Systematics and Biodiversity 5 (4): 417–434 doi:10.1017/S1477200007002307 Printed in the United Kingdom
1∗
Ewa Przybo´s , Ma Őlgorzata 1 Prajer , Magdalena 2 Greczek-Stachura , 3 Bogumi Őla Skotarczak , 3 Agnieszka Maciejewska & 1 Sebastian Tarcz 1 Institute
of Systematics and Evolution of Animals, Polish Academy of Sciences, S Őlawkowska 17, 31-016 Krakow, ´ Poland 2 Institute of Biology, Educational Academy, Podbrzezie 3, 31-054 Krako´ w, Poland 3 Department of Genetics, Szczecin University, Al. Piastow ´ 40b, 71-065 Szczecin, Poland submitted April 2005 accepted December 2006
Issued 20 November 2007 C The Natural History Museum
Genetic analysis of the Paramecium aurelia species complex (Protozoa: Ciliophora) by classical and molecular methods Abstract The Paramecium aurelia complex includes 15 species (sibling species) and is characterised by inbreeding (to varying degrees in different species), causing an increase in intra-specific differentiation. Investigations into inter- and intraspecific differentiation of strains originating from remote habitats within species of the complex were carried out by classical inter-strain crosses and molecular analyses (RAPD– PCR fingerprints, ARDRA riboprints, RFLP–PCR analysis). RAPD analysis showed that all species in the complex possessed characteristic band patterns and the majority were also polymorphic intra-specifically. A correlation exists between the degree of inbreeding characteristic for a species with differentiation of DNA genotypes revealed by RAPD analysis within species, where inbreeders showed substantial variability of band patterns and moderate inbreeders were highly similar. RFLP analysis (a 480bp fragment of the gene coding the Hsp 70 protein) with the application of restriction enzyme TruII distinguished among species, while digestion with restriction enzyme AluI distinguished groups of species (clusters) and both enzymes revealed intraspecies polymorphism within P. dodecaurelia. ARDRA riboprinting (using a fragment of SSU-LSU rDNA, about 2400 bp) with restriction enzymes HhaI, AluI, HinfI, TaqI distinguished groups of species with different band patterns. The majority of enzymes also demonstrated intra-specific differentiation within P. dodecaurelia. TaqI also revealed intraspecific differences in P. biaurelia and P. tetraurelia. All species in the P. aurelia complex showed a high percentage of surviving hybrid clones in F1 obtained by conjugation and F2 obtained by autogamy in inter-strain crosses. A low percentage was observed only in F2 inter-strain hybrids of P. tredecaurelia, however no cytological changes in the nuclear apparatuses were detected and similar band patterns existed in the studied strains. Future studies, including sequencing of rDNA fragments, may disclose deeper relationships of the species. Key words Paramecium aurelia, species complex, speciation, strains, inbreeding system, strain crosses, molecular analysis
Introduction Paramecium, a unicellular eukaryote, is a model organism in studies on speciation, cell biology, genetics, biochemistry and molecular biology; species in the P. aurelia complex in particular having been used as model organisms in studies on speciation. Some species show a great intra-species polymorphism; their strains are characterised by different genotypes revealed by genetic markers. Such intra-species polymorphism may be ∗ Corresponding
author. Email:
[email protected]
recognised as a beginning of the process of speciation. Comparison of genomic variability may also be useful for the characterisation of population structures. Consequently, we have used species in the P. aurelia complex in our research on general problems of species structure and the process of speciation in eukaryotes. The genus Paramecium includes several taxonomic species among which ‘Paramecium aurelia’ M¨uller 1773 has been the most frequently investigated. Since Sonneborn assigned binominal names to particular genetic species in 1975, it has been known as the Paramecium aurelia species complex; they are 417
418
Ewa Przybo´s et al.
sibling species, morphologically similar, but with isolated gene pools. The P. aurelia complex comprises 14 species described by Sonneborn (1975) and a 15th species (P. sonneborni) described by Aufderheide et al. (1983). The species differ in distribution, temperature preferences, conditions required for acquisition of conjugation, system of mating types inheritance and life cycle features. The P. aurelia complex is characterised by inbreeding occurring in various degrees in different species (Sonneborn, 1957; Landis, 1986) causing an increase in intra-species differentiation. Depending on the degree of inbreeding, strains within species are more or less isolated, showing a higher or lower percentage of surviving hybrid clones in inter-strain crosses. This aspect has been only fragmentarily addressed within a few species. For instance, some strains in P. tetraurelia (Dippell, 1954) and P. primaurelia (Ko´sciuszko, 1965) have been investigated genetically and karyologically. Other studies on karyological differentiation of strains within species concern only single strains (Jones, 1956). Recent papers have compared species within the P. aurelia complex, yet they have always been carried out on single strains of particular species or only on a few species. For instance, investigations on water salinity tolerance were conducted on only three species (Fokin & Smurov, 2001) and comparative studies within the subclass Peniculia or within the genus Paramecium based on SSU rRNA sequences included only two species (Str¨uder-Kypke et al., 2000a b; Fokin et al., 2004). Nanney et al. (1998) compared sequence differences in the variable 23S rRNA domain for the construction of phylogenetic relationship of Paramecium, Tetrahymena, and Colpoda using several species of the P. aurelia complex (P. biaurelia, P. triaurelia, P. tetraurelia, P. sexaurelia, P. octaurelia, P. tredecaurelia, P. sonneborni) but the species were represented by single strains only. Similarly, Coleman (2005) sequenced the internal transcribed spacer (ITS) region of the nuclear ribosomal cistron of 13 species of the P. aurelia complex for analysis of their phylogenetic relationships using either one or two strains per species. Recently, the Paramecium tetraurelia genome has also been sequenced (Dessen et al., 2001; Sperling et al., 2002; Zagulski et al., 2004). Therefore investigations of strain relationships by interstrain crosses within all species of the complex, and comparison of numerous strain genotypes revealed by RAPD (random amplified polymorphic DNA) – PCR (polymerase chain reaction) fingerprints, ARDRA (amplified ribosomal DNA restriction analysis) riboprints, RFLP (restriction fragment polymorphism) – PCR analysis, together with phylogenetic analysis of species should disclose the structure of the complex. It seems that knowledge of the genetic relationships of strains within species as well as among species is essential for understanding the intricacies of the Paramecium aurelia species complex. Here we investigate the degree of genetic differentiation among strains in species within the complex originating from remote and isolated localities (habitats) and also relationships between species in the complex. We examined cosmopolitan species such as P. primaurelia, P. biaurelia, P. tetraurelia, relatively rare species represented by allopatric strains recently discovered beyond the known range,
and also those previously accepted in literature (Sonneborn, 1974, 1975); species such as P. pentaurelia, P. septaurelia, P. octaurelia, P. decaurelia, P. dodecaurelia, P. tredecaurelia and P. quadecaurelia (Przybo´s, 2005). This study encompasses all known species in the complex and includes P. undecaurelia and P. sonneborni, which are known only from single habitats. The genetic diversity of strain genotypes within particular species of the complex and species relationships within the complex were examined at three levels: cellular – by classical strain crosses and by assessing the percentage of surviving clones in F1 and F2 generations in the particular species; molecular – by RAPD–PCR fingerprints, ARDRA riboprinting, RFLP analysis and subcellular – by cytological analysis of nuclear apparatuses in inter-strain hybrids. The aim of the study was to investigate the genetic relationships of the particular species composing the P. aurelia complex as well as the rate of speciation (differentiation) of strains within species by inter-strain crosses and comparison of strain genotypes revealed by the applied molecular methods.
Materials and methods The following species of the P. aurelia complex were studied: P. primaurelia, P. biaurelia, P. tetraurelia, P. pentaurelia, P. septaurelia, P. octaurelia, P. decaurelia, P. undecaurelia, P. dodecaurelia, P. tredecaurelia, P. quadecaurelia and P. sonneborni. Strains of each species are listed in Table 1.
Strain cultivation and crossing The methods of Sonneborn (1970) were used for the cultivation of strains, induction of conjugation and autogamy. Paramecia were cultivated on a lettuce medium inoculated with Enterobacter aerogenes at a temperature of 24 ◦ C. In the intra and inter-strain crosses, the F1 generation was obtained by conjugation and F2 by autogamy (using the method of daily isolation lines). The occurrence of the desired stage of autogamy (specimens at the stage of two macronuclear anlagen) was examined on preparations stained with aceto-carmine. Survival of clones in both generations was estimated from a total of 100 clones. Clones were considered survivors after passing 6–7 fissions during 72 hours following the separation of conjugation partners or postautogamous caryonids, in accordance with Chen (1956). All possible inter- and intrastrain crosses within species were performed. We compared the percentage of surviving clones in the inter-strain crosses and the time of persistence of particular generations of inter-strain hybrids. The methods have been described in detail in Przybo´s (1975).
Methods used in cytological analysis Analysis of nuclear apparatuses of inter-strain hybrids was carried out by temporarily staining slides with aceto-carmine (Sonneborn, 1950) or by making permanent slides fixed in Schaudinn’s fluid with glacial acetic acid (Chen, 1944) and
The Paramecium aurelia species complex
Species
Strain designation
Geographical origin
References
Paramecium primaurelia
90 standard of the species (1)
USA, Pennsylvania, Bethayres Spain, Andalusia Greece, Athens Russia, Moscow Vietnam, Hanoi Israel, Qasr-el Yehud, River Jordan Poland, Carpathians, Bieszczady Mts Scotland, Rieff Spain, Segovia Romania, Cluj Russia, Irkutsk Italy, Island of Giglio Poland, Pomeranian Lake District, Pruszcz Poland, Middle Sudetes Mts Australia, Sydney Spain, Madrid Slovakia, Carpathians, Tatras, Strbske Lake Istrael, Tabga Japan, Honshu Island Poland, Krak´ow USA, Pennsylvania Russia, Astrahan Nature Reserve USA, Florida Russia, Astrahan Nature Reserve USA, Florida Israel, Ein Efek USA, Florida Japan, Nara
Sonneborn, 1974
SA (2) GA (23) RM (4) VH (21) IJ (25) PB (260) Paramecium biaurelia
Rieff standard of the species (31) SS (261) RC (46) RI (34) IG (41) PP (75) PSK (65)
Paramecium tetraurelia
Paramecium pentaurelia
S standard of the species (92) SM (94) ST (95) IT (97) J (99) PK (104) 87 standard of the species (106) RAZ (115)
Paramecium septaurelia
38 standard of the species (144) RA (210)
Paramecium octaurelia
138 standard of the species (168) IEE (169) 223 standard of the species (194) JN (195) 219 standard of the species (196) 246 standard of the species (197) HHS (199) JU (198) G (201) IE (200) 209 standard of the species (203)
USA, Texas USA, southern state Hawaii, Honolulu Japan, Ube Germany, M¨ unster Italy, Elbe Island France, Paris
321 standard of the species (204)
Mexico, Taxco
IKM (205) 328 standard of the species (206) AN (207) PS standard of the species (208)
Israel, Kinet Motzkin Australia, Emily Gap Africa, Namibia USA, Texas
Paramecium decaurelia Paramecium undecaurelia Paramecium dodecaurelia
Paramecium tredecaurelia
Paramecium quadecaurelia Paramecium sonneborni Table 1
419
Przybo´s unpublished Przybo´s & Fokin, 2002 Komala & Dubis, 1966 Przybo´s & Fokin, 1996 Przybo´s, 1995 Komala & Przybo´s, 1980 Beale & Schneller, 1954 Przybo´s, 1980 Przybo´s, 1968 Przybo´s & Fokin, 1996 Przybo´s, 1998 Przybo´s & Komala, 1981 Przybo´s & Komala, 1988 Sonneborn, 1974 Przybo´s, 1980 Dubis & Komala, 1963 Przybo´s, 1995 Przybo´s & Fokin, 2001 Komala & Przybo´s, 2000 Sonneborn, 1974 Przybo´s et al., 2004 Sonneborn, 1974 Przybo´s et al., 2004 Sonneborn, 1974 Przybo´s et al., 2002a Sonneborn, 1974 Przybo´s et al., 2003b Sonneborn, 1975 Sonneborn, 1974 Przybo´s & Fokin, 2003a Przybo´s et al., 2003b Przybo´s & Fokin, 2003b Przybo´s & Fokin, 2003b Rafalko & Sonneborn, 1959 Rafalko & Sonneborn, 1959 Przybo´s et al., 2002b Sonneborn, 1975 Przybo´s et al., 2003a Aufderheide et al., 1983
Strains of species of the Paramecium aurelia complex used in this study. In the second column, the numbers of strains deposited in the collection of the Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, are indicated in parentheses. List of strains is accessible at: http://www.isez.pan.krakow.pl (Department of Experimental Zoology).
420
Ewa Przybo´s et al.
stained using Giemsa (10% Giemsa solution in 0.01 M phosphate buffer), (cf. Przybo´s, 1978).
Methods used in molecular analysis Random amplified polymorphic DNA–PCR (RAPD–PCR) analysis Paramecium genomic DNA was isolated from vegetative cells at the end of the exponential phase using QIAamp DNA Mini Kit (Qiagen Germany) as described in Przybo´s et al. (2003c). DNA was stored at −20 ◦ C until analysis. All strains used in investigations are listed in Table 1. PCR amplification for RAPD analysis was carried out using one oligonucleotide 10 mer random primer characterized by the sequence 5 -GCAGAGAAGG-3 . This primer was chosen from a series of ten 10 mer random primers (Ro 460 Roth, Karlsruhe, Germany) because it gave easily distinguishable banding patterns for species and strains in Paramecium jenningsi (Skotarczak et al., 2004 a, b). The same primer was also used in several studies carried out on P. aurelia spp. (Stoeck et al., 1998, 2000a) and on P. jenningsi (Przybo´s et al., 1999, 2003c). Each 20 µl PCR mixture contained 2 µl of DNA template, 1 × reaction QIAGEN buffer, 2.5 mM MgCl2 , 200 µM dNTPs, 1.5 µM primer, 1.5U of Taq DNA polymerase (QIAGEN). PCR reactions were performed according to the program described by Stoeck and Schmidt (1998). PCR products (15 µl), along with the pGEM DNA molecular weight marker (Promega) were run on 1.5% TBE agarose gels stained with 0.5 µg ml−1 ethidium bromide. Generally, three repetitions of the PCR reaction were performed in order to assess the reproducibility of the data. All RAPD parameters were carefully standardized.
Restriction fragment length polymorphism (RFLP–PCR) analysis DNA was isolated from c. 20 cells (similar culture conditions as described in 3a) of each of the studied strains (Table 1) using Master Pure DNA Purification Kit (Epicentre, USA). A fragment (about 480 bp) of the gene coding the Hsp70 protein was PCR amplified using forward primer Afor (GAGGAGAAGATTTCGATAAC) and reverse primer Arev (GCTTCATCTGGGTTGATTGA) (Biomers, Germany) as in Przybo´s et al. (2003c). The reaction mixture of 50 µl final volume contained: 5 µl DNA isolate, Qiagen polymerase (0.05 U/µl of reaction mixture), Qiagen buffer (1 × concentrated, c. 1.5 mM MgCl2 /µl reaction mixture), MgCl2 (c. 0.0025 MgCl2 /µl reaction mixture), primers Afor and Arev in equal quantities (c. 0.5 pmol/µl of reaction mixture), dNTPs (c. 100 µM/µl of reaction mixture), and water to 10 µl. PCR products were precipitated and purified by an ethanol (96% and 70%) and sodium acetate protocol. DNA was suspended in 5 µl of Te buffer (pH = 8). Digestion of amplification products was conducted using AluI, EcoRI and TruII restrictases (Fermentas, Lithuania), each at a concentration of c. 0.15 U per µl of reaction mixture. The mixture for restriction digestion for 1 sample (20 µl volume) contained 5 µl of the amplification product, 0.15 U enzyme/µl
of reaction mixture, 2 µl of buffer for the particular enzyme and water to 20 µl. The digestion was carried out at 37 ◦ C for 18 hours. Enzymes were inactivated at 65 ◦ C. The products of the enzyme digestion were separated by electrophoresis in 4.5% agarose for 4 hours at 85 V together with a set of DNA molecular weight markers that included GeneRuler (Fermentas, Lithuania), SmartLadder (Eurogentec, Belgium), Marker 501 and Marker 1044 (Polgen, Poland). Gels were stained with ethidium bromide and visualised under UV light. The images were stored in computer memory using the program Biocapt (Vilbert Lourmat, France). The length of the restriction fragments obtained was evaluated using the Bio 1D program (Vilbert Lourmat, France).
Amplified ribosomal DNA restriction analysis (ARDRA) (fragment of SSU-LSU rDNA) Paramecium genomic DNA was isolated from vegetative cells at the end of the exponential phase using the QIamp DNA Mini Kit (Qiagen Germany) as described in Przybo´s et al. (2003c) from all studied species and strains (Table 1). For ARDRA analysis PCR, amplifications of genomic DNA were performed using the forward primer 5 GAAACTGCGAATGGCTC-3 , an internal ciliate specific sequencing primer (82F) from the 5 end of the SSU rRNA gene (Elwood et al., 1985) and the reverse primer: 5 TTGGTCCGTGTTTCAAGACG-3 ; constructed from a region of the ciliate LSU rRNA (Jerome & Lynn, 1996). Each amplification reaction was carried out in 100 µl of reaction mixture containing 2 µl DNA template, 1 × QIAGEN PCR buffer, 1 × Q solution, 200 µM dNTP mix, 0.4 µM of each primer, 2.5U of Taq DNA polymerase (QIAGEN). PCR reactions were performed under the following conditions: initial denaturation 10 min at 94 ◦ C, and next 40 cycles consisted of denaturation 1 min at 94 ◦ C, annealing 2 min at 49 ◦ C and extension 2 min at 72 ◦ C. These cycling sequences were followed by a final extension of 10 min at 72 ◦ C. A 10 µl aliquot from each reaction was run on 1.5% agarose gel to visualise the PCR product. Restriction digests were performed directly on the ∼2.4 kb PCR product without precipitation of DNA after PCR. The following restriction enzymes were used: AluI, DraI, HhaI, HindIII, HinfI, EcoRV, MspI, PstI, TaqI (PROMEGA). Digestion reactions were carried out separately for each enzyme at 37 ◦ C (65 ◦ C for TaqI) for 1.5 h. The final volume of the reaction mixture was 20 µl and contained: 10 µl PCR product, 5U of each restriction enzyme, 1 × reaction buffer, 0.1 µg/µl acetylated BSA. Digested PCR products were run on 1.5% or 2% agarose gels for 1.5 h at 85 V.
Analysis of molecular data The Bio1D++ program (Vilbert Lourmat, France) was used to calculate intra- and inter-species relationships on the basis of the similarity of DNA band patterns obtained by the RAPD method, according to the Nei and Li (1979) similarity coefficient i.e. a = 2nxy/(nx + ny) where nx and ny are the number
The Paramecium aurelia species complex
of bands in lane ‘x’ and ‘y’, respectively, and nxy the number of shared bands between the two lanes. Dendrograms were produced from the similarity values in the matrix using the UPGMA (unweighted pair group match average) algorithm. UPGMA is a phenetic distance method (Nei, 1987; Page & Holmes, 1998; Graur & Li, 2000) employing a sequential clustering algorithm. The results of electrophoresis of DNA fragments obtained by RFLP and ARDRA methods were entered into the database as 0 (absence of a band) and 1 (presence). The profiles were compared by means of a similarity index computed according to the formula of Nei and Li (1979). Next, the matrices of distances were subjected to cluster analysis. The patterns of clusters were found by means of the Ward method. The matrices were also illustrated with multidimensional scaling (Manly, 1986).
Results Crosses Generally, a high percentage of surviving clones was observed in F1 (obtained by conjugation) and F2 (obtained by autogamy) generations in the inter-strain crosses within the studied species of the P. aurelia complex (Table 2), i.e. Paramecium primaurelia, P. biaurelia, P. tetraurelia, P. pentaurelia, P. septaurelia, P. octaurelia, P. decaurelia, P. dodecaurelia and P. quadecaurelia The strains used in the crosses originated from geographically distant collecting sites (Table 1) and were always crossed with the standard strain of the particular species and in different combinations with each other. For comparison, survival in intra-strain crosses is presented. Some strains in P. tetraurelia represented one mating type only, so it was impossible to ob-
Fig. 1
421
tain F1 by conjugation in intra-strain crosses and inter-strain hybrids (Table 2) as both crossed strains were restricted to the same mating type. A low percentage of surviving hybrid clones was observed in F2 generation of P. tredecaurelia, i.e. 24% in the cross of standard strains 209 × 321 (strain from France, genetically restricted to odd mating type × strain from Mexico, genetically restricted to even mating type, they can react only with each other), and 26% in the cross of IKM (strain from Israel, restricted to even mating type) × 209 (strain from France). However, no cytological changes in the nuclear apparatuses in the inter-strain hybrids in both generations were observed on slides (Giemsa stain), so we do not see what was the cause of such low percentage of surviving clones. Sonneborn (1974) also observed a low percentage of surviving hybrid clones in F2 generation in the inter-strain cross (strains 209 × 321) of P. tredecaurelia. The fission rate in intra- and inter-strain crosses was similar among F1 lines leading to viable F2 generations. Autogamy in the studied hybrid lines appeared after a similar number of fissions as in parental lines. No disorder was observed in the course of the life cycle of the hybrids.
RAPD fingerprint analysis [Figs 1–4] Paramecium primaurelia The basic band pattern characteristic for the species is comprised of bands at 350, 900 and 1500 bp appearing in the studied strains originating from different collecting sites, even from different continents. Comparison of all band patterns of the particular strains distinguished three different genotypes within this species (Figs 1A, 2A). The first genotype (PpI) appears in strains 90 (USA, Pennsylvania) and RM (Russia,
RAPD fingerprints of species of the Paramecium aurelia complex. M – molecular pGEM marker, molecular weight of the marker DNA bands are given in bp. Agarose gel and schematic representation of band patterns. A. Strains of P. primaurelia : 1–90, 2-RM, 3-SA, 4-PB, 5-GA, 6-IJ, 7-VH; B. Strains of P. biaurelia: 1- Rieff, 2-PSK, 3-PP, 4-SS, 5-IG, 6-RC, 7-RI; C. Strains of P. pentaurelia: 1–87, 2-RAZ and strains of P. septaurelia: 3–38, 4-RA; D. Strain of P. undecaurelia: 1–219; strains of P. tredecaurelia: 2- 209, 3- IKM; strains of P. quadecaurelia : 4–328, 5- AN; strain of P. sonneborni : 6-Ps. E. Strains of P. tetraurelia: 1-S, 2-J, 3-PK, 4-SM, 5-ST, 6-IT; F. Strains of P. octaurelia: 1–138, 2-IEE and strains of P. decaurelia: 3–223, 4-JN; G. Strains of P. dodecaurelia: 1–246, 2-HHS, 3-JU, 4-IE, 5-G.
422
Ewa Przybo´s et al.
Species Strain P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P.prim P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P. bi P.tetr P.tetr P.tetr P.tetr P.tetr P.tetr P.tetr P.tetr P.tetr P.tetr Table 2
90 × 90 SA × SA GA × GA RM × RM VH × VH IJ × IJ PB × PB SA × 90 GA × 90 RM × 90 VH × 90 IJ × 90 PB × 90 SA × GA SA × RM SA × VH SA × IJ SA × PB GA × RM RM × VH VH × IJ IJ × PB VH × GA 2×2 SS × SS RC × RC RI × RI IG × IG PSK × PSK SS × 2 RC × 2 RI × 2 IG × 2 PSK × 2 SS × RI PSK × IG RC × SS S×S SM × SM ST × ST IT × IT J×J PK × PK SM × S ST × S IT × S J×S
F1 F2 (by conjugation) (by autogamy) Species 100 100 98 97 100 98 98 100 100 100 98 100 100 96 100 100 98 98 98 100 96 100 98 98 98 100 96 100 100 100 100 100 100 100 100 100 100 100 One mating type One mating type One mating type One mating type One mating type 100 100 100 100
98 100 86 98 100 98 98 92 98 100 94 98 82 92 100 98 98 80 92 96 80 98 97 96 98 94 90 98 98 92 98 96 82 90 94 96 78 100 100 100 100 100 100 88 100 98 96
P.tetr P.tetr P.tetr P.tetr P.tetr P.tetr P.tert P.tetr P.tetr P.tetr P.tetr P. pent P. pent P. pent P.sept P.sept P.sept P.oct P.oct P.oct P. dec P. dec P. dec P. undec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P. dodec P.tredec P.tredec P.tredec P.quadec P.quadec P.quadec P.sonneb
Strain
F1 F2 (by conjugation) (by autogamy)
PK × S SM × ST SM × IT SM × J SM × PK ST × IT J × PK ST × PK J × IT PK × IT ST × J 87 × 87 RAZ × RAZ RAZ × 87 38 × 38 RA × RA RA × 38 138 × 138 IEE × IEE IEE × 138 223 × 223 JN × JN JN × 223 219 × 219 246 × 246 HHS × HHS JU × JU G×G IE × IE HHS × 246 JU × 246 G × 246 IE × 246 JU × HHS IE × G JU × G JU × IE HHS × G HHS × IE 209 × 321 IKM × IKM IKM × 209 328 × 328 AN × AN An × 328 PS × PS
100 One mating type One mating type 98 One mating type One mating type 100 One mating type 100 One mating type One mating type 100 100 100 One mating type One mating type 100 100 100 100 100 100 100 100 One mating type One mating type One mating type 100 100 90 100 100 98 95 98 100 98 100 100 100 One mating type 100 100 100 100 100
98
94
96 100
100 100 100 100 100 94 100 100 100 100 100 100 100 100 100 100 96 100 88 68 80 96 93 94 98 95 96 100 24 100 26 96 100 96 100
Survival (percentage) in intra- and interstrain crosses of the Paramecium aurelia spp. complex
Moscow), their band patterns showing 82% similarity in the cluster analysis. The second genotype (PpII) represented by strain SA (Spain, Andalusia) is characterised by a specific band pattern. The third genotype (PpIII) appears in strains PB (Poland, Bieszczady Mts), GA (Greece, Athens), IJ (Israel,
River Jordan), and VH (Vietnam, Hanoi). However, strains PB and GA seem more related to each other (96% similarity) than to strains VH and IJ (approximately of 80% similarity). Strains VH and IJ show 74% similarity in their band patterns. A strain from Spain (SA) shows the greatest difference in band pattern
The Paramecium aurelia species complex
Fig. 2
423
Intraspecies dendrograms of P. primaurelia (A), P. biaurelia (B), P. tetraurelia (E), P. octaurelia (F1 ), P. decaurelia (F2 ) and P. dodecaurelia (G) strains, based on RAPD fingerprinting.
in comparison with both groups of strains, with about 40% band pattern similarity to strains 90 and RM and only 30% similarity to strains from the third genotype group (PB, GA, IJ, VH).
Paramecium biaurelia Within P. biaurelia large variation in band patterns characteristic for the particular strains was found and several genotypes
were detected: PbI characteristic for strain designated Rieff, Scotland; Pb II for strain PSK, Poland (southern part), Sudetes Mts; Pb III for strain PP, Poland (northern part), Pomeranian Lake District; PbIV for strain SS, Spain, Segovia; PbV for strain IG, Italy, Island of Giglio; PbVI for two strains, one strain RC, Romania, Cluj and the second strain RI, Russia, Irkutsk. The only band appearing in all strains is at about 300 bp (Fig. 1B). A dendrogram (Fig. 2B) presents the relationships
424
Ewa Przybo´s et al.
Fig. 3
Dendrogram presenting the relationships of species of the P. aurelia complex constructed on the basis of RAPD fingerprints of the standard strains representing the particular species.
Fig. 4
Dendrogram presenting the relationships of species of the P. aurelia complex constructed on the basis of RAPD fingerprints of the strains representing all revealed genotypes within the particular species.
of strains within P. biaurelia, three main groups of strains can be distinguished. Strains Rieff and PSK show 74% similarity (first group), strains RC and RI also show 75% similarity of their band patterns (second group), and strains SS and IG show only 45% similarity (third group). The groups of strains show low similarity to each other. It is also interesting to compare the band patterns of strains from the same country e.g. two Polish strains, PSK and PP (southern and northern Poland), show 50% similarity of band patterns.
Paramecium tetraurelia The band patterns of the studied strains are polymorphic within species (Fig. 1E). Some strains are characterised by similar bands, however, only two bands (e.g. about 550 and 600 bp) appear in all studied strains and can be recognised as composing the basic band pattern of the species. Paramecium tetraurelia strains cannot be precisely divided into separate genotype groups as their band patterns differ from each other within the particular groups in one or more bands. However,
The Paramecium aurelia species complex
three genotypes can be distinguished, each composed of geographically isolated strains. Strains S (Sydney, Australia) and PK (Poland) form one genotype group (PtI), strains J (Japan) and SM (Spain) form the second group(PtII), and the strains ST (Slovakia) and IT (Israel) compose the third group (PtIII). Group I and II demonstrate some similarity to each other. The difference within the first group appears in the band pattern of the strain from Australia as two extra bands at about 2150 and 2400 bp, the strains show 82% similarity. In the second group, four extra bands at about 900, 1400, 2100, and 2400 bp appear in the pattern of the strain from Spain, both strains J and SM show 75% similarity. In the third genotype group, in the pattern characteristic for the IT strain the extra bands at 400 and 800 bp can be seen as well as a missing band at about 1200 bp which is present in the ST strain, the strains exibit 75% similarity. A tree diagram (Fig. 2E) constructed on the basis of the cluster analysis of the fingerprint similarity pattern presents relationships of groups of strains. Strains S (Sydney) and SM from Spain show about 70% similarity, both strains to the strain from Poland (PK) show about 65% similarity, and all three strains show 55% similarity to the strain from Japan. This group of strains shows only 45% similarity to the other group of strains ST (Slovakia) and IT (Israel), and both strains (ST and IT) show 55% similarity of band patterns.
Paramecium pentaurelia Both P. pentaurelia strains used in the present work (strain 87 from USA, Pennsylvania and strain RAZ from Russia, Astrahan Nature Reserve) revealed the same genotypes (Fig. 1C). The strains show 100% similarity of band patterns. Paramecium septaurelia Both strains of this species, one from the USA (strain 38, Florida) and second from Russia (RA, from Astrahan Nature Reserve) are characterised by similar band patterns showing 94% similarity and differ by only one extra band at about 1300 bp in the pattern of the Russian strain (Fig. 1C). Paramecium octaurelia Paramecium octaurelia strains from the USA (138, Florida) and Israel (IEE, Ein Efek) showed different band patterns, only one similar band appeared in the patterns of both strains at about 1100 bp and the similarity of their band patterns is only 13% (Figs 1F, 2F1 ). Paramecium decaurelia The basic band pattern characteristic for the species comprises several bands seen in both studied strains, in strain 223 (standard strain of the species, from USA) and in JN strain (Japan) (Fig. 1F). The only difference between patterns is the presence of extra bands (430, 470, and 1100 bp) in strain 223. Figure 2F2 presents the close relationship of both strains, with 75% similarity of band patterns. Paramecium undecaurelia The band pattern characteristic for strain 219 from Texas, USA is presented in Fig. 1D. Paramecium dodecaurelia Considerable polymorphism was revealed in P. dodecaurelia strains originating from different collecting sites on different
425
continents (Fig. 1G). The basic band pattern characteristic for the species and appearing in all strains comprises bands at about 900 and 1200 bp. It is difficult to group the strains into particular groups of genotypes as band patterns are substantially differentiated. Each strain represents a different genotype, the first (Pdd I) appears in strain 246 from USA, the second (PddII) in strain HHS from Hawaii, the third (PddIII) in strain JU from Japan, the forth (PddIV) in strain IE from Italy, and the fifth (PddV) in strain G from Germany. Figure 3G presents the relationships of strains. Strains 246 (USA) and G (Germany) show similarity of 35%, strains HHS (Hawaii), JU(Japan) and IE (Italy) show similarity of 45% of their band patterns, and both groups show low similarity of about 23% to each other.
Paramecium tredecaurelia Paramecium tredecaurelia strains 209 (France, Paris) and IKM (Israel, Kinet Motzkin) showed generally similar band patterns. They differ by the presence of only one band at about 1000 bp in the strain from Israel and show 92% similarity of band patterns (Fig. 1D). Paramecium quadecaurelia Paramecium quadecaurelia strains 328 (Australia, Emily Gap) and AN (Africa, Namibia) showed generally similar band patterns, they differ only in two bands (diagram) and show similarity of 86 % (Fig. 1D). Paramecium sonneborni Only one known strain from Texas was used. The characteristic band pattern is presented in Fig. 1D. A dendrogram (with homology coefficient 1% [UPGMA]) presenting the relationships of the studied species of the P. aurelia complex (Fig. 3) was constructed on the basis of RAPD fingerprints of the standard strains representing the particular species. Band patterns of P. primaurelia and P. pentaurelia show 35 % similarity, and are about 33% similar to the P. septaurelia band pattern. The P. tredecaurelia band pattern shows 25% similarity to the previous ones. These species compose one species group. The second cluster comprises several species, among them P. biaurelia and P. tetraurelia showing 50% similarity of band patterns, both species exhibit about 37% similarity to the P. undecaurelia band pattern. P. quadecaurelia and P. sonneborni show similarity of 60% of band patterns, and both species appear 32% similar to the P. dodecaurelia band pattern. The next group within this cluster comprises P. octaurelia and P. decaurelia showing about 45% similarity of band patterns. Both groups of species (clusters) show low (about 20%) similarity of their band patterns. Another dendrogram (with homology coefficient 1% [UPGMA]) presenting the relationships of the studied species of the P. aurelia complex (Fig. 4) was constructed on the basis of RAPD fingerprints of the strains representing all revealed genotypes in the species of the P. aurelia complex. Strains of some species cluster together on the dendrogram, like those of P. biaurelia (strains Rieff, PSK, PP, SS, IG and RC), representing all genotypes in the species; their band patterns show 60–90% similarity. Strains 246, JU, HHS and IE
426
Fig. 5
Ewa Przybo´s et al.
RFLP analysis (fragment of about 480 bp of the gene coding for the Hsp 70 protein) of species of the Paramecium aurelia complex. M – molecular marker, Marker 501 (Polgen, Poland), molecular weight of the marker DNA bands in bp. Band patterns on agarose gel after digestion with restriction enzymes: TruII, AluI, Eco RI. Strains of P. primaurelia: 1–90, 2-SA, 3-GA, 4-RM, 5-VH, 6-IJ, 7-PB; Strains of P. biaurelia: 1-Rieff, Scotland, 2-SS, 3-RC, 4-RI, 5-IG, 6-PP, 7-PSK; Strains of P. tetraurelia: 1-SM, 2-ST, 3-IT, 4-J, 5-PK, 6-S; Strains of P. pentaurelia: 1–87, 2-RAZ; Strains of P. septaurelia: 1–38, 2-RA; Strains of P. octaurelia: 1–138, 2-IEE; Strains of P. decaurelia: 1–223, 2-JN: Strain of P. undecaurelia 219; Strains of P. dodecaurelia: 1–246; 2-HHS, 3-JU, 4-G, 5-IE: Strains of P. tredecaurelia: 1–209, 2-IKM; Strains of P. quadecaurelia:1–328, 2-AN.
of P. dodecaurelia group together showing similarity of 40– 60%, only strain G of P. dodecaurelia appears separately on the dendrogram. Strains of P. tetraurelia comprise one group (S, PK, and ST) together with strain 138 of P. octaurelia. Similarity of their band patterns is about 50%. Strains 90 and VH representing different genotypes of P. primaurelia appear in the dendrogram in one cluster with those of other species in the complex, namely 38 of P. septaurelia, 219 of P. undecaurelia, 209 of P. tredecaurelia, and RAZ of P. pentaurelia. However, strain SA of P. primaurelia appears separately being closer to strains of P. biaurelia. Strain 328 of P. quadecaurelia and the only known strain of P. sonneborni show 60% similarity of band patterns. Strain 223 of P. decaurelia groups together with the previous species.
RFLP analysis (Figs 5–7) A fragment of the gene coding the Hsp 70 protein (about 480 bp) isolated from all studied strains (Table 1) of the P. aurelia complex was digested (methods 3b) by restriction enzymes AluI, EcoRI, TruII (Fermentas, Lithuania) (Fig. 5). Patterns obtained by cleavage with enzyme TruII were characteristic and unique for the particular species; they did not show intra-species differentiation with the exception of Paramecium dodecaurelia. Within that species only strains from Europe, i.e. from Germany (G) and Italy (IE) showed similar band patterns, other strains 246 (USA), HHS (Hawaii), and JU (Japan) revealed different band patterns. Band patterns of the studied species obtained by cleavage with enzyme AluI were not characteristic and unique for the particular species,
The Paramecium aurelia species complex
427
Nei & Li distance, Ward clustering 1.8 1.6
Distance linkage
1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 12(JU)
Fig. 6
12(IEG)
8 4
7
13
12(246)
11 12(HHS)
14
2
10 1
5
Dendrogram of band pattern similarity (Nei & Li distance, Ward clustering) of the studied species, based on RFLP analysis. Numbers designate particular species, i.e. 1-P. primaurelia, 2-P. biaurelia, 4-P. tetraurelia, 5-P. pentaurelia, 7-P. septaurelia, 8-P. octaurelia, 10-P. decaurelia, 11-P. undecaurelia, 12-P. dodecaurelia (JU strain, IE, G strains, HHS strain 246 strain), 13-P. tredecaurelia, 14-P. quadecaurelia.
1.2 12(JU)
1.0
12(IEG)
0.8 0.6
7 14
0.4 Dimension 2
0.2
12(248) 4
8
12(HHS)
0.0 -0.2
13 11 10
-0.4 -0.6
5 2
-0.8 -1.0 1
-1.2 -1.4 -1.2
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Dimension 1 Fig. 7
Similarity matrix of the studied species demonstrated by means of multidimensional scaling. Clusters of species obtained by cluster analysis are encircled. Results of RFLP analysis. Designations of species and strains as in Fig. 6.
428
Ewa Przybo´s et al.
but showed some differences distinguishing groups of species, although intraspecies differentiation was found only within P. dodecaurelia. Similar band patterns appeared in the first group of species, i.e. P. primaurelia, P. pentaurelia, P. decaurelia, P. undecaurelia, P. tredecaurelia and P. quadecaurelia, and in two strains of P. dodecaurelia (246-USA and HHS –Hawaii). Similar band patterns were found in P. tetraurelia, P. septaurelia and P. octaurelia, comprising the second group. Only one band appeared in P. biaurelia and European strains of P. dodecaurelia (G from Germany and IE from Italy); these were placed in the third group of species. The strain of P. dodecaurelia from Japan (JU) is characterised by bands at 204, 63 and 35 bp and is unique, forming a fourth group. Only P. dodecaurelia showed intra-species differentiation revealing three types of band patterns. Band patterns of all studied species were similar after cleavage with enzyme EcoRI which does not differentiate species. A dendrogram based on band patterns from the RFLP analysis with application of two restriction enzymes discerned three clusters of species (Fig. 6), one composed of P. tetraurelia, P. octaurelia with P. septaurelia and strain JU of P. dodecaurelia. The second cluster includes P. undecaurelia, strain HHS of P. dodecaurelia, P. tredecaurelia, P. quadecaurelia, and strains IE and G of P. dodecaurelia. The third cluster (connected with the second one) comprises P. primaurelia, P. decaurelia, P. pentaurelia, strain 246 of P. dodecaurelia and P. biaurelia. The same groups of species can be seen in Fig. 7 presenting clusters of species obtained by cluster analysis. Substantial intra-species polymorphism was revealed in P. dodecaurelia; strains of this species belong to three clusters.
ARDRA analysis (Figs 8–10) We amplified a fragment of about 2400 bp of SSU –LSU ribosomal RNA gene, with the internal transcribed spacers (ITS). Some restriction enzymes (DraI, HindIII, and PstI) did not cleave the DNA of the studied species of the P. aurelia complex. EcoRV did not produce different restriction patterns in the studied species (Fig. 8) as well as MspI, with the exception of P. dodecaurelia. MspI revealed an extra band in patterns of IE and G strains (Fig. 8G, band patterns numbers 4 and 5). AluI, HhaI, HinfI, and TaqI produced different band patterns characteristic for groups of species (Fig. 8). AluI differentiated four groups, the first including P. primaurelia, P. biaurelia, P. tetraurelia, P. pentaurelia, P. septaurelia P. octaurelia, P. decaurelia, P. quadecaurelia and P. sonneborni; the second group – P. undecaurelia, and the third group – P. tredecaurelia. The band pattern of P. dodecaurelia differs from those of other species and is also differentiated intraspecifically. The latter constitutes the fourth group. HhaI produced three groups, the first included P. primaurelia, P. pentaurelia, P. septaurelia, P. quadecaurelia and P. sonneborni; the second P. biaurelia, P. undecaurelia, P. tredecaurelia and strains HHS, JU, IE and G of P. dodecaurelia, the third P. tetraurelia, P. octaurelia and P. decaurelia, and strain 246 of P. dodecaurelia. HinfI differentiated three groups, the first comprised P. primaurelia, P. tetraurelia, P. octaurelia, P. decaurelia, P. undecaurelia,
P. dodecaurelia, P. tredecaurelia and P. quadecaurelia, the second included P. biaurelia, P. pentaurelia and P. septaurelia, and the third P. sonneborni. TaqI differentiated several groups, the first comprised P. primaurelia, P. pentaurelia and P. undecaurelia, the second P. biaurelia, P. septaurelia, P. tredecaurelia, P. quadecaurelia and P. sonneborni. It is interesting that in the case of this enzyme, intra-species differentiation is seen within P. biaurelia, two strains; RC (Romania) and RI (Russia) showed differed band patterns (one extra band) from those characteristic for the other strains of the species. The third group of species is composed of P. tetraurelia (with a different band pattern for strain ST lacking one band), P. octaurelia, P. decaurelia, and strains 246 and HHS of P. dodecaurelia. Band patterns of the other P. dodecaurelia strains differ from patterns characteristic for other species of the complex and show strong intra-species differentiation. Strains 246 and HHS show similar patterns to the third group of species, and strain JU has a very divergent band pattern as well as strains IE and G (with identical band pattern). A dendrogram of band patterns similarity based on ADRRA analysis with the application of enzymes AluI, HhaI, HinfI, TaqI shows two clusters of species (Fig. 9). One cluster is composed of strains JU, G, and HHS of P. dodecaurelia. The second cluster includes several species, some forming subclusters. One subcluster includes P. primaurelia, P. quadecaurelia and P. pentaurelia with the closely related P. septaurelia, P. sonneborni and P. tetraurelia. It is divided into two groups, one composed only of strain ST, and the second group (designated J) includes five other strains of P. tetraurelia, P. octaurelia, and P. decaurelia all having identical band patterns. The second subcluster is composed of P. biaurelia divided into two groups, one group with two strains RC and RI sharing an identical band pattern differing from patterns of other strains of the species, and the second group of five other strains of P. biaurelia with identical band patterns, P. tredecaurelia, P. undecaurelia. The third subcluster is composed of strains IE and 246 of P. dodecaurelia. Figure 10 presents a similarity matrix of the studied species demonstrated by means of multidimensional scaling. It clearly shows the existence of two clusters, one with strains G, HHS, and JU of P. dodecaurelia, and the other with the remaining species, with an internal subgroup of two strains (IE and 246) of P. dodecaurelia. Again substantial polymorphism was revealed within P. dodecaurelia.
Discussion Recently, DNA-based molecular marker techniques have been widely applied in studies revealing the genetic diversity of species. Among these is the RAPD technique, used on invertebrates (Vandewoestijne & Baguette, 2002; Van Doninck et al., 2004), vertebrates (Mamuris et al., 2002; Ste˛pniak et al., 2002), plants (Huang et al., 2000; Ulloa et al., 2003; Su et al., 2003; ˇ Ma et al., 2004), and unicellular organisms (Sedinov´ a et al., 2003), among these ciliates, e.g. Tetrahymena thermophila (Lynch et al., 1995; Brickner et al., 1996), Euplotes sp. (Kusch & Heckman, 1996; Chen et al., 2000), Uronychia sp. (Chen
The Paramecium aurelia species complex
Fig. 8
429
ARDRA riboprint patterns (SSU-LSU rDNA fragment of about 2400 bp) after digestion with restriction enzymes EcoRV, MspI, AluI, HhaI, HinfI, TaqI of species of the Paramecium aurelia complex, agarose gel. M - molecular pGEM marker, molecular weight of the marker DNA bands are given in bp. A. Strains of P. primaurelia : 1–90, 2-RM, 3-SA, 4-PB, 5-GA, 6-IJ, 7-VH; B. Strains of P. biaurelia: 1- Rieff, 2-PSK, 3-PP, 4-SS, 5-IG, 6-RC, 7-RI; C. Strains of P. pentaurelia: 1–87, 2-RAZ and strains of P. septaurelia: 3–38, 4-RA; D. Strain of P. undecaurelia: 1–219; strains of P. tredecaurelia: 2–209, 3-IKM; strains of P. quadecaurelia 4–328, 5-AN; strain of P. sonneborni : 6-Ps; E. Strains of P. tetraurelia : 1-S, 2-J, 3-PK, 4-SM, 5-ST, 6-IT; F. Strains of P. octaurelia: 1–138, 2-IEE and strains of P. decaurelia: 3–223, 4-JN; G. Strains of P. dodecaurelia: 1–246, 2-HHS, 3-JU, 4-IE, 5-G.
et al., 2003), Diophrys sp. (Chen & Song, 2002), Stentor coeruleus (Kusch, 1998) and Gonostomum affine (Foissner et al. 2001). Several molecular studies concerning DNA fragment analyses (ARDRA, RAPD) as well as comparisons of gene sequences (rRNA) in protozoa were summarised by Schlegel and Meisterfeld (2003). RAPD analysis has been used in studies on intra-species differentiation in Paramecium, revealing different genotypes within the P. aurelia complex, i.e. P. triaurelia, P. pentaurelia, P. sexaurelia and P. novaurelia (Stoeck et al., 1998, 2000a). The method proved useful in identification of species in the P. aurelia complex (Stoeck & Schmidt, 1998) and was also applied to other species of genus Paramecium, i.e. P. nephridiatum, P. calkinsi, P. dubosqui, P. woodruffi (Fokin et al., 1999a, b), and P. schewiakoffi (Fokin et al., 2004), and in recent research on the existence of sibling species as in the case of
P. jenningsi (Przybo´s et al., 1999, 2003; Skotarczak et al., 2004a, b) and P. caudatum (Stoeck et al., 2000b). This method revealing diversity within morphotypes is important as, according to Nanney et al. (1998) ‘the large molecular diversity is obscured by morphological conservatism associated with constraints of ancient designs’. Our results of the RAPD-PCR analysis showed that species of the Paramecium aurelia complex could be differentiated inter- and intraspecifically by their band patterns. The majority of species revealed intraspecific polymorphism as the presence of several genotypes with different band patterns (e.g. P. primaurelia, P. biaurelia, P. tetraurelia), while other species showed a high similarity of genotypes (P. pentaurelia, P. septaurelia, P. decaurelia, P. tredecaurelia and P. quadecaurelia). Substantial variation of band patterns was found within P. octaurelia and P. dodecaurelia. Such
430
Ewa Przybo´s et al.
Nei & Li distance, Ward clustering 0.7
0.6
Distance linkage
0.5
0.4
0.3
0.2
0.1
0.0 12(JU) 12(HHS) 12(246) 12(G) 12(IE) 11
4(ST)
2**
13 2*
J***
14
7 P.s
5
1
Fig. 9
Dendrogram of band pattern similarity (Nei & Li distance, Ward clustering) of the studied species, based on ARDRA riboprinting (AluI, HhaI, HinfI, TaqI enzymes). Designations: 1 – P. primaurelia, 2∗ – strains RC and RI of P. biaurelia with identical band patterns but different from other strains by one extra band, 2∗∗ – the other strains of P. biaurelia; J∗∗∗ – strains of P. tetraurelia (excluding strain ST), P. octaurelia, P. decaurelia, all with identical band patterns; 4(ST) – strain ST of P. tetraurelia, 5 – P. pentaurelia, 7 – P. septaurelia, 11 – P. undecaurelia, 12 – P. dodecaurelia (JU strain, G strain, HHS strain, IE strain, 246 strain), 13 – P. tredecaurelia, 14 – P. quadecaurelia, P.s. – P. sonneborni.
Fig. 10
Similarity matrix of the studied species demonstrated by means of multidimensional scaling. Clusters of species obtained by cluster analysis are encircled. Results of ARDRA riboprinting (AluI, HhaI, HinfI, TaqI enzymes). Designations as in Fig. 9.
The Paramecium aurelia species complex
polymorphism may be connected with the degree of inbreeding (extreme inbreeding) characteristic for the above-mentioned species; other species with low differentiation are characterised by moderate levels of inbreeding. The dendrograms present the relationships of species within the P. aurelia complex (Figs 3, 4); both are constructed on the basis of RAPD fingerprints but differ by the number of strains taken into consideration. The first dendrogram (Fig. 3) constructed only on the basis of RAPD fingerprints of the standard strains representing the particular species revealed two groups of species; the first comprises P. primaurelia, P. pentaurelia, P. septaurelia, P. tredecaurelia, and the second the remaining species of the complex. Both groups show low similarity in their band patterns. The second dendrogram (Fig. 4) constructed on the basis of RAPD fingerprints of the strains representing all genotypes within the studied species provides a greater resolution of relationships of both species and strains. Strains of P. dodecaurelia belong to separate clusters. RFLP analysis (a fragment of about 480 bp of a gene coding the Hsp 70 protein) with the application of the restriction enzyme TruII also distinguished particular species of the complex and revealed intraspecific differentiation, although the latter was limited to P. dodecaurelia. Application of restriction enzyme AluI places species into several groups i.e. one group composed of P. primaurelia, P. pentaurelia, P. decaurelia, P. undecaurelia, P. tredecaurelia, P. quadecaurelia, and strain 246 of P. dodecaurelia, a second including P. tetraurelia, P. septaurelia, P. octaurelia, and a third with P. biaurelia and two strains (Germany, Italy) of P. dodecaurelia (Figs 6, 7). RFLP-PCR of a large segment of nuclear ribosomal DNA and internal transcribed spacers analysis (with several restriction enzymes) was also used for identifying and distinguishing sibling species in the Tetrahymena pyriformis complex; RFLP– PCR seems to be an alternative to traditional technique for identifying species by mating with living reference specimens or isoenzyme analysis (Jerome & Lynn, 1996). RFLP–PCR has been used on its own or in combinations with RAPD fingerprinting in investigations on the flagellate Euglena agilis (Zakry´s, 1997) and on plants (Parani et al., 1997). The method of ARDRA riboprinting (using a highly conserved rDNA fragment) with the application of restriction enzymes HhaI, AluI, HinfI and TaqI distinguished several groups of species (Figs 9, 10) within the P. aurelia complex with different band patterns. AluI, HhaI, TaqI and MspI revealed intra-specific polymorphism within P. dodecaurelia, and TaqI also differentiated within P. biaurelia and P. tetraurelia. A dendrogram of band patterns similarity of the studied species based on ARDRA analysis produced two species clusters. One cluster is composed of strains JU, G, and HHS of P. dodecaurelia, the second cluster includes several species forming several subclusters with an internal subgroup with two strains IE and 246 of P. dodecaurelia. Stoeck et al. (2000b) wrote in a paper concerning P. caudatum ‘unpublished results of different P. aurelia sibling species investigated by ARDRA showed that these P. aurelia syngens are characterised by different riboprint patterns’. We have tried to find differences between 15 species of the P. aurelia complex. Riboprinting of small subunit RNA genes was also applied in Entamoeba spp. and intraspecific
431
variation was detected by Clark and Diamond (1997). They supposed ‘. . . riboprinting can be a useful tool for the rapid identification and assessment of relatedness among species in a broad range of organisms’ and ARDRA analysis was recently used for rapid identification of rumen ciliates (Regensbogenova et al., 2004). The molecular methods (RAPD, RFLP and ARDRA) revealed the existence of groups of species within the P. aurelia complex. Paramecium primaurelia, P. pentaurelia, P. septaurelia in one group, P. undecaurelia and P. tredecaurelia as a second group, P. tetraurelia, P. octaurelia and P. decaurelia as another, and P. dodecaurelia very polymorphic. The allocation of species of the complex into different groups was already proposed by Sonneborn (1957, 1966, 1975) according to types of mating type inheritance. The groups also differ in antigen systems and the occurrence of endosymbionts. Our study with the application of molecular methods placed P. primaurelia and P. pentaurelia together in one group. Similarly, according to Sonneborn (1975) both species show a caryonidal system of mating type inheritance, and the odd mating type of P. primaurelia reacts moderately with the even mating type of P. pentaurelia (not yielding viable F2 generation). The intraspecies differentiation within P. dodecaurelia is remarkable and was revealed by all the applied molecular methods. It may be connected with the characteristic degree of inbreeding in this species. Sonneborn had already in 1957 associated several features of Paramecium aurelia spp. life history (type of mating type determination, occurrence of autogamy, selfing, the length interval of sexual immaturity after conjugation) with the degree of inbreeding. Nanney et al. (1998) studied the relative molecular distances separating species within genus Paramecium by comparing sequence (190 bases) divergence in a variable D2 domain of 23S rRNA and also investigated some species of the P. aurelia complex. They found that ‘the aurelia complex constitutes a tight (dense) evolutionary cluster’ in the tree constructed by the authors. They also suggested that ‘Although intraspecific D2 polymorphism was not observed, one would not be surprised . . . to find D2 polymorphism within an aurelia species if studies were made of large samples of strains from widely separated collection sites’. In the present paper we used the strains from such remote sites. The molecular methods applied in the present work revealed relationships of species and intraspecies polymorphisms. Such polymorphism can be recognised as symptom of the process of speciation. All the species of the P. aurelia complex studied showed a high percentage of surviving clones in F1 and F2 generations in inter-strain crosses. A low percentage was observed only in P. tredecaurelia in F2 . No cytological changes in the nuclear apparatuses in the inter-strain hybrids were observed. Sequencing of rDNA fragments of the studied strains of P. tredecaurelia may perhaps shed light on this problem as well as on the substantial polymorphism of strains observed in P. dodecaurelia (Tarcz et al. unpublished). Recently, the internal transcribed spacer (ITS) region of nuclear ribosomal cistron for 13 species of the P. aurelia complex was sequenced, and the set of 111–116 ITS2 nucleotide positions relatively conserved were derived for comparative analysis (Coleman,
432
Ewa Przybo´s et al.
2005). Intrasyngen homogeneity was revealed but the author used only one strain, 246 of P. dodecaurelia and one or two strains representing other species (syngens). We plan to investigate several strains of P. dodecaurelia originating from remote collecting sites, which proved divergent in our molecular characterisation. Future studies comprising sequencing of DNA fragments of strains from all species of the complex may reveal deeper relationships among the species. These will be elaborated in future work.
Acknowledgements This research was supported financially by the Grant No. 2P04C 011 26 of the Ministry of Science and Information Society Technologies, Warsaw, Poland, acknowledged by the authors. The authors also thank Ms Marta Surmacz for excellent technical assistance.
References AUFDERHEIDE, K.J., DAGGETT, P.-M. & NERAD, T.A. 1983. Paramecium sonneborni n. sp., a new member of the Paramecium aurelia species-complex. Journal of Protozoology 30, 128–131. BEALE, G. & SCHNELLER, M. 1954. A ninth variety of Paramecium aurelia. Journal of General Microbiology 11, 57–58. BRICKNER, J.H., LYNCH, T.J., ZEILINGER, D. & ORIAS, E. 1996. Identification, mapping and linkage analysis of randomly amplified DNA polymorphisms in Tetrahymena thermophila. Genetics 143, 811–821. CHEN, T.T. 1944. Staining nuclei and chromosomes in protozoa. Stain Technology 19, 83–90. CHEN, T.T. 1956. Varieties and mating types in Paramecium bursaria. II. Variety and mating types found in China. Journal of Experimental Zoology 132, 255–268. CHEN, Z. & SONG, W. 2002. Characterization and identification of the Diophrys species (Protozoa, Ciliophora, Hypotrichida) based on RAPD fingerprinting and ARDRA riboprinting. European Journal of Protistology 38, 383–391. CHEN, Z., SONG, W. & WARREN, A. 2000. Studies on six Euplotes spp. (Ciliophora: Hypotrichida) using RAPD fingerprinting, including a comparison with morphometric analyses. Acta Protozoologica 39, 209–216. CHEN, Z., SONG, W. & WARREN, A. 2003. Species separation and identification of Uronychia spp. (Hypotrichia: Ciliophora) using RAPD fingerprinting and ARDRA riboprinting. Acta Protozoologica 42, 83–90. CLARK, C.G. & DIAMOND, L.S. 1997. Intra-specific variation and phylogenetic relationships in the genus Entamoeba as revealed by riboprinting. Journal of Eukaryotic Microbiology 44, 142–154. COLEMAN, A. 2005. Paramecium aurelia revisited. Journal of Eukaryotic Microbiology 52, 68–77. DESSEN, P., ZAGULSKI, M., GROMADKA, R., PLATTNER, H., KISSMEHL, R., MEYER, E., BE´ TERMIER, M., SCHULTZ, J.E., LINDER, J.U., PEARLMAN, R.E., KUNG, C., FORNEY, J., SATIR, B.H., VAN HOUTEN, J.L., KELLER, A-M., FROISSARD, M., SPERLING, L. & COHEN, J. 2001. Paramecium genome survey: a pilot project. Trends in Genetics 17, 306–308. DIPPELL, R.V. 1954. A preliminary report on the chromosomal constitution of certain variety 4 races of Paramecium aurelia. Caryologia 260 (suppl.), 1109–1111. DUBIS, K. & KOMALA, Z. 1963. Syngens of Paramecium aurelia in the water reservoir of the Tatra Mountains. Folia biologica (Krak´ow) 11, 309–313. ELWOOD, H.J., OLSEN, G.J. & SOGIN, M.L. 1985. The small subunit rDNA gene sequences from the hypotrichous ciliates Oxytricha
nova and Stylonychia pustulata. Molecular Biology and Evolution 2, 399–410. FOISSNER, W., STOECK, T., SCHMIDT, H. & BERGER, H. 2001. Biogeographical differences in a common soil ciliate, Gonostomum affine (Stein), as revealed by morphological and RAPD-fingerprint analysis. Acta Protozoologica 40, 83–97. FOKIN, S.I., PRZYBOS´ , E., CHIVILEV, S.M., BEIER, C.L., MATTHIAS, H., SKOTARCZAK, B., WODECKA, B. & FUJISHIMA, M. 2004. Morphological and molecular investigations of Paramecium schewiakoffi sp. nov. (Ciliophora, Oligohymenophorea) and current status of distribution and taxonomy of Paramecium spp. European Journal of Protistology 40, 225–243. FOKIN, S.I. & SMUROV, A.O. 2001. Salinity tolerance of Paramecium (Ciliophora, Peniculia): phylogenetical aspect. Proceedings of Zoological Institute of Russian Academy of Sciences 289, 83–88. FOKIN, S.I., STOECK, T. & SCHMIDT, H.J. 1999a. Rediscovery of Paramecium nephridiatum Gelei, 1925 and its characteristics. Journal of Eukaryotic Microbiology 46, 416–426. FOKIN, S.I., STOECK, T. & SCHMIDT, H.J. 1999b. Paramecium duboscqui Chatton, Brachon, 1933. Distribution, ecology and taxonomy. European Journal of Protistology 35, 161–167. GRAUR, D. & LI, W-H. 2000. Fundamentals of Molecular Evolution. Sinauer Associates, Sunderland, MA. HUANG, S.C., TSAI, C.C. & SHEU, C.S. 2000. Genetic analysis of Chrysanthemum hybrids based on RAPD molecular markers. Botanical Bulletin of Academia Sinica 41, 257–262. JEROME, C.A. & LYNN, D.H. 1996. Identifying and distinguishing sibling species in the Tetrahymena pyriformis complex (Ciliophora, Oligohymenophorea) using PCR/RFLP analysis of nuclear ribosomal DNA. Journal of Eukaryotic Microbiology 43, 492– 497. JONES, K.W. 1956. Nuclear differentiation in Paramecium. Ph.D. Thesis, University of Wales, Aberystwyth, GB. KOMALA, Z. & DUBIS, K. 1966. Syngens of Paramecium aurelia in some regions of Moscow and Leningrad. Folia biologica (Krak´ow) 14, 227–228. KOMALA, Z. & PRZYBOS´ , E. 1980. Investigations on the Paramecium aurelia species complex in the Duszatyn Lakes. Folia biologica (Krak´ow) 28, 195–200. KOMALA, Z. & PRZYBOS´ , E. 2000. Further investigations on the zooplankton of water bodies in the Botanical Garden of the Jagiellonian University in Krak´ow. Folia biologica (Krak´ow) 48, 49–51. KOS´ CIUSZKO, H. 1965. Karyologic and genetic investigations of syngen 1 of Paramecium aurelia. Folia biologica (Krak´ow) 13, 339– 368. KUSCH, J. 1998. Local and temporal distribution of different genotypes of pond-dwelling Stentor coeruleus. Protist 149, 147–154. KUSCH, J. & HECKMANN, K. 1996. Population structure of Euplotes ciliates revealed by RAPD fingerprinting. Ecoscience 3, 378–384. LANDIS, W.G. 1986. The interplay among ecology, breeding systems, and genetics in the Paramecium aurelia and Paramecium bursaria complexes. In: CORLISS, J.P. & PATTERSON, D., Eds., Progress in Protistology 1. Biopress, Bristol, pp. 287–307. LYNCH, T.J., BRICKNER, J., NAKANO, K.J. & ORIAS, E. 1995. Genetic map of randomly amplified DNA polymorphisms closely linked to the mating type locus of Tetrahymena thermophila. Genetics 141, 1315–1325. MA, R., YLI-MATTILA, T. & PULLI, S. 2004. Phylogenetic relationships among genotypes of world-wide collection of spring and winter ryes (Secale cereale L.) determined by RAPD-PCR markers. Hereditas 140, 210–221. MAMURIS, Z., SFOUGARIAS, A.I., STAMATIS, C. & SUCHENTRUNK, F. 2002. Assessment of genetic structure of greek brown hare (Lepus europeus) populations based on variation in random amplified polymorphic DNA (RAPD). Biochemical Genetics 40, 323–338. MANLY, B.F.J. 1986. Multivariate Statistical Methods. A Primer. Chapman and Hall, London, New York. NANNEY, D.L., PARK, C., PREPARATA, R. & SIMON, E.M. 1998. Comparison of sequence differences in a variable 23S rRNA domain
The Paramecium aurelia species complex
among sets of cryptic species of ciliated protozoa. Journal of Eukaryotic Microbiology 45, 91–100. NEI, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York. NEI, M. & LI, W-H. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of National Academy Sciences 76, 5260–5273. PAGE, R.D.M. & HOLMES, E.C. 1998. Molecular evolution. A phylogenetic approach. Blackwell Science Ltd., Oxford. PARANI, M., LAKSHMI, M., ELANGO, S., RAM, N. & ANURATHA, C.S. 1997. Molecular phylogeny of mangroves II. Intra- and interspecific variation in Avicennia. PRZYBOS´ , E. 1968. The occurrence of syngens of Paramecium aurelia in Rumania. Folia biologica (Krak´ow) 16, 131–136. PRZYBOS´ , E. 1975. Genetic studies of Paramecium jenningsi strains (Diller, Earl 1958). Folia biologica (Krak´ow) 23, 425–471. PRZYBOS´ , E. 1978. Cytological and karyological studies of Paramecium jenningsi. Folia biologica (Krak´ow) 26, 25–29. PRZYBOS´ , E. 1980. Distribution of species of the Paramecium aurelia complex in Spain. Folia biologica (Krak´ow) 28, 405–412. PRZYBOS´ , E. 1995. Species of the Paramecium aurelia complex in Israel (Ciliophora, Protista). Israel Journal of Zoology 41, 205– 206. PRZYBOS´ , E. 1998. New habitats of Paramecium biaurelia in Italy. Folia biologica (Krak´ow) 46, 87–89. PRZYBOS´ , E. 2005. Recent data on the distribution of species of the Paramecium aurelia complex in Europe. Folia biologica (Krak´ow) 53, in press. PRZYBOS´ , E., HORI, M. & FOKIN, S.I. 2003a. Strains of Paramecium quadecaurelia from Namibia, Africa. Genetic and molecular studies. Acta Protozoologica 42, 357–360. PRZYBOS´ , E. & FOKIN, S.I. 1996. New habitats of species of the Paramecium aurelia complex in Russia and Vietnam. Folia biologica (Krak´ow) 44, 107–109. PRZYBOS´ , E. & FOKIN, S.I. 2001. Species of the Paramecium aurelia complex in Japan. Folia biologica (Krak´ow) 49, 105–106. PRZYBOS´ , E. & FOKIN, S.I. 2002. Further studies on the Paramecium aurelia species complex in Greece. Folia biologica (Krak´ow) 50, 179–180. PRZYBOS´ , E. & FOKIN, S.I. 2003a Paramecium dodecaurelia strains from Hawaii. Folia biologica (Krak´ow) 51, 225–226. PRZYBOS´ , E. & FOKIN, S. 2003b. Habitats of Paramecium dodecaurelia in Europe. Protistology 3, 136–137. PRZYBOS´ , E., FOKIN, S., STOECK, T. & SCHMIDT, H.J. 1999. Occurrence and ecology of Paramecium jenningsi strains. Folia biologica (Krak´ow) 47, 53–59. PRZYBOS´ , E., FUJISHIMA, M. & NAKAOKA, Y. 2003b. Paramecium decaurelia and Paramecium dodecaurelia from the P. aurelia spp. complex in Japan. Folia biologica (Krak´ow) 51, 223–224. PRZYBOS´ , E. & KOMALA, Z. 1981. Species of the Paramecium aurelia complex in Northern Poland. Folia biologica (Krak´ow) 29, 141– 149. PRZYBOS´ , E. & KOMALA, Z. 1988. Studies on the Paramecium aurelia species complex in the Middle Sudetes of Poland. Folia biologica (Krak´ow) 36, 183–194. PRZYBOS´ , E., NEVO, E. & PAVLICEK, T. 2002a. Distribution of species of the Paramecium aurelia complex in Israel. Acta Protozoologica 41, 293–295. PRZYBOS´ , E., NEVO, E. & PAVLICEK, T. 2002b. Paramecium tredecaurelia of the Paramecium aurelia complex in Israel. Folia biologica (Krak´ow) 50, 221–222. PRZYBOS´ , E., RAUTIAN, M. & POTEKHIN, A. 2004. First European record of Paramecium septaurelia and the discovery of new European habitats of P. pentaurelia and P. sexaurelia in Russia (Astrakhan and Volgograd regions). Folia biologica (Krak´ow) 52, 87–90. PRZYBOS´ , E., SKOTARCZAK, B. & WODECKA, B. 2003c. Phylogenetic relationships of Paramecium jenningsi strains (classical analysis and RAPD studies). Folia biologica (Krak´ow) 51, 185–195.
433
RAFALKO, M. & SONNEBORN, T.M. 1959. A new syngen (13) of Paramecium aurelia consisting of stocks from Mexico, France and Madagascar. Journal of Protozoology 6 (Suppl.), 30. REGENSBOGENOVA, M., KISIDAYOVA, S., MICHALOWSKI, T., JAVORSKY, P., MOON-VAN DER STAAY, S.Y., MOON-VAN DER STAAY, G.W.M., HACKSTEIN, J.H.P., MCEWAN, N.R., JOUANY, J-P., NEWBOLD, J.C. & PRISTAS, P. 2004. Rapid identification of rumen Protozoa by restriction analysis of amplified 18 S rRNA gene. Acta Protozoologica 43, 219–224. SCHLEGEL, M. & MEISTERFELD, R. 2003. The species problem in protozoa revisited. European Journal of Protistology 39, 349– 355. ´ J., FLEGER, J., EY, P. & KULDA, J. 2003. Use of ranSˇ EDINOVA, dom amplified polymorphic DNA (RAPD) analysis for the identification of Giardia intestinalis subtypes and phylogenetic tree construction. Journal of Eukaryotic Microbiology 50, 198–203. SKOTARCZAK, B., PRZYBOS´ , E., WODECKA, B. & MACIEJEWSKA, A. 2004a. Sibling species within Paramecium jenningsi. Acta Protozoologica 43, 29–35. SKOTARCZAK, B., PRZYBOS´ , E., WODECKA, B. & MACIEJEWSKA, A. 2004b. Random amplified polymorphic DNA fingerprinting as a marker for Paramecium jenningsi strains. Folia biologica (Krak´ow) 52, 117–124. SONNEBORN, T.M. 1950. Methods in general biology and genetics of Paramecium aurelia. Journal of Experimental Zoology 113, 87–148. SONNEBORN, T.M. 1957. Breeding systems, reproductive methods and species problem in Protozoa. In: MAYR, E., Ed., The species problem. AAAS, Washington, DC., pp. 155–324. SONNEBORN, T.M. 1966. A non-conformist genetic system in Paramecium Aurelia. American Zoology 6, 589. SONNEBORN, T.M. 1970. Methods in Paramecium research. In: PRESCOTT, D.M., Ed., Methods in cell physiology 4. Academic Press, New York, pp. 242–339. SONNEBORN, T.M. 1974. Paramecium aurelia. In: KING, R.C., Ed., Handbook of Genetics 2. Plenum Press, New York, pp. 469–594. SONNEBORN, T.M. 1975. The Paramecium aurelia complex of fourteen sibling species. Transections of American Microscopical Society 94, 155–178. SPERLING, L., DESSEN, P., ZAGULSKI, M., PEARLMAN, R.E., MIGDALSKI, A., GROMADKA, R., FROISSARD, M., KELLER, A-M. & COHEN, J. 2002. Random sequencing of Paramecium somatic DNA. Eukaryotic Cell 1, 341–352. ´ , M. 2002. Use of STE¸ PNIAK, E., ZAGALSKA, M.M. & S´ WITONSKI RAPD technique in evolution studies of four species in family Canidae. Journal of Applied Genetics 43, 489–499. STOECK, T., PRZYBOS´ , E., KUSCH, J. & SCHMIDT, H.J. 2000a. Intraspecies differentiation and level of inbreeding of different sibling species of the Paramecium aurelia complex. Acta Protozoolgica 39, 15–22. STOECK, T., PRZYBOS´ , E. & SCHMIDT, H.J. 1998. A comparison of genetics with inter-strain crosses and RAPD-fingerprints reveals different population structures within the Paramecium aurelia complex. European Journal of Protistology 43, 348–355. STOECK, T. & SCHMIDT, H.J. 1998. Fast and accurate identification of European species of the Paramecium aurelia complex by RAPDfingerprints. Microbial Ecology 35, 311–317. STOECK, T., WELTER, H., SEITZ-BENDER, D., KUSCH, J. & SCHMIDT, H.J. 2000b. ARDRA and RAPD-fingerprinting reject the sibling species concept for the Phylogenetic relationships of the subclass Peniculia (Oligohymenophorea, Ciliophora) inferred from small subunit rRNA gene sequences. Journal of Eukaryotic Microbiology 47, 419–429. ¨ STRUDER -KYPKE, M.C., WRIGHT, A.-D., FOKIN, S.I. & LYNN, D.H. 2000a. Phylogenetic relationships of the genus Paramecium inferred from small subunit rRNA gene sequences. Molecular Phylogenetics and Evolution 14, 122–130. ¨ STRUDER -KYPKE, M.C., WRIGHT, A.-D., FOKIN, S.I. & LYNN, D.H. 2000b. Phylogenetic relationships of the subclass Peniculia
434
Ewa Przybo´s et al.
(Oligohymenophorea, Ciliophora) inferred from small subunit rRNA gene sequences. Journal of Eukaryotic Microbiology 47, 419–429. SU, H., QU, L-J., HE, K., ZHANG, Z., WANG, J., CHEN, Z. & GU, H. 2003. The great wall of China: a physical barrier to gene flow? Heredity 90, 212–219. ULLOA, O., ORTEGA, F. & CAMPOS, H. 2003. Analysis of genetic diversity in red clover (Trifolium pratense L.) breeding populations as revealed by RAPD genetic markers. Genome 46, 529–535. VANDEWOESTIJNE, S. & BAGUETTE, M. 2002. The genetic structure of endangered populations in the cranberry fritillary, Boloria aquilonaris (Lepidoptera, Nymphalidae): RAPDs vs allozymes. Heredity 89, 439–445.
¨ , I., MARTENS, K. & BACKELJAU, T. 2004. VAN DONINCK, K., SCHON Clonal diversity in the ancient asexual ostracod Darwinula stevensoni assessed by RAPD-PCR. Heredity 93, 154–160. ZAGULSKI, M., NOWAK, J.K., LE MOUE¨ L, A., NOWACKI, A., MIG¨ L, B., BLANC, I., DESSEN, P., DALSKI, A., GRAMADKA, M., NOE WINCKER, P., KELLER, A-M., COHEN, J., MEYER, E. & SPERLING, L. 2004. High coding density on the largest Paramecium tetraurelia somatic chromosome. Current Biology 14, 1397– 1404. ZAKRYS´ , B. 1997. The taxonomic consequences of morphological and genetic variability in Euglena agilis Carter (Euglenophyta): species or clones in Euglena? Acta Protozoologica 36, 157–169.