrição do Produto
Biochemical and Biophysical Research Communications 377 (2008) 423–428
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications j o u r n a l h o m e p a g e : w w w . e l s e v i e r. c o m / l o c a t e / y b b r c
Expression of dopamine-associated genes on conjunctiva stromal-derived human mesenchymal stem cells Samad Nadri a,b,c, Masoud Soleimani d,*, Zahra Mobarra e, Sepideh Amini a a
Stem Cells and Tissue Engineering Department, Stem Cell Technology Institute, Tehran, Iran Medical Physics and Biomedical Engineering Department, Faculty of Medic ine, Shahid Beheshti University of Medical Science, Tehran, Iran c Nanotechnology Department, Stem Cell Technology Institute, Tehran, Iran d Hematology Department, Faculty of Medical Science, Tarbiat Modares University, Tehran 14115-111, Iran e Molecular Biology Department, Stem Cell Technology Institute, Tehran, Iran b
a r t i c l e
i n f o
Article history: Received 23 September 2008 Available online 11 October 2008 Keywords: Conjunctiva mesenchymal stem cells Dopamine neuron Parkinson’s diseases
a b s t r a c t Parkinson’s disease (PD) is neurodegenerative diseases caused by the loss of dopaminergic neurons in the substantia nigra pars compacta. Stem cell therapy is one of the promising strategies in helping to cure PD. In the present study, human mesenchymal stem cells (MSCs) from eye conjunctiva stromal cells were differentiated into dopaminergic neurons. In this work, after conjunctiva biopsy, mesenchymal stem cells were obtained via adherence to the plastic culture dishes. Then, MSCs were treated with general neurogenic medium containing DMEM supple mented with RA, IBMX and dbcAMP for 6 days. RT-PCR, immunocytochemistry and flow cytometry were used for expression of dopaminergic genes such as TH. As a result, RT-PCR analysis revealed the expression of dopaminergic neuron genes such as TH, Ptx3, Nurr1. Furthermore, immunocytochemistry revealed that the differentiated CJMSCs not only express TH gene, but also express TH protein. Flow cytometry showed that TH, MAP-2 proteins increased signifi cantly as increasing passage number. In conclusion, the reported results indicate that CJMSCs might be a suitable and available source for cell transplantation therapy for the central system diseases such as PD. © 2008 Elsevier Inc. All rights reserved.
Parkinson’s disease (PD) is a common neurodegenerative disor der of the brain which has as a part of its core pathology the pro gressive degenerat ion of the dopaminergic nigrostriatal pathway. It affects all ethnic groups at a frequency of »1% of people >65 years of age. Although several treatments have been shown to modify the course of the disease, none have successfully halted the degenerat ion [1,2]. In recent years, stem cell replacement has emerged as the novel therap eutic strategy for Parkinson’s disease (PD). Stem cells are defined as a population of primitive cells with the capability of self-renewal and differentiation into multiple cell lin eages [3]. These cells have been isolated from a wide variety of tissue. There are many reports on the derivation of dopamine neurons from human embryonic stem cells [4–9]. However, ESCs can form terato mas and are likely to elicit immune rejection if used for transplanta tion. Neural stem cells (NSCs) maintain lineage specificity and have the ability to differentiate into any type of brain cell [10]. Although NSCs show therapeutic value for neural disorders, NSC-derived dopa mine neurons have some drawbacks with respect to efficiency and lineage polarization [11]. This by no means suggests that NSCs and ESCs will not transition from bench to bedside, but additional studies * Corresponding author. Fax: +98 21 88970478. E-mail addresses: soleim_m@modares.ac.ir (S. Masoud).soleimani_masoud@ yahoo.com (S. Masoud). 0006-291X/$ - see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.09.148
are warranted to identify other stem cells with the ability to generate dopamine neurons with high efficiency. The least characterized stem cells, with respect to their ability to generate dopamine neurons, are the mesenchymal stem cells. Of the adult stem cells, MSCs appear to have the best potential for regenerative medicine [12–17]. In fact, MSCs are currently in clinical trials for a number of disorders includ ing graft versus host disease, heart failure, multiple sclerosis [17] and Parkinsonism [18]. Mesenchymal stem cells from the conjunctival stroma of the human eye posses stem cells properties. We previously demon strated that conjunctival stroma-derived MSCs (CJMSCs) could be induced to differentiate into neuron-like cells. CJMSCs are also capable of differentiating into osteogenic, chondrogenic and adi pogenic [19]. In the present study, CJMSCs were isolated and transformed into dopaminergic neurons in vitro. Studies like this could help recognize a new source of MSCs for treatment of PD. Materials and methods Isolation, expansion and characterization of CJMSCs. CJMSCs were isolated according to a protocol modified from Nadri and co-worker [19]. In brief, After informed consent from the individuals, 2–3 mm2
424
S. Nadri et al. / Biochemical and Biophysical Research Communications 377 (2008) 423–428
conjunctiva biopsy was obtained from patients undergoing pterygium surgery and it was incubated in supplemented hor monal epithelial medium (SHEM), which is made of Dulbecco’s modified Eagle’s medium (DMEM)/F-12 (GIBCO-BRL, Grand Island, NY) containing bicarbonate (Sigma Chemical Co., St. Louis, MO), 0.5% dimethyl sulfoxide, 2 ng/ml human epidermal growth factor (EGF; Peprotech, Rocky Hill, NJ), 5 mg/ml insulin (GIBCOBRL), 5 mg/ ml transferrin (GIBCO-BRL), 5 ng/ml sodium selenite (GIBCO-BRL), 0.5 mg/ml hydrocortisone (GIBCO-BRL), 30 ng/ml cholera toxin A subunit, 5% fetal calf serum (FCS; GIBCO-BRL), 50 mg/ml gentami cin (Sigma Chemical Co.), and 1.25 mg/ml amphotericin B (Sigma Chemical Co.) for 2–5 min. Then, the biopsies were treated in SHEM containing 50 mg/ml dispase II (Sigma Chemical Co.) and 100 mM sorbitol (Espana et al., 2003). Under a stereomicroscope, epithe lial sheets were separated and the isolated stromal tissue segment was cultured in DMEM/F-12 (1:1) (GIBCO-BRL) supplemented with 10% knockout serum (GIBCO-BRL), 4 ng/ml basic-FGF (Pepro tech), 5 mg/ml insulin (Sigma Chemical Co.), and 10 ng/ml human LIF (Chemicon; Temecula, CA) (Dravida et al., 2005) and incubated at 37 °C with 5% CO2 in a humidifi ed chamber for 2 weeks. After 2 weeks, the biopsy was removed and the mesenchymal stem cells were trypsinized (0.25% Trypsin–ethylenediaminetetraacetic acid [EDTA]; GIBCO-BRL) after confluency. The cells were subsequently expanded by two passages in DMEM (GIBCO-BRL) supplemented with 100 IU/ml penicillin (Sigma Chemical Co.), 100 mg/ml strep tomycin (Sigma Chemical Co.), and 15% FCS. To identify MSCs nature of the isolated cells, the cells were treated with osteogenic DMEM composed of 50 mg/ml ascorbic acid 2-phosphate (Sigma Chemical Co.), 10 nM dexamethasone (Sigma Chemical Co.), and 10 mM b-glycerop hosphate (Sigma Chemical Co.), adipogenic (DMEM, supplemented with 50 mg/ml indomethacine (Sigma Chemical Co.) and 100 nM dexamethasone (Sigma Chemical Co.); and chondrogenic DMEM supplemented with 10 ng/ml transforming growth factor-ß3 (TGF-ß3; Sigma Chemical Co.), bone morphogenetic protein-6 (BMP-6), 10¡7 M dexamethasone (Sigma Chemic al Co.), and 50 mg/ml ascorbate2-phosphate (Sigma Chemical Co.), 50 mg/ml insulin–transferrin– selenium (ITS; GIBCO-BRL) medium for 21 days [19]. For cell surface marker (antigen) characterization, MSCs mark ers were measured by flow cytometry using FITC-conjugated anti-human CD34 (Milten yi Biotec GmbH, Bergisch Gladbach, Ger many), CD73 (Abgent, San Diego, CA), CD105, CD45 (eBioscience; San Diego, CA), and PE-conjugated anti-human CD44, Alcam (CD166) (eBioscience). In vitro differentiation of cells to dopaminergic neuron. The cells (CJMSCs), having been thawed and plated at 100 cell/cm2 in a flask 25 cm2, were incubated in DMEM supplemented with 100 IU/ml penicillin (Sigma Chemical Co.), 100 mg/ml streptomy cin (Sigma Chemical Co.), and 15% FCS for 4 days until confluency was achieved. The proliferation medium was replaced with a neu rogenic medium consisting of DMEM, supplemented with 0.5 mM isobutyl methyl xanthin (IBMX; Sigma Chemic al Co.), 1 mM dibu tyryl-cAMP (dbcAMP; Sigma Chemic al Co.), and 10 mM retinoic acid (Sigma Chemical Co.) [19] for 6 days. At the end of this period, the cells were used for RT-PCR analysis and immunocytochemistry. Two, sixth and ten-passage cells were used for the experiments including RT-PCR for dopaminergic gene expression, immunocy tochemistry and flow cytometry analysis for MAP-2 and TH pro teins. RT-PCR analysis. Total RNA was isolated from cells by using the Nucleospin RNAII kit (Macherey-Nagel, Germany). Prior to reverse transcription (RT), RNA samples were digested with DNaseI (EN0521; Fermentas) to remove contaminating geno mic DNA. DNase I was dissolved in 10£ reaction buffer with MgCl2, and 1 U/ll of DNase I was added per 1 lg of RNA and incubated for 30 min at 37 °C. DNaseI activity was arrested fol
lowing addition of 1 ll of 25 mM EDTA and it was incubated at 65 °C for 10 min. Standard RT was performed using the Revert Aid™ H Minus First Strand cDNA Synthesis Kit (Fermentas) and 2 lg total RNA, 0.5 lg oligo (dt18) per reaction according to the manufacturer’s instructions. Reaction mixtures for PCR included 2.5 ll cDNA, 1£ PCR buffer (AMS™, Sinagen, Iran), 200 lM dNTPs, 0.5 lM of each of Forward and Reverse primers and 1 U Taq DNA polymerase(Fermentas, MD, USA). The primers are listed in Table 1. Polymerase chain reactions were performed at 94 °C for 1 min, 25–30 cycles 94 °C for 30 s, 55–63 °C for 30 s, and 72 °C for 45 s and 72 °C for 7 min. Amplified DNA fragments were electrophoresed on 1.5% agarose gel. The gels were stained with ethidium bromide (10 lg/ml) and photographed on a UV transilluminator (uvidoc, UK). Immunocytochemistry analysis. The cells treated with neuro genic medium were cultured on sterile glass cover slips and fixed by incubation in 1% paraformaldehyde/PBS for 3–5 min, perme abilized with 0.5% Triton X-100 in PBS for 15 min, and post-fixed for an additional 10 min in 4% paraformaldehyde in PBS. The cells were then reacted with primary antibodies (mouse anti-tyrosine hydroxylase (TH), and Microtubule-associated protein-2 (MAP-2; Chemicon) at 4 °C for 24 h, washed with PBS and reacted with the isothioc yanate (FITC)-conjugated anti mouse IgG as the secondary antibody (Sigma Chemical Co.) at room temperature for 3 h. Then, the cells were washed with PBS-Tween 0.1% three times and incu bated with diaminobenzidine (DAB) solution (Sigma Chemical Co.) for 10 min. Flow cytometry analysis. The cultivated cells (passage 2, 6, 10) in neurogenic medium were detached with Trypsin/EDTA and per meabilized with 0.5% Triton X-100 in PBS for 45 min. About 2 £ 105 cells were divided into aliquots in amber-tinted 5 ml centrifuge tubes and 3% rat serum was added. The cells were incubated on ice for 30 min, resuspended in 400 ll PBS and pelleted by centrifuga tion for 10 min at 400g. Next, the cells were stained with fluores cent isothiocyanate (FITC)-conjugated mouse anti-human MAP-2 (Chemicon) and TH (CEDARLANE) at a concentration of 2 lg/ml at
Table 1 Specific primers used for PCR amplification. Genes
Primer sequences
Size (bp)
EN1
CTGGGTGTACTGCACACGTTAT TACTCGCTCTCGTCTTTGTCCT
356
EN2
GTGGGTCTACTGTACGCGCT CCTACTCGCTGTCCGACTTG
358
Nurr1
GCACTTCGGCAGAGTTGAATGA GGTGGCTGTGTTGCTGGTAGTT
491
Ptx3
TGGGAGTCTGCCTGTTGCAG CAGCGAACCGTCCTCTGGG
213
Pax2
ATGTTCGCCTGGGAGATTCG GCAAGTGCTTCCGCAAACTG
361
Wnt1
TAGCCTCCTCCACGAACCTG CAGCCTCGGTTGACGATCTTG
239
Wnt3a
AAGCAGGCTCTGGGCAGCTA GACGGTGGTGCAGTTCCA
234
Wnt5a
ATCCTGACCACTGGAAGCCCTGT GGCTCATGGCGTTCACCAC
358
TH
GTCCCCTGGTTCCCAAGAAAAGT TCCAGCTGGGGGATATTGTCTTC
333
HPRT1
CCTGGCGTCGTGATTAGTG TCAGTCCTGTCCATAATTAGTCC
125
S. Nadri et al. / Biochemical and Biophysical Research Communications 377 (2008) 423–428
425
4 °C for 3 h. The cells were also stained with FITC-labeled mouse anti-rat IgG 1, 2 (Sigma) as negat ive controls. The cells were pel leted, washed twice with PBS and fixed with 1% paraformaldehyde in PBS. After fixation, FACS analysis was performed on a FACS Cal libur cytometry (Becton Dickinson, San Jose, CA) using cell quest software. Win MDI 2.8 software was used to create the histo grams. Results Cell culture and characterization of CJMSCs In this work, the fibroblast-like cells from human conjunctiva stromal cells (n = 10) were isolated by adhesion of these cells on the surface of the plastic culture dishes. After 2 weeks, fibroblast-like cells with spindle-shape morphology appeared on culture dishes. To confirm mesenchymal nature, the fibroblast-like cells were treated with appropriate osteo-, chondro- and adipo-inductive media (Nadri et al., 2008), and their differentiation was confirmed via appropriate staining including alizarin red (for osteogenic dif ferentiation), alcian blue (for chondrogenic differentiat ion) and oil red (for adipogenic differentiation) staining (Supplementary File 1). Furthermore, flow cytometry analysis showed that the expres sion cell surface markers such as SH2, SH3, CD44, CD166 (Alcam) was positive, but CD34 and CD45 was negat ive (Supplementary File 2). In these cells, spindle-shaped morphology with proliferation and differentiat ion capacity was maintained during the subculture period and up to passage 15. Dopaminergic differentiat ion of the cells Next, we studied the potential of CJMSCs to differentiate into dopaminergic neural cells. To elucidate the dopaminergic neural differentiation potential of CJMSCs, these cells were cultured in neuroinductive medium including DMEM supplemented with RA, IBMX and dbcAMP. After 6 days, we examined the expres sion of dopaminergic genes by RT-PCR and immunocytochem istry. RT-PCR analysis was indicat ive of the expression of TH and Nurr1 genes in treated compared with non-treated cells (Fig. 1). Immunocytochemistry was used to analyze the intra cellular TH and MAP-2 proteins. These proteins were detected in the CJFLCs after treatment in neuroinductive medium for 6 days (Fig. 2). Flow cytometry analysis The treated cells (passages 2, 6 and 10) in neurogenic medium were analyzed for the expression of a MAP-2 and TH proteins, as shown in Fig. 3. Results showed that the expression of MAP-2 and TH proteins cells appears to gradually increase as the number of passages rises. About 95% of the cells (passage 10) expressed TH and MAP-2 proteins and did not lose differentiat ion potential up to passage 15 (Data not shown). Discussion Parkinson disease is the second most common neurodegenera tive disorder. The lifetime risk of developing Parkinson disease for men and women is 2% and 1.3%, respectively. A range of different option is currently used to reverse the symptoms of PD. Patients initially respond to treatment with dopaminergic-enhancing med ications such as levodopa [20,21]. However, the effectiveness of such treatments gradually diminishes because the conversion to dopamine within the brain is increasingly disrupted by the pro gressive degeneration of the dopaminergic terminals. As a result,
Fig. 1. Investigation of dopaminergic-specific gene expression. Expression of dopa minergic markers in control (day 0) and differentiation culture (day 6). HPRT is shown as a control for RNA sample quality.
most patients with Parkinson’s disease suffer from disability that cannot be satisfactorily controlled [21]. An alternative approach that has been targeted using for the renovation of the damaged dopaminergic system is application of stem cells [22]. To date, several different stem cells have been investigated for PD diseases, such as embryonic stem cells (ESCs) [6,23,24] and mesenchymal stem cells. However, difficulties of using human ESCs including the ethical issues and tumorigenic potential led to the search for other types of cells for treatment of PD disease. These include the possibility of autologous grafts using MSCs, as well as allograft of human ESCs. The differentiation capability of MSCs into dopaminergic neu ron has been described [25]. Despite the fact that the bone marrow is considered to be a well-accepted source of MSCs, the clinical use of MSCs from this source has presented problems including painful aspiration, contamination with non-MSCs, the low yield of aspira tion and declining stem cells properties with increasing passage number [26]. This has led many researchers to investigate alter nate sources of MSCs for treatment of PD disease. To date, these cells have been differentiated into dopaminergic neurons from Wharton’s Jelly [27] tissues. This project aimed to induce CJMSCs into mature dopamine secreting cells.
426
S. Nadri et al. / Biochemical and Biophysical Research Communications 377 (2008) 423–428
Fig. 2. Immunostaining of conjunctiva mesenchymal stem cells with TH and MAP-2 staining. The cells were maintained in neurogenic medium for 6 days and analyzed for expression of TH and MAP-2 proteins (A, C). Cells were co-stained with 4,6-diamidino-2-phenylindole to visualize nuclei (blue) related to TH (B, D). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this paper.)
Fig. 3. Expression of TH and MAP-2 proteins during diverse passages. The cells were maintained in neurogenic medium for 6 days and analyzed for expression of TH and MAP-2 proteins in two, sixth and tenth passages.
S. Nadri et al. / Biochemical and Biophysical Research Communications 377 (2008) 423–428
Conjunctiva tissue has been identified as an alternative source of multipotent stromal MSCs, which can be obtained by a less inva sive method without any contamination with non-MSCs, and it can maintain stem cell capability including proliferation and osteoadipo-chondrogenic differentiation up to passages 15. The cells isolated (fibroblast-like cells) from conjunctiva stromal tissue, along with their capability in differentiating into bone, adipocyte and chondrocyte lineages and expression of cell surface antigens such as CD105 (SH2), CD73(SH3), CD166 (Alcam) convinced us that the cells being examined are the mesenchymal stem cells. In this work, CJMSCs expressed dopaminergic neuron genes after treatment with DMEM containing 10% FBS, 0.5 mM IBMX, 1 mM dbcAMP, and 10 mM retinoic acid for 1 week. Previous inves tigators have differentiated MSCs in 2 weeks using a multistep protocol in cocktail of dopaminergic medium consisting of DMEM supplemented with 10% FBS, sonic hedgehog (SHH), fibroblast growth factor, epidermal growth factor, N2 supplement, butylated hydroxyanisole, IBMX, RA and dbcAMP [25,27]. According to results it seems that CJMSCs differentiated into dopaminergic neurons by an easier protocol compared with BMMSCs and human umbilical mesenchymal stem cells. In the present study, RT-PCR analysis was used for the con firmation of differentiat ion of CJMSCs into dopaminergic neu rons. RT-PCR analysis showed that dopaminergic genes including TH, En1, En2, PTX3, Wnt1, Wnt3a and Wnt5a were expressed in CJMSCs. Furthermore, immunocytochemistry and flow cytometry analysis revealed that TH protein was expressed in CJMSCs and the percentage of it had been increased by subcultures. Several studies of dopaminergic induction reported TH expression in MSCs after induced differentiation [28–30]. A TH protein is the initial and rate-limiting enzyme in the catecholamine synthesis pathway, and is considered the principal regulator of dopamine biosynthesis in the central neuron system. In this work, surprisingly the expres sion rate of TH and MAP-2 proteins were gradually increased as a number of passages rises which indicated CJMSCs are progen itor cells that increased neurogenic differentiat ion as rising pas sage number. However, compared to bone marrow-derived MSCs, CJMSCs are preserve neurogenic differentiat ion capacity up to high passages. Principle donor cells for Parkinson’s disease therapy should be easily available, capable of rapid expansion in culture, long-term survival, and long-term expression of genes such as TH [31]. The results in this work showed that CJMSCs were obtained via a simple approach, maintained rapid proliferat ion capacity and expressed TH gene and protein up to 15 passages. Furthermore, the expres sion and detection of TH and some other dopamine-associated genes such as Nurr1, PTX3, En1, En2, Wnt1, Wnt3a necessary for both the survival and differentiation of the mesencephalic dopa minergic precursor’s neurons [32–36] showed us that CJMSCs are differentiated into dopaminergic neurons and are good candidates for neurologic al cell therapy. Collectively, results of our study indicated that CJMSCs expressed dopaminergic genes using a simple method. This high potential of dopaminergic differentiat ion together with high proliferation and long-term culture of cells allowed us to conclude that these cells are promising candidates for treating Parkinson’s disease. Acknowledgment This work was supported by a grant from Stem Cells Technology institute. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2008.09.148.
427
References [1] C.R. Bjarkam, J.C. Sorensen, N.A. Sunde, F.A. Geneser, K. Ostergaard, New strat egies for the treatment of Parkinson’s disease hold considerable promise for the future management of neurodegenerative disorders, Biogerontology 2 (2001) 193–207. [2] G. Kleiner-Fisman, D.N. Fisman, E. Sime, J.A. Saint-Cyr, A.M. Lozano, A.E. Lang, Long-term follow up of bilateral deep brain stimulation of the subthalamic nucleus in patients with advanced Parkinson disease, J. Neurosurg. 99 (2003) 489–495. [3] E. Fuchs, J.A. Segre, Stem cells: a new lease on life, Cell 100 (2000) 143–155. [4] K.A. Buytaert-Hoefen, E. Alvarez, C.R. Freed, Generation of tyrosine hydrox ylase positive neurons from human embryonic stem cells after coculture with cellular substrates and exposure to GDNF, Stem Cells 22 (2004) 669– 674. [5] C.H. Park, Y.K. Minn, J.Y. Lee, D.H. Choi, M.Y. Chang, J.W. Shim, J.Y. Ko, H.C. Koh, M.J. Kang, J.S. Kang, D.J. Rhie, Y.S. Lee, H. Son, S.Y. Moon, K.S. Kim, S.H. Lee, In vitro and in vivo analyses of human embryonic stem cell-derived dopamine neurons, J. Neurochem. 92 (2005) 1265–1276. [6] A.L. Perrier, V. Tabar, T. Barberi, M.E. Rubio, J. Bruses, N. Topf, N.L. Harrison, L. Studer, Derivation of midbrain dopamine neurons from human embryonic stem cells, Proc. Natl. Acad. Sci. USA 101 (2004) 12543–12548. [7] Y. Yan, D. Yang, E.D. Zarnowska, Z. Du, B. Werbel, C. Valliere, R.A. Pearce, J.A. Thomson, S.C. Zhang, Directed differentiation of dopaminergic neuronal sub types from human embryonic stem cells, Stem Cells 23 (2005) 781–790. [8] X. Zeng, J. Cai, J. Chen, Y. Luo, Z.B. You, E. Fotter, Y. Wang, B. Harvey, T. Miura, C. Backman, G.J. Chen, M.S. Rao, W.J. Freed, Dopaminergic differentiation of human embryonic stem cells, Stem Cells 22 (2004) 925–940. [9] N.S. Roy, C. Cleren, S.K. Singh, L. Yang, M.F. Beal, S.A. Goldman, Functional engraftment of human ES cell-derived dopaminergic neurons enriched by coculture with telomerase-immortalized midbrain astrocytes, Nat. Med. 12 (2006) 1259–1268. [10] D.C. Lie, G. Dziewczapolski, A.R. Willhoite, B.K. Kaspar, C.W. Shults, F.H. Gage, The adult substantia nigra contains progenitor cells with neurogenic potential, J. Neurosci. 22 (2002) 6639–6649. [11] B.J. Snyder, C.W. Olanow, Stem cell treatment for Parkinson’s disease: an update for 2005, Curr. Opin. Neurol. 18 (2005) 376–385. [12] A. Alhadlaq, J.J. Mao, Mesenchymal stem cells: isolation and therapeutics, Stem Cells Dev. 13 (2004) 436–448. [13] F.P. Barry, Biology and clinical applications of mesenchymal stem cells, Birth Defects Res. C Embryo Today 69 (2003) 250–256. [14] A.I. Caplan, S.P. Bruder, Mesenchymal stem cells: building blocks for molecular medicine in the 21st century, Trends Mol. Med. 7 (2001) 259–264. [15] D.G. Phinney, I. Isakova, Plasticity and therap eutic potential of mesenchy mal stem cells in the nervous system, Curr. Pharm. Des. 11 (2005) 1255– 1265. [16] P. Bianco, M. Riminucci, S. Gronthos, P.G. Robey, Bone marrow stromal stem cells: nature, biology, and potential applications, Stem Cells 19 (2001) 180– 192. [17] A. Giordano, U. Galderisi, I.R. Marino, From the labor atory bench to the patient’s bedside: an update on clinical trials with mesenchymal stem cells, J. Cell Physiol. 211 (2007) 27–35. [18] E.J. Schwarz, G.M. Alexander, D.J. Prockop, S.A. Aziz i, Multipotential marrow stromal cells transduced to produce L-DOPA: engraftment in a rat model of Parkinson disease, Hum. Gene Ther. 10 (1999) 2539–2549. [19] S. Nadri, M. Soleimani, J. Kiani, A. Atashi, R. Izadpanah, Multipotent mesenchy mal stem cells from adult human eye conjunctiva stromal cells, Differentiat ion 76 (2008) 223–231. [20] G.C. Cotzias, M.H. Van Woert, L.M. Schiffer, Aromatic amino acids and modifi cation of parkinsonism, N. Engl. J. Med. 276 (1967) 374–379. [21] C.W. Olanow, W.G. Tatton, Etiology and pathogenesis of Parkinson’s disease, Annu. Rev. Neurosci. 22 (1999) 123–144. [22] A. Bjorklund, O. Lindvall, Cell replacement therapies for central nervous sys tem disorders, Nat. Neurosci. 3 (2000) 537–544. [23] B.E. Reubinoff, P. Itsykson, T. Turetsky, M.F. Pera, E. Reinhartz, A. Itzik, T. BenHur, Neural progenit ors from human embryonic stem cells, Nat. Biotechnol. 19 (2001) 1134–1140. [24] S.C. Zhang, M. Wernig, I.D. Duncan, O. Brustle, J.A. Thomson, In vitro differen tiation of transplantable neural precursors from human embryonic stem cells, Nat. Biotechnol. 19 (2001) 1129–1133. [25] I. Kan, T. Ben-Zur, Y. Barhum, Y.S. Levy, A. Burstein, T. Charlow, S. Bulvik, E. Mel amed, D. Offen, Dopaminergic differentiation of human mesenchymal stem cells—utilization of bioassay for tyrosine hydroxylase expression, Neurosci. Lett. 419 (2007) 28–33. [26] P.A. Zuk, M. Zhu, P. Ashjian, D.A. De Ugarte, J.I. Huang, H. Mizuno, Z.C. Alfonso, J.K. Fraser, P. Benhaim, M.H. Hedrick, Human adipose tissue is a source of mul tipotent stem cells, Mol. Biol. Cell 13 (2002) 4279–4295. [27] Y.S. Fu, Y.C. Cheng, M.Y. Lin, H. Cheng, P.M. Chu, S.C. Chou, Y.H. Shih, M.H. Ko, M.S. Sung, Conversion of human umbilical cord mesenchymal stem cells in Wharton’s jelly to dopaminergic neurons in vitro: potential therapeutic appli cation for Parkinsonism, Stem Cells 24 (2006) 115–124. [28] M. Dezawa, H. Kanno, M. Hoshino, H. Cho, N. Matsumoto, Y. Itokazu, N. Taj ima, H. Yamada, H. Sawada, H. Ishikawa, T. Mimura, M. Kitada, Y. Suzuki, C. Ide, Specific induction of neuronal cells from bone marrow stromal cells and application for autologous transplantation, J. Clin. Invest. 113 (2004) 1701–1710.
428
S. Nadri et al. / Biochemical and Biophysical Research Communications 377 (2008) 423–428
[29] N.R. Blondheim, Y.S. Levy, T. Ben-Zur, A. Burshtein, T. Cherlow, I. Kan, R. Barzi lai, M. Bahat-Stromza, Y. Barhum, S. Bulvik, E. Melam ed, D. Offen, Human mes enchymal stem cells express neural genes, suggesting a neural predisposition, Stem Cells Dev. 15 (2006) 141–164. [30] A. Hermann, R. Gastl, S. Liebau, M.O. Popa, J. Fiedler, B.O. Boehm, M. Maisel, H. Lerche, J. Schwarz, R. Brenner, A. Storch, Efficient generation of neural stem cell-like cells from adult human bone marrow stromal cells, J. Cell Sci. 117 (2004) 4411–4422. [31] A. Bjorklund, Neurobiology. Better cells for brain repair, Nature 362 (1993) 414–415. [32] Y. Chu, K. Kompoliti, E.J. Cochran, E.J. Mufson, J.H. Kordower, Age-related decreases in Nurr1 immunoreactivity in the human substantia nigra, J. Comp. Neurol. 450 (2002) 203–214.
[33] Y. Chu, W. Le, K. Kompoliti, J. Jankovic, E.J. Mufson, J.H. Kordower, Nurr1 in Par kinson’s disease and related disorders, J. Comp. Neurol. 494 (2006) 495–514. [34] G. Castelo-Branco, J. Wagner, F.J. Rodriguez, J. Kele, K. Sousa, N. Rawal, H.A. Pasolli, E. Fuchs, J. Kitajewski, E. Arenas, Differential regulation of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a, and Wnt-5a, Proc. Natl. Acad. Sci. USA 100 (2003) 12747–12752. [35] C. Martinat, J.J. Bacci, T. Leete, J. Kim, W.B. Vanti, A.H. Newman, J.H. Cha, U. Gether, H. Wang, A. Abeliovich, Cooperative transcription activation by Nurr1 and Pitx3 induces embryonic stem cell maturation to the midbrain dopamine neuron phenotype, Proc. Natl. Acad. Sci. USA 103 (2006) 2874–2879. [36] H.H. Simon, H. Saueressig, W. Wurst, M.D. Goulding, D.D. O’Leary, Fate of mid brain dopaminergic neurons controlled by the engrailed genes, J. Neurosci. 21 (2001) 3126–3134.
Lihat lebih banyak...
Comentários