SHOCK, Vol. 24, No. 6, pp. 518–522, 2005
GENETIC PREDISPOSITION FOR A COMPROMISED IMMUNE SYSTEM AFTER MULTIPLE TRAUMA Frank Hildebrand,* Hans-Christoph Pape,* Martijn van Griensven,* Sven Meier,* Sandra Hasenkamp,† Christian Krettek,* and Manfred Stuhrmann† *Trauma Department and † Department of Human Genetics, Medical School Hannover, Carl-Neuberg Strasse 1, 30625 Hannover, Germany Received 11 Apr 2005; first review completed 3 May 2005; accepted in final form 17 Aug 2005 ABSTRACT—Severe trauma induces sustained changes of the immune response, which are thought to be related to secondary organ dysfunction. Despite a similar injury severity, the extent of the inflammatory response may vary between polytraumatized patients. It is unclear whether inflammatory variability is associated with genetic variations. In this prospective cohort study, patients were included when the following criteria were fulfilled: Injury Severity Score >16, age 18 to 60 years, and a survival >48 h after injury. Four different polymorphisms (TNF-Nco1, IL-1-Taq1, IL-6-174G/C, and IL-8251A/T) were determined. Patients were separated according to the severity of the systemic inflammatory response syndrome (SIRS; ACCP/SCCM criteria: >2 criteria at 2 consecutive days or at 3 days of the observation period: group +SIRS; #2 criteria: group –SIRS). Ninety-seven severely injured patients were included (2SIRS, 56 patients; +SIRS, 41 patients). A significantly higher incidence of the IL-6-174G allele and the IL-6-174G homozygous genotype in +SIRS patients was observed. The IL-6-174G/C polymorphism was associated with the severity of posttraumatic SIRS. This data points toward a genetic predisposition regarding an enhanced inflammatory response after polytrauma that may be associated with adverse outcome. KEYWORDS—Cytokines, multiple trauma, SIRS, ARDS, sepsis, genetic polymorphisms
INTRODUCTION
loci such as TNF-a, IL-1b, and IL-6, have been associated with a predisposition to numbers of inflammatory diseases such as arthritis, pneumonia, and sepsis. Variable associations between cytokine production and polymorphisms have been reported. It was suggested that polymorphisms in regulatory regions may affect the transcriptional regulation of cytokines. A single nucleotide polymorphism (SNP) within the human IL-6 gene (G/C) was demonstrated to exhibit an enhanced spontaneous and inducible production of IL-6. Furthermore, a SNP in the TNFa promotor was shown to increase TNF-a synthesis (6, 8–11). In the present study it was hypothesized that genetic polymorphisms may also influence the systemic inflammatory response in the traumatic setting. Therefore, the distribution of TNF-a, IL-1b, IL-6, and IL-8 genotypes in patients with severe trauma were determined and it was investigated whether an association with the systemic inflammatory response and clinical outcome occurs.
The development of a trauma-induced exaggerated inflammatory response is recognized as a part of the physiologic reaction after trauma and infection (1). An overwhelming systemic inflammation (systemic inflammatory response syndrome, SIRS) has been attributed to a state that predisposes to further posttraumatic complications (2). Among the proinflammatory cytokines, IL-6 is regarded as one of the most important mediators of early response to trauma (3). IL-6 has been clearly shown to represent one of the best markers for outcome in patients with severe blunt trauma (4). Permanently increased plasma levels of IL-6 were associated with an adverse outcome after trauma, whereas significantly lower IL-6 plasma concentrations were seen in patients who survived complications in the posttraumatic course (4). Likewise, systemic IL-8 concentrations were reported to correlate with injury severity and were found to be an early predictor of survival after trauma (5). Despite a similar injury severity and injury distribution, the intensity of inflammation varies between polytraumatized patients. Clinical and experimental studies have suggested that the inflammatory response is regulated at the genetic level (6– 14). Certain cytokine gene polymorphisms, including those in
PATIENTS AND METHODS Patients The study followed the guidelines of the revised UN declaration of Helsinki in 1975 and its latest amendment of 1996 (42. general meeting). After approval by the ethical committee of Hanover Medical School, informed consent was obtained from patients or their closest relatives for blood sampling and genotyping. Between March 2001 and December 2002, patients sustaining blunt trauma were consecutively enrolled. Injuries of the various body regions were classified by the Abbreviated Injury Scale and the Injury Severity Score (ISS) was calculated (15). Inclusion criteria included an initially estimated ISS $ 16, patients age of $16 years and #65 years, a survival of more than 24 h in the intensive care unit (ICU), and primary admittance to our institution within 1 h after injury. Patients were excluded in case of steroid and nonsteroid anti-inflammatory medication, any hormone therapy, and vascular obstruction (such as cardiac coronary disease, renal dysfunction, and diabetes).
Address reprint requests to Frank Hildebrand, MD, Trauma Department, Hannover Medical School, Carl Neuberg Strasse 1, 30625 Hanover, Germany. E-mail:
[email protected]. F.H. was awarded a Young Investigator Travel Award by the American Shock Society to present these results at the 27th Annual Conference on Shock of the American Shock Society, Halifax, Canada, 2004. This work was supported by Hochschulinterne Leistungsfo¨rderung (Hilf) of Hannover Medical School. DOI: 10.1097/01.shk.0000184212.97488.4e Copyright Ó 2005 by the Shock Society
General therapeutic characteristics In all trauma patients, resuscitation was started by an emergency physician once seen. After resuscitation, patients were admitted to the trauma center. At the time of
518
SHOCK DECEMBER 2005
GENETIC PREDISPOSITION
AND
MULTIPLE TRAUMA
519
TABLE 1. Detection methods for different polymorphisms Name of polymorphism IL-6-174 IL-8-251° IL-8-251T TNF-Nco1 IL-1b-Taq1
Primer forward
Primer reverse
Annealing temperature (°C)
Detection method
Reference
TTGTCAAGACATGCCAAAGTG CCACAATTTGGTGAATTATCAAT CCACAATTTGGTGAATTATCAAA CCGTGCTTCGTGCTTTGGACTA GTATATGCTCAGGTGTCCTC
TCAGACATCTCCAGTCCTATA TGCCCCTTCACTCTGTTAAC TGCCCCTTCACTCTGTTAAC AGAGGGGTGGATGCTTGGGTT CATGGAGAATTAGCAAGCTG
57 60 60 54 55
RE/Hsp92II ARMS-PCR ARMS-PCR RE/Nco1 RE/Taq1
Schlu¨ter (9) Hull (26) Hull (26) Mira (31) Pociot (30)
admission, further stabilization of cardiovascular and pulmonary function was performed using mechanical ventilation, placement of a central venous line and an arterial line for monitoring, and i.v. infusion via peripheral venous lines. All patients had a standardized examination, including all x-rays, abdominal ultrasound, and cerebral CT scan, on admission to the hospital and surgical ICU. The trauma protocol foresees that major fractures are stabilized acutely by internal operations or by external fixation. Patients in a critical condition because of another associated injury may undergo laparotomy or craniotomy first and then be submitted to stabilization of their fractures. A patient who is highly unstable during this procedure may undergo external fixation parallel to the abdominal/cranial operation or may be transferred to the ICU, where an external fixateur is placed.
Clinical parameters and outcome evaluation Clinical data, including demographics, source of injury, and operative interventions, as well as the time period of intensive care and mortality, were abstracted from the patients’ chart review. Furthermore, laboratory, hemodynamic, and respiratory parameters were monitored for the length of stay in the ICU. The Glasgow Coma Scale (GCS) was determined daily until a significant change in the GCS could be noted. Diagnosis of acute lung injury, and Adult Respiratory Distress Syndrome (ARDS) was made according to the criteria of the AmericanEuropean Consensus Conference on ARDS (16). Sepsis was defined according to the American College of Chest Physicians and Society of Critical Care Medicine Consensus conference criteria (17).
SIRS SIRS was defined according to the criteria of the American College of Chest Physicians/Society of Critical Care Medicine consensus conference. The diagnosis of SIRS requires that two or more of the criteria are met (17). SIRS severity was classified as follows: no SIRS, meeting none or one of the SIRS criteria; SIRS 2, meeting two criteria; SIRS 3, meeting three criteria; and SIRS 4, meeting four criteria.
Group distribution For analysis of allele frequencies and genotype distribution, trauma patients were separated in two groups according to the severity of posttraumatic SIRS. One group included patients with no SIRS and SIRS 2 (group 2SIRS), and the other group comprised individuals with SIRS 3 and SIRS 4 at 2 consecutive days or at 3 days of the observation period (group +SIRS). Patients were assigned to the +SIRS group as soon as they fulfilled these criteria during the observation period, whereas patients were included in group –SIRS at the end of the observation period. This group distribution was chosen based on the results of a previous study showing the most significant results for patients with a SIRS score of more than 2 (18). Each group was post hoc divided in two subgroups for confirmation of possibly positive findings of subgroup 1 with subgroup 2.
Statistics Parametric data were first observed by analysis of variance and thereafter were subjected to Student t test. The level of statistical significance was considered at P < 0.05. Nonparametric data as genotype distribution or mortality were subjected to the chi-square test or Fisher’s exact test. Data are presented graphically as mean SEM. Odds ratios were calculated using the SPSS package, version 11.5 (SPSS Inc., Chicago, IL).
RESULTS Group distribution according to SIRS severity
Patient demographics and clinical outcome—Of 97 patients, 56 were assigned to group +SIRS and 41 patients were included in group 2SIRS. Mean ISS was comparable in both groups. The mortality rate in group +SIRS was 16.1% and in group 2SIRS, it was 4.9% (P < 0.05; Table 2). Allele frequencies and genotype distribution according to SIRS severity—The allele and genotype distribution of the observed polymorphisms are presented in Tables 3 and 4. Comparison of allele and genotype distribution of the IL-6 promoter polymorphism (2174G/C) between +SIRS and 2SIRS trauma patients showed significant differences (P < 0.001). Association between cytokine genotypes and other posttraumatic complications—In addition to the described significant association between SIRS severity and the IL-6-174G/C polymorphism, no other significant association between a posttraumatic complication (acute lung injury, ARDS, sepsis, or mortality) and a cytokine polymorphism was found.
DISCUSSION Systemic inflammation is supposed to play the decisive role in the development of posttraumatic complications (20). TABLE 2. Demographic data of study population (+SIRS vs. 2SIRS)
DNA isolation and genotyping Once blood for the isolation of DNA was withdrawn into EDTA tubes (1.6 mg EDTA/mL blood, Monovette; Sarstedt, Numbrecht, Germany), each patient’s genomic DNA was extracted by using a commercially available DNA isolation kit (QiAmp blood kit; Qiagen, Hilden, Germany) according to the instruction of the manufacture.
Genotyping Restriction length polymorphisms: IL-1b-Taq1, TNF-Nco1, IL-6-174G/C, and IL-8-251 A/T—The regions containing the polymorphic sites were amplified by PCR. Enzymatic digestion of the products was done with specific restriction endonuclease. After digestion, samples were electrophoresed in agarose gel and stained with ethidium bromide. The agarose concentration was chosen as suggested by Bowtell and Sambrook (19). Bands were visualized under ultraviolet light and were photo documented. Specific conditions for genotyping of the different polymorphisms are described in Table 1.
Patients (n) Sex ratio (m:f) Age (years) ISS GCS Non-survivor (n)/(% of all) Number of operations (n) Mean duration of operations (minutes) ICU-stay (days) Mechanical ventilation (days) Hospital stay (days)
Total study population
1SIRS
2SIRS
97 70:27 34.5 2.7 25.7 1.7 10.5 1.0 11 (12.4%) 1.9 0.2
56 41:15 35.1 3.6 26.4 2.5 10.3 1.4 9 (16.1%) 2.0 0.3
41 29:12 33.9 4.2 24.9 2.3 10.8 1.4 2 (4.9%)* 1.8 0.3
85.7 19.9 15.7 34.3
82.0 23.8 18.9 39.9
90.5 14.4 11.4 27.0
10.9 2.5 2.4 4.2
13.5 3.6 3.5 6.2
18.4 2.8* 2.8* 4.7*
520
SHOCK VOL. 24, NO. 6
HILDEBRAND
ET AL.
TABLE 3. Allele frequencies in trauma patients: +SIRS (score >2) versus 2SIRS (score #2) Subgroup 1 (frequency of variant allele; %)
Allele SNP
Reference Variant +SIRS 2SIRS
IL6-175 IL8-251 TNF-Nco1 IL1b-Taq1
G A G C
C T A T
26.7 40.0 28.3 17.2
50.0 52.5 30.0 20.0
P
Subgroup 2 (frequency of variant allele; %)
Odds Ratio (OR) (95% CI) +SIRS 2SIRS
0.017 0.36 0.31 0.60 1.0 1.08 0.79 0.83
(0.16–0.84) (0.27–1.35) (0.45–2.61) (0.28–2.34)
19.6 50.0 31.3 23.1
P
All patients (frequency of variant allele; %)
OR (95% CI)
+SIRS 2SIRS
64.3
