JOURNAL OF NEUROCHEMISTRY
| 2009 | 109 | 899–910
doi: 10.1111/j.1471-4159.2009.06017.x
*Departamento de Gene´tica y Biologı´a Molecular, Centro de Investigacio´n y de Estudios Avanzados del Instituto Polite´cnico Nacional, Apartado, Me´xico Instituto Nacional de Ciencias Me´dicas y Nutricio´n ‘Salvador Zubira´n’ Vasco de Quiroga, Colonia Seccio´n XVI, Tlalpan, Me´xico àInstitut de Neurocie`nces i Departament de Bioquı´mica i Biologı´a Molecular, Universitat Auto`noma de Barcelona, Bellaterra, Cerdanyola del Valle`s, Barcelona, Spain
Abstract Glutamate (Glu) is the major excitatory transmitter in the vertebrate brain. Ligand-gated and G protein-coupled Glu receptors present in glial cells are presumably involved in neuronal function. Activation of Bergmann glial Glu receptors triggers a membrane to nuclei signaling cascade that regulates gene expression at the transcriptional and translational levels. Sryrelated high-mobility group box (Sox10), a member of the conserved high-mobility group box transcription factor family is expressed in neural crest stem cells and in a subset of neural crest-derived lineages that include glial, but not neuronal cells. To gain insight into the role of Sox10 in Bergmann glial cells, we explored its expression and regulation. We demonstrate herein
that Sox10 is expressed in Bergmann glial cells and that its DNA binding activity, mRNA, and protein levels as well as its transcriptional behavior augments upon the activation of metabotropic Glu receptors. Increase in Sox10–DNA complexes and Sox10 mRNA and protein levels were found upon exposure to Glu. Over-expression of Sox10 leads to transcriptional repression in reporter gene assays and in one of its target genes: the chick kainate binding protein gene. These findings add a new perspective into glial glutamatergic signaling and suggest the participation of Sox10 in cerebellar glutamatergic transactions. Keywords: Bergmann glial cells, glutamate, metabotropic glutamate receptors, signaling, Sox10, transcriptional control. J. Neurochem. (2009) 109, 899–910.
Glutamate (Glu), the main excitatory neurotransmitter in the vertebrate brain, exerts its actions through specific membrane receptors divided into ionotropic (iGluRs) and metabotropic (mGluRs) glutamate receptors. Both types are expressed in glial cells and their stimulation is linked to transcriptional as well as translational control (Verkhratsky and Kirchhoff 2007). Based on sequence similarity, signal transduction mechanisms and pharmacology, mGluRs have been subdivided into three groups. Group I are coupled to the stimulation of phospholipase C and the generation of an intracellular Ca2+ signal, while Groups II and III regulate cAMP levels through the inhibition of adenylate cyclase. Specific mGluRs agonists have been developed: (±)-1aminocyclopentane-trans-1,3-dicarboxylic acid and (R,S)3,5-dihydroxyphenylglycine (DHPG) for Group I; L-(+)-2amino-4-phosphonobutyric acid activates Group II while quisqualic acid acts upon Group III (Coutinho and Knopfel 2002). Both iGluRs and mGluRs are expressed in Bergmann glial cells (BGC) (Lopez et al. 1998; Gallo and
Ghiani 2000). The strategic localization of these cells within the cerebellum, surrounding glutamatergic terminals, suggests their relevance in synaptic plasticity (Iino et al. 2001). Received November 2, 2008; revised manuscript received December 11, 2008; accepted February 23, 2009. Address correspondence and reprint requests to Arturo Ortega, PhD, Departamento de Gene´tica y Biologı´a Molecular Cinvestav-IPN Apartado Postal 14-740, Me´xico DF 07000, Me´xico. E-mail:
[email protected] Abbreviations used: AP-1, activator protein-1; BGC, Bergmann glial cells; CAT, chloramphenicol acetyltransferase; chkbp, chick kainate binding protein gene; CPCCOEt, 7(hydroxyimino)cyclopropa [b]chromen-1a-carboxylate ethyl ester; CPPG, (R,S)-a-cyclopropyl-4-phosphonophenilglycine; DHPG, (R,S)-3,5-dihydroxyphenylglycine; DNQX, 6,7-dinitroquinoxaline-2,3-dione; EMSA, electrophoretic mobility shift assays; Glu, glutamate; iGluR, ionotropic glutamate receptors; KBP, kainate binding protein; mGluR, metabotropic glutamate receptor.PBS, phosphate-buffered saline; Sox, Sry-related high-mobility group box; Sp1, stimulating protein 1; SV40, Simian virus 40; TRE, 12-O-tetradecanoylphorbol 13-acetate response element.
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
899
900 | I. Cruz-Solis et al.
Glutamate receptors participate in differentiation, proliferation, and modulation of gene expression mainly, although not exclusively, through the regulation of inducible transcription factors (Steinhauser and Gallo 1996). Members of the high-mobility group box transcription factor E family include Sry-related high-mobility group box (Sox) 10, SoxP1, Sox8, and Sox9 (Wegner 1999). In mammals, these proteins are expressed in the early neural crest and in mature glial cells like Schwann cells and oligodendrocytes (Kuhlbrodt et al. 1998; Stolt et al. 2002; Rowitch 2004). Sox10 is a transcriptional modulator of protein zero, myelin basic protein, ciliary’s neurotrophic factor, proteolipid protein, Connexin 32, and 47 other genes (Peirano et al. 2000; Bondurand et al. 2001; Stolt et al. 2002; Ito et al. 2006; Schlierf et al. 2006). Accordingly, putative Sox DNA binding sites are present in the promoter region of these and other genes. Interestingly, the gene encoding the chick kainate binding protein (chkbp), a Bergmann glia exclusive protein, harbors Sox binding sites (Aguirre et al. 2000). Two important regulatory characteristics are present in Sox10, first its capacity to bind to a 7 bp consensus DNA element AACAAAG either as a monomer or as a dimer with different functional consequences (Peirano and Wegner 2000; Schlierf et al. 2002) and second, its cooperativity with other transcription factors (Kuhlbrodt et al. 1998; Ghislain and Charnay 2006). Mutations in the Sox10 gene produce hereditary myelin disorders such as Charcot–Marie–Tooth disease and Waardenburg–Hirschsprung syndrome (Potterf et al. 2000; Bondurand et al. 2001; Pingault et al. 2001; Chan et al. 2003). The molecular mechanisms that regulate Sox10 activity are not well established. Sox10 has two typical nuclear localization signals and one nuclear export signal, that allows the nuclei-cytoplasmic shuttling essential for its transactivation properties (Rehberg et al. 2002). Additionally, recent reports demonstrate that Sox10 is modified by sumoylation (Iwamoto et al. 2005; Taylor and Labonne 2005; Girard and Goossens 2006). Therefore, the aim of this work was to establish Sox10 expression and Glu-dependent regulation in BGC. Our results indicate that Sox10 is expressed in cultured chick BGC and that in these cells, down-regulates the transcription of the chkbp gene.
Materials and methods Materials Tissue culture reagents were obtained from GE Healthcare (Carlsbad, CA, USA). Glutamatergic agonists, Glu, DHPG, and the antagonists 6,7-dinitroquinoxaline-2,3-dione (DNQX), 7(hydroxyimino)cyclopropa [b]chromen-1a-carboxylate ethyl ester (CPCCOEt), (R,S)-1-amino-5-phosphonoindan-1-carboxilic acid, and (R,S)-a-cyclopropyl-4-phosphonophenilglycine (CPPG) were purchased from Tocris-Cookson (Ellisville, MO, USA). The enhanced chemiluminescence reagent was obtained from GE Healthcare
(Waukesha, WI, USA). All other chemicals were from SigmaAldrich (St Louis, MO, USA). Cell culture and stimulation protocol Primary cultures of cerebellar BGC were prepared from 14-day-old chicken embryos as described previously (Ortega et al. 1991). Cells were plated in 60 mm diameter plastic culture dishes in Dulbecco’s modified Eagle’s medium (GE Healthcare) containing 10% fetal bovine serum, 2 mM L-glutamine, and 50 mg/mL gentamicin (all from GE Healthcare). Cells were used on the fourth or fifth day in culture. Immunocytochemical and kainate-induced ion fluxes of these primary cultures have shown that the vast majority of the cultured cells are BGC (Ortega et al. 1991). These cultures are not heterogeneous and do not contain oligodendrocyte precursors that would contain Sox10. Prior to any drug exposure, confluent monolayers from cell cultures were incubated for 4 h at 37C, 5%CO2 in 0.5% serum medium, and then treated as indicated. Antagonists were added 30 min before the agonists. Plasmids, transient transfections, and chloramphenicol acetyltransferase assays The reporter plasmid pSoxCAT contains one copy of the Sox10 oligonucleotide: 5¢-CTAGATACACAAAGCCCTCTGTGTAAGA3¢ cloned in front of the early promoter of Simian virus 40 (SV40) and the chloramphenicol acetyltransferase (CAT) reporter gene in the pCAT-Promoter vector (Promega, Madison, WI, USA) at XbaI site (Huerta et al. 2007). The plasmids p435 kbpCAT and p170 kbpCAT contain the entire or the promoter region ()170 to +85) from chick kainate binding protein (KBP) 5¢-non-coding region, cloned in the pCAT-Basic vector (Promega) (Aguirre et al. 2000). To generate the recombinant protein chick Sox10 Xpress-tagged, full-length chicken Sox10 cDNA (GenBank accession number: AF152356) was amplified by RT-PCR using 2 lg total RNA from BGC primary cultures. PCR step, using the Expand High Fidelity PCR system with 3 mM MgCl2 (Roche, Indianapolis, IN, USA) was as follows: after an initial 94C incubation cycle for 2 min, reactions were amplified for 35 cycles at 95C for 1 min, 60C for 1 min, and 72C for 3 min. The reactions were then incubated at 72C for 10 min. Primers used to amplify the 1386 bp fragment from chick Sox10 gene were: Sox10CS, 5¢-ATGGCTGATGACCAAGATCTG3¢ and Sox10CAS, 5¢-GCTGAGAGAGGTCTGGTATC-3¢. PCR amplification products were separated on a 1% agarose gel and visualized by ethidium bromide staining. The 1386 bp full-length chick Sox10 cDNA was introduced into the pcR2.1-TOPO vector at EcoRI site (GE Healthcare); XL1-Blue competent cells were transformed with the cloning mix and the colonies were selected by color (X-gal/Isopropyl Beta-D-1-thiogalactopyranoside; GE Healthcare) and sequentially introduced into pcDNA4/HisMaxB at BamHI and EcoRV sites (GE Healthcare) using the In-Fusion Dry-Down PCR Cloning Kit (Clontech Laboratories, Inc. Mountain View, CA, USA). For detection of the Xpress-tagged recombinant chSox10, BGC were grown on eight well Lab-Tek Chamber Slides (Nalge Nunc International, Rochester, NY, USA); we used the anti-Xpressantibody (GE Healthcare) and anti-mouse FITC (Zymed Laboratories, San Francisco, CA, USA). In this case, nuclei were counterstained with 4¢,6-diamidine-2¢-phenylindole dihydrochloride (Sigma-Aldrich) for 5 min at 20C. Slips were mounted with Shandon Immu-mount (Cat. no. 9990402; Thermo-Scientific, Pittsburg, PA,
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
Glutamate-dependent Sox10 transcriptional repression
USA). All preparations were examined under a fluorescence microscopy (Zeiss Axioscope 40) and analyzed with the AXIOVISION software (Carl Zeiss, Inc., Thornwood, NY, USA) (data not shown). The reporter plasmid 12-O-tetradecanoylphorbol 13-acetate response element (TRE)-CAT was kindly donated by Michael Gerdes from Dr Yuspa laboratory at NIH (Bethesda, MD, USA). TRE-CAT contains CAT gene under the control of the herpes virus thymidine kinase promoter and five SV40 activator protein-1 (AP-1) sites cloned upstream (Rutberg et al. 1999). pAmino-zona occludens 2/HisMax was reported before (Jaramillo et al. 2004). Transient transfection assays were performed in 80% confluent BGC cultures using calcium phosphate protocol with indicated quantities of verified (by restriction and complete automated sequence analyses) and purified plasmids (plasmid purification kit; Qiagen Inc., Valencia, CA, USA). Under such conditions, the transfection efficacy was close to 50% determined by a transfection control (b-gal). When specified, the empty vector was co-transfected in the same concentrations. BGC were harvested 48 h after transfection and cells were processed for obtaining total extracts for CAT assays. All treatments were performed 16 h post-transfection for the indicated time periods and concentrations. Cells were used 12–16 h after treatment. Protein lysates for CAT assays were obtained as follows: cells were harvested in 40 mM Tris–HCl, pH 8.0, 1 mM EDTA, and 15 mM NaCl buffer, lysed with five freeze– thaw cycles in 0.25 M Tris–HCl, pH 8.0, and centrifuged at 12 000 g for 3 min. Equal amounts of protein lysates (80 lg) were incubated with 0.25 lCi of [14C]-chloramphenicol (50 mCi/ mMol; GE Healthcare) and 0.8 mM acetyl-CoA (Sigma-Aldrich) at 37C. Acetylated forms were separated by TLC and quantified using a Typhoon Optical Scanner (Molecular Dynamics, Sunnyvale, CA, USA). CAT activities were expressed as the acetylated fraction corrected for the activity in the pCAT-Basic vector (Promega) and are expressed as relative activities to non-treated control cell lysates. Electrophoretic mobility shift assays Nuclear extracts were prepared as described previously (LopezBayghen et al. 1996). Protein concentration was measured by the Bradford (1976) method. Nuclear extracts (15 lg) from cells were incubated on ice with 0.5 lg of poly[dG-dC] as a non-specific competitor (GE Healthcare) and 2 ng of [32P]-end labeled double stranded oligonucleotides: Sox 5¢-GATGTGGGGAGAACAAAGGCGCG-3¢; AP-1 5¢-CTAGTATAATATGACTAAGCTGTG-3¢. The reaction mixtures were incubated for 10 min on ice, electrophoresed through 6% polyacrylamide gels using a low ionic strength 0.5x Tris-Borate-EDTA (TBE) buffer. The gels were dried and exposed to autoradiographic film (JXA2; JUAMA, Distrito Federal, Mexico). For competition assays, the reaction mixtures were pre-incubated with the non-labeled probes for 10 min (before adding labeled DNA): SoxMut 5¢ GATGTGGGGAGGGCAAAGGCGCG 3¢; Stimulating protein 1 (Sp1) 5¢-CTAGATTCGATCGGGGCGGGGCGA-3¢. For super-shift assays, anti-Sox 10 antibody (rabbit polyclonal; Cat. no. ab25978; Abcam, Cambridge, UK) was added before the labeled probe and incubated 16 h, 4C.
| 901
Immunoprecipitation assays Confluent BGC monolayers were incubated for 2 h in 0.5% serum medium and then treated with 1 mM Glu for 16 h; cells were harvested in Tris–Dulbecco–glycerol 30% then frozen ()70C) until nuclear extracts were prepared. Approximately 100 lg of nuclear extracts were mixed with radioimmunoprecipitation assay buffer (RIPA) to which 1 lg of goat polyclonal anti-Sox10 antibody (N-20, sc-17342; Santa Cruz Biotechnology, Santa Cruz, CA, USA) was added and the mix was incubated overnight on shaking at 4C. Then, 20 lL agarose A protein (GE Healthcare) were added to the mix and incubated for 3 h at 4C on shaking. The immunoprecipitation mix was centrifuged at 12 000 g for 1 min at 4C. The pellet was washed with 500 lL of radioimmunoprecipitation assay buffer (RIPA) buffer once; pellet and supernatant were frozen at )70C until electrophoretic mobility shift assays (EMSA) assays were performed. Immunohistochemistry Bergmann glial cells were grown on eight well Lab-Tek Chamber Slides (Nalge Nunc International) in the same culture conditions as described under Cell culture section. Cells were fixed by exposure to methanol/acetone at )20C for 5 min, washed twice with phosphate-buffered saline (PBS). Tissue sections were obtained from paraffin-embedded chicken brain and cerebellum in charged slides (Biocare Medical, Concord, CA, USA) and hydrated using decreasing concentration series of xylol and ethanol to Ventana tris based buffer (APK) (Ventana Medical Systems, Tucson, AR, USA). Heat-induced antigen retrieval was carried out in the slides with EDTA solution 10 mM, pH 9, for 30 min at maximum pressure. Non-specific antibody reactions were blocked by placing the sections and cells in 3% normal horse serum for 1 h at 20C, prior to incubation with primary antibodies. The tissue was exposed for 10 min to 0.5% hydrogen peroxide to eliminate endogenous peroxidase activity. Sections were then incubated with primary antibodies for 10 min with Peroxidase Blocking Reagent according to manufacturer instructions (Dako, Carpinteria, CA, USA) and incubated in the presence of Sox10 rabbit polyclonal-Chromatin Immunoprecipitation (ChIP) grade antibody (does not cross react with Sox8 and Sox9; dilution 1 : 75, Cat. no. ab25978; Abcam) or anti-KBP 1 : 400 (rabbit polyclonal antibody) for 60 min at 20C. Then, slides were washed with Ventura tris based buffer (APK), incubated in the presence of secondary biootin-free detection system 4 (MACH-4) mouse probe (Biocare Medical) for 15 min at 20C; following by incubation in biootin-free detection system 4 (MACH-4) horseradish peroxidase (HRP)-polymer (Biocare Medical) for 15 min at 20C. Staining reaction was completed by a peroxidase reaction to produce a brown color with 3, 3¢diaminobenzidine (Dako) and 0.04% H2O2 (Dako) for 4 min at 20C. Samples were counterstained with hematoxylin (Ventana Medical Systems), dehydrated, and mounted with entellan microscope resin (Merck, Darmstadt, Germany). Slides were observed with a Zeiss Axioscope 40 microscope and images obtained using the AXIOVISION software (Carl Zeiss, Inc.). Human kidney sections were used as positive control for Sox10 (data not shown) and chicken cerebellum sections for KBP. Negative controls were obtained when no primary antibodies were added (Biocare Medical).
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
902 | I. Cruz-Solis et al.
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and western blots Whole tissue extracts were obtained as follows: brain or cerebellum were extracted from an adult rat and placed on 0.5% Dulbecco’s modified Eagle’s medium, frozen on liquid nitrogen, grinded in a mortar, and then harvested with PBS (10 mM K2HPO4/KH2PO4 and 150 mM NaCl, pH 7.4)–phenylmethylsulfonyl fluoride 1 mM (Sigma-Aldrich). Obtained cells were lysed with 50 mM Tris–HCl, pH 7.5, with protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride, 1 mg/mL aprotinin, and 1 mg/mL leupeptin; Sigma-Aldrich) and concentration was measured by the Bradford (1976) method. Equal amounts of nuclear protein extracts or whole extracts (20 lg per lane for KBP and 100 lg per lane for Sox10) were denatured in Laemmli’s sample buffer and resolved through 10% sodium dodecyl sulfate–polyacrylamide gels and electroblotted to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). Blots were stained with Ponceau S (Sigma-Aldrich) to confirm equal protein loading. Membranes were soaked in PBS to remove the Ponceau S and blocked in PBS containing 5% dried skimmed milk and 0.1% Tween 20. The membranes were incubated overnight at 4C with anti-Sox10, anti-KBP, or anti-actin (kindly donated by Dr Manuel Herna´ndez, Cinvestav, Mexico) diluted in 5% dried skimmed milk and 0.1% Tween 20 (Sigma-Aldrich) in Tris-buffered saline, followed by horseradish peroxidase linked antigoat (Sox10), anti-rabbit (Sox10 and KBP), or anti-mouse antibody (for actin, 1 : 500) obtained from Zymed Laboratories for 2 h. Bands in the immunoblots were detected using an enhanced chemiluminescence western blot detection kit (GE Healthcare). RT-PCR assays Total RNA was isolated from confluent BGC cultures treated with glutamatergic ligands. Total RNA was extracted from cells using the Trizol method (GE Healthcare) and treated with Dnase I (10 U/lL) for 30 min at 37C (Roche); 1 lg of total RNA was used in each assay. RT-PCR reactions were performed using the reverse transcriptase Improm-II (Promega) and 0.1 lg of oligodT as primer (Sigma-Aldrich), 10 mM of dNTPs – dATP, dGTP, dCTP, and dTTP (GE Healthcare) in a final volume of 20 lL with nuclease-free water (Promega). The RT step was performed at 25C for 5 min, 37C for 60 min, and 70C for 15 min. Amplification conditions with Ready Mix Taq PCR Reaction Mix (Sigma-Aldrich) with 2.5 mM MgCl2 (final concentration) for Sox10 were: after an initial 94C incubation cycle for 2 min, amplified for 30 cycles at 95C for 1 min, 70C for 1 min, and 72C for 1 : 30 min. The reactions were then incubated at 72C for 10 min. PCR amplification products were separated on a 2% agarose gel and visualized by ethidium bromide staining. Primers used to amplify the chicken Sox10 gene were the following: Sox10S, 5¢-CACAGGCATCCTGGGGAAGGGTCA-3¢ and SoxAS, 5¢-GGCGCCGGCGACCGATACCG-3¢ and for chkbp amplification, kbp sense: 5¢-GCGAATTCGTGGGAGATGGGAAGTATGGC-3¢ and kbp anti-sense: 5¢-GCGGTACCTATGGTGAAGAGCCACCA-3¢. As a control, we used the following specific primers to the chicken ribosomal subunit S17: primer S17S 5¢-CCGCTGGATGCGCTTCATCAG-3¢ and primer S17AS, 5¢-ATGTGGGCAGACCCGTTG-3¢. Amplified fragments were automatically sequenced to corroborate identity. Quantitative data were obtained by scanning the bands, the optical densities of Sox10 or KBP were normalized to the S17 signal.
In silico promoter analysis Chick KBP promoter sequence(GenBank accession number: AF208519) was analyzed searching for putative binding sites for Sox family of transcription factors using three different searching software packs: MATINSPECTOR 2.2 (Cartharius et al. 2005); MATCH1.0 PUBLIC (http://www.gene-regulation.com/cgi-bin/pub/programs/ match/bin/match.cgi); and CONSITE (http://www.asp.ii.uib.no:8090/ cgi-bin/CONSITE/consite). Comparison and site mapping were performed with MULAN (Ovcharenko et al. 2005) and with Vector NTI Suite 8 (InforMax Inc.; GE Healthcare, Waukesha, WI, USA). Statistical analysis Data are expressed as the mean (average) was performed to determine whether differences between conditions. When significance (at the 0.05 level), post hoc test analysis was used to determine significantly different from each other Software (San Diego, CA, USA).
± SE. A one-way ANOVA there were significant this analysis indicated Student–Newman–Keuls which conditions were with PRISM, GraphPad
Results Sox10 is expressed in Bergmann glial cells The in silico prediction of Sox DNA binding sites within the promoter region of chkbp, the establishment of Sox9 as a neural stem cell marker for radial BGC together with the fact that Sox10 is present in neural crest of chicken embryos and cerebellum (Cheng et al. 2000; Kordes et al. 2005) prompted us to explore Sox10 expression in cultured chick BGC. Western blot assays performed with nuclear extracts prepared from the cultured cells displayed the characteristic Sox10 56 kDa band (Fig. 1a) (Kuhlbrodt et al. 1998; Cheng et al. 2000). Note that the same pattern of immunoreactivity is detected with two different anti-Sox10 antibodies, clearly supporting the specificity of our finding. To establish the subcellular localization of Sox10 in BGC, immunohistochemical experiments were carried out using18day-old chick embryonic tissue and BGC primary cultures. As depicted in Fig. 1b, Sox10 expression is prominent in the cerebellar molecular layer in clear analogy to KBP immunoreactivity, which is expressed exclusively in BGC in the chick cerebellum (Somogyi et al. 1990). These results demonstrate that Sox10 is expressed in BGC in situ. Note that Sox10 is present in nucleus and cytoplasm of cultured BGC (Fig. 1c). As internal control of cultured BGC identity, staining with anti-KBP antibodies was performed (Fig. 1c) (Gregor et al. 1988; Somogyi et al. 1990). Glutamate increases Sox10-DNA binding It is now evident that Glu regulates the localization and DNA binding activity of various transcription factors through a complex signal transduction network in neurons and glial cells (Lerea 1997; Lopez-Bayghen et al. 2007). As a first approach to characterize Sox DNA binding activity, nuclear extracts
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
Glutamate-dependent Sox10 transcriptional repression
(a)
(b)
(c)
Fig. 1 Detecting Sox10 in chick cerebellum and primary cultures of Bergmann glial cells (BGC). (a) Western blot assays were performed with two different antibodies, goat polyclonal anti-Sox10 (Cat. no. sc17342; Santa Cruz Biotechnology) and rabbit polyclonal anti-Sox (labeled as +; Cat. no. ab25978; Abcam) using total or nuclear extracts from the indicated sources. (b) Sox10 was detected by indirect immunohistochemistry on paraffin-embedded sections (8 lm) of cerebellum slices from 18-day-old chicken embryos (anti-Sox10, dilution 1 : 75; Abcam). The molecular layer of cerebellum was located using anti-KBP (dilution 1 : 400) as a specific marker for BGC (> 80% of cells in molecular layer). (c) Primary cultures of 14-day-old chicken embryos were seeded on coverslips, fixed with acetone after 4 days, and processed for immunohistochemistry. The rabbit polyclonal antiSox10 (dilution 1 : 75; Abcam) was used as primary antibody. KBP was detected using a rabbit polyclonal anti-KBP (dilution 1 : 400).
from mice and chick cerebellum were prepared and used in EMSA with a labeled Sox consensus sequence. As shown in Fig. 2a, two protein–DNA complexes can be clearly defined and monitored. Once the EMSA conditions were defined, confluent BGC were exposed to 1 mM Glu for 2 h and nuclear extracts were prepared. An increase in both Sox complexes was found. As expected, Glu does not modify significantly Sp1–DNA binding activity (Fig. 2b). The described results strongly suggest that proteins from Sox family, present in nuclear extracts prepared from chick BGC, bind to DNA and point out that the Sox/DNA binding levels are increased as a response to Glu stimulation. The specificity of this interaction was challenged with three different approaches. First, competition assays were performed with a 100-fold excess of unlabeled oligonucleotides. Only the Sox oligonucleotide competed effectively the retarded complexes unlike the mutated version of Sox (SoxMut), AP-1, or Sp1 (Fig. 2c).
| 903
Second, super-shift experiments were performed with antiSox10 antibodies and as shown in Fig. 2e, a super-shifted complex was clearly detected. Third, Sox10 immunoprecipitation was used to identify which of the two protein/DNA complexes represents Sox10. Nuclear extracts from Glutreated cells were incubated with anti-Sox 10 anti-sera followed by protein A–Agarose. The precipitated material was added to the Sox labeled probe; under these conditions, only the lower complex (SCx2) appears in the autoradiogram, suggesting that this complex corresponds to Sox 10 (Fig. 2d). Note that the Glu-induced AP-1 complex (Aguirre et al. 2000) was not precipitated with anti-Sox10 antibodies. Taken together, these results established the specificity of our EMSA. Pharmacological characterization of the glutamate effect Once we could demonstrate that Glu increases Sox10-DNA binding activity in BGC, we set to characterize this effect. To this end, time and dose dependency curves were obtained. As clearly shown in Fig. 3a, both Sox complexes increase as a function of the time upon Glu exposure. Note the differential kinetics of appearance of the complexes; while Sox10 is evident after a 5 min treatment, it takes almost 15 min for SCx1 to appear. The maximal response for both complexes is obtained after a 30 min of Glu exposure. Thereafter, a 30 min treatment was routinely used. Increasing Glu concentrations elicited a progressive augmentation of the Sox/ DNA complexes. The calculated EC50 values obtained after densitometric analysis of three independent experiments were 0.351 lM forSCx1while an approximated EC50 of 0.870 lM for the Sox10 complex (Fig. 3b). Taking into consideration that these values fall in the range of mGluRs (Conn and Pin 1997) and that BGC express mGluR1 and mGluR5 (Lopez et al. 1998), we decided to evaluate the effect on the Group I metabotropic agonist DHPG. The results are shown in Fig. 4a, 30 min exposure to 50 lM DHPG mimics the Glu effect. As expected, the Group I specific antagonist, CPCCOEt at a10 lM concentration blocked the Glu effect (Fig. 4b). In contrast, the Groups II and III antagonists (R,S)-1-amino-5-phosphonoindan-1-carboxilic acid (100 lM) or CPPG (300 lM) did not reduce significantly the Glu response (Fig. 4c). To rule out the involvement of the a-amino-3-hydroxy-5methylisoxazole-4-propionate subtype of iGluRs in Sox10 increased binding to DNA, BGC primary cultures were pretreated with 50 lM DNQX. The Glu response was not affect by DNQX. Moreover, when the stimulation protocol was carried out in Ca2+-free medium, Glu was still capable to induce Sox10-DNA binding (Fig. 4d). These results support the conclusion that the Glu effect is mediated through Group I mGluRs. Glutamate regulates Sox10 mRNA and protein levels A plausible mechanism for the described increase in Sox10DNA binding activity could be a Glu-mediated increase in
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
No
SCx1
* SCx2
o ab ti-S S An PI
SN
BGC
0 x1
SN
(-)
(e) IP
FR EE
Competitor
(d)
So x So xM AP ut -1 Sp 1
(c) N/ S G lu
(b)
Cerebellum chick mouse
N/ S G lu
(a)
C er eb el lu m
904 | I. Cruz-Solis et al.
AP-1cx
SS Sox10
SCx1
SCx2
Sox Sox
Sox
Sp1
Sox AP- 1
Sox
Fig. 2 Sox10 binding to DNA is mediated by Glu in chicken BGC. (a) EMSA performed using a-32P-labeled oligonucleotide for Sox family, which was probed with 15 lg of nuclear extracts obtained from 14day-old chick embryo cerebellum or from 4-day-old mouse cerebellum. (b) EMSA performed with nuclear extracts from BGC primary culture; treatment with 1 mM Glu was performed for 2 h at 37C. N/S, non-stimulated BGC; a-32P-labeledoligonucleotide for Sp1 was tested with the same nuclear extracts used to detect Sox proteins (Sox). (c) EMSA and competition assays were performed using oligonucleotide for Sox proteins, 15 lg of BGC nuclear extracts and a 100-fold ex-
cess of indicated non-labeled oligonucleotides; Free, probe alone. We also noticed an unspecific complex, denoted by a star (q), it appeared in some nuclear extract preparations (25%). (d) Super-shift assay, SS, super-shifted complex using the anti-Sox10 antibody from Abcam. (e) BGC nuclear extracts were immunoprecipitated (IP) with goat polyclonal anti-Sox10 (Santa Cruz Biotechnology) to deplete Sox10 from extracts. The supernatants (SN) were also tested with the consensus labeled oligonucleotide for AP-1 as indicated. Cerebellum stands for nuclear extracts obtained from 14-day-old chick cerebellum.
1 mM Glu
(a)
in
in
/S
N
5
m
10
m
in
in
15
m
30
m
0 12
m
/S
/S
N
N
SCx1
Sox10
Sox10
*
700
SCx1 Sox10
*
* *
SCx1 Sox10
1 0.
µM 1
µM
10
µM
0
µM
10
0
µM
0 10
EC50 = 0.351 µM EC50 = 0.870 µM
600
* *
% Control
O. D. (arbitrary units)
SCx1
180 160 140 120 100 80 60 40 20 0
Glu 30 min
(b) in
500 400 300 200 100
N/S
5
10
15
30
60
120 min
0 –8
–7
–6 –5 [glu]
–4
–3
Fig. 3 Sox10 binding to DNA is regulated through GluRs. (a) BGC primary cultures were stimulated with 1 mM Glu for different times and 15 lg of pre-treated or non-stimulated (N/S) nuclear extracts were used for EMSA. The complexes were quantified by densitometry and data plotted in the graph below. Mean ± SE are indicated for three independent experiments. (b) BGC primary cultures were treated with increasing Glu concentrations for 30 min and
nuclear extracts tested by EMSA. Sox10/SCx2 and SCx1 complex’s levels were quantified by densitometry and data expressed as percentage of complexes obtained with nuclear extracts from nonstimulated cells (control values) ± SE. EC50 values were determined using non-linear regression with GRAPHPAD PRISM 5. Results are the mean of three independent experiments;*p < 0.001, ANOVA compared with N/S.
Sox10 levels. To this end, a semi-quantitative RT-PCR strategy was used to measure Sox10 mRNA levels under Glu stimulation. Confluent BGC cultures were treated with 1 mM Glu for 30 min and returned to normal medium. The cells were harvested 16 h later and total RNA extracted. With
specific Sox10 primers, a 330 bp fragment was amplified. A 30 min Glu treatment augmented significantly Sox10 mRNA levels. Ribosomal S17 mRNA levels from the same samples were determined as internal control. In line with the increase in Sox10 DNA binding, this mRNA increase is mediated
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
| 905
C
C
P
P
lu G
N /S
lu
D H P
G
N /S
SCx1
SCx1
SCx2
*
*
*
*
*
(d)
SCx2
*
G + P
C lu
through Group I mGluRs as DHPG reproduces the Glu effect, whereas CPCCOEt antagonizes it (Fig. 5a). The Sox10 protein levels were also measured in control and Glutreated cultures. Similarly, a Glu-dependent increase in Sox10 is evident (Fig. 5b). These results suggest that Sox10 is under Glu-dependent transcriptional control. Sox10 is a transcriptional repressor in BGC At this stage, it became imperative to investigate if the Gludependent augmentation in Sox10 mRNA and protein levels together with the increase in Sox10 DNA binding activity had an effect in transcriptional activity. For this purpose, we cloned the Sox consensus sequence into the XbaI site in pCAT-Promoter plasmid. In such construct, the transcrip-
*
*
*
*
% Control
% Control
180 160 140 120 100 80 60 40 20 0
200
TA D
E
E
TA
TA
D
G
*
*
250
*
/G
/G SCx2
E
N SCx1
SCx2
lu
/S
Q
X
/G X
N D
Q D
N
lu G
/S N SCx1
*
*
(f)
lu
(e)
*
l TA u
0
*
E
100
160 140 120 100 80 60 40 20 0
G
% Control
150
50
SCx1 SCx2
P
P C
P
lu G
*
G
200
% Control
/S SCx2
*
*
250
SCx1 SCx2
N SCx1
SCx1
Fig. 4 Sox10 DNA binding activity augments after mGluRs occupancy. EMSAs performed with BGC nuclear extracts (15 lg) obtained from (a) cells treated for 30 min with Glu (1 mM) or (R,S)-3,5-dihydroxyphenylglycine (DHPG; 100 lM). In the following panels, BGC were previously treated with 10 lM CPCCOEt in (b); 100 lM (R,S)-1-amino-5-phosphonoindan1-carboxilic acid (APICA) in (c); 300 lM CPPG in (d); 50 mM DNQX in (e); 5 mM EDTA or 5 mM EGTA in (f); each inhibitor/ chelator was applied for 30 min alone or before the stimuli with Glu (1 mM, 30 min); N/S, non-stimulated BGC. The analysis by densitometry is depicted in the graphics below each gel shift; *p < 0.05, ANOVA compared with N/S.
G
A A P IC A
IC A
P
lu G
N /S
+
G lu
(c)
200 180 160 140 120 100 80 60 40 20 0
G lu
*
200 180 160 140 120 100 80 60 40 20 0
% Control
% Control
SCx2
SCx1 SCx2
C
(b)
G
(a)
C O C Et C O E t+
G
lu
Glutamate-dependent Sox10 transcriptional repression
*
* *
150 100 50 0
tional activity of the SV40 early promoter is under the influence of Sox10 (pSoxCAT) (Fig. 6a). An over-expression strategy was then undertaken to explore the Sox10 effect in transcriptional control. The 1386 bp full-length chick Sox10 cDNA was introduced into pcDNA4/HisMaxB, and the resulting plasmid named pchSox10/HisMax transfected into BGC. The increase in Sox10 protein led to a pronounced decrease in the reporter activity. Note that expression of an unrelated protein, the amino terminal of zona occludens 2, does not reduce the transcriptional activity. Next, we determined the activity of pSoxCAT in cells treated with Glu and its analogs. Glu exposure results in an important reduction of pSoxCAT transcriptional activity (Fig. 6b). This effect is reproduced by DHPG and sensitive to CPCCOEt,
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
906 | I. Cruz-Solis et al.
O Et C O Et
C
PC C
PC C
H D
N
(a)
G lu
/S
PG
+
G lu
region revealed the presence of multiple binding sites for factors belonging to the Sox family (Fig. 7a). With this in mind, we decided to over-express Sox10 in BGC and assay its effects over the activated chkbp promoter activity (under Glu stimuli). The results are shown in Fig. 7b. A sharp decrease in promoter activity was detected. A closer look was obtained by testing the activity p170 kbpCAT construct under Sox10 over-expression and Glu environment. No effect was noticed, pointing out that the Sox sites, present in the region between nucleotides )435 and )250 are responsive to Sox10. Wheatear the three predicted sites (Fig. 7a) are compulsory for the Glu effect or only one of them is sufficient is not known at this moment and is beyond the scope of this communication. In any event, as one could expect, a decrease in KBP mRNA and protein levels was also present in the Sox10 over-expressing cells (Fig. 7c and d).
330 bp
Sox10
129 bp
S17
% control
300
*
*
200 100 0
um
l
l be
PG H D
lu G
/S
e er
N
(b)
tc Ra
PG m lu G DH ellu + + eb Et Et Et er O O O c CC CC PCC hick CP CP C C
56 kDa
Sox10
44 kDa
Actin
Fig. 5 Sox10 mRNA and protein levels increase through mGluRs. RTPCR performed with BGC treated as in Fig. 4 and 7 lM CPCCOEt Sox10 (330 bp) and S17 (129 bp) amplified fragments were analyzed by densitometry. Data are plotted in graph below; *p < 0.05, ANOVA compared with N/S. (b) Whole cell lysates form control and treated cells were subject to western blot analysis with anti-Sox10 antibody from Abcam.
but not to the Group III antagonist CPPG. Note that a-amino3-hydroxy-5-methylisoxazole-4-propionate is ineffective in regulating pSoxCAT transcription. To rule out an unspecific effect, the transcriptional activity of a 12-O-tetradecanoylphorbol-13-acetate responsive promoter, pTRE-CAT, was determined in pchSox10/HisMax transfected BGC. Maximal recombinant Sox10 expression did not affect pTRE-CAT promoter activity (Fig. 6d). Moreover, the sole presence of the Sox10 consensus sequence reduces the activity of the pCAT-Promoter (Fig. 6e). Sox10 regulates chkbp promoter activity and KBP levels Among Glu-regulated genes in BGC, a fine-tuning effect in transcriptional activity that includes the return to basal activities is often present. Specifically, in terms of the transcriptional regulation of the chkbp gene, Glu elicits a Janus-like effect. An increase in transcription mediated through an AP-1 site precedes an octamer binding factor 2 mediated down-regulation of the promoter activity (Mendez et al. 2004). An in silico analysis of the chkbp promoter
Discussion Neuronal Glu-dependent gene expression regulation is involved in synaptic plasticity, at the transcriptional (Zhu et al. 2004; Wang et al. 2007) and translational levels (Ronesi and Huber 2008). Glial/neuronal interactions are fundamental for the proper function of glutamatergic synapses, at least in two aspects: the Glu/glutamine shuttle, needed for the neurotransmitter turnover (Bak et al. 2006) and the energetic coupling via the astrocyte/neuronal lactate shuttle (Pellerin et al. 2007). This interaction indicates that glial cells sense synaptic activity, concept that has been elegantly described for cerebellar BGC (for a review, see Bellamy 2007). Signaling through BGC has also been linked to differential gene expression (Lopez-Bayghen et al. 2007), therefore the dissection of molecular mechanisms triggered by Glu in these cells is important for an advance in our understanding of the role of glial cells in synaptic function. In this context, we described here the expression and Gludependent regulation of Sox10. Sox genes encode an important family of transcription factors that have been divided into subfamilies based on the sequence identity of the DNA-binding high-mobility group domain (Wegner 1999). In vertebrates, the SoxE family includes Sox8, Sox9, and Sox10, all sharing a characteristic C-terminal transcriptional activation domain (Kelsh 2006). Sox10 expression is highly conserved and has been detected during chick cerebellar development (Kordes et al. 2005). Although, Sox 9 expression has been found in BGC (Pompolo and Harley 2001; Sottile et al. 2006), we were able to identify Sox10 in these cells both in situ and in cultured cells. One could argue that the antibodies used in our experiments cross react with Sox9 and therefore question our findings. This would be an unlikely interpretation as in the one hand, we used two different commercially available specific antibodies, and with both identified Sox10 (Fig. 1). But more important is that when we over-expressed Sox10
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
Glutamate-dependent Sox10 transcriptional repression
(a)
Sox10
SV40 promoter
CAT
| 907
pSoxCAT
CTAGATACACAAAGCCCTCTGTGTAAGA
XbaI
XbaI
(b)
(c) 140
*** ***
120
120 100
% Control
% Control
100 80 60
80 60
***
40 40
***
***
20 20
pTRE-CAT
(d)
A M A
P C C
P
G
G
t +
C
C
C
P
O E
t
+ P
G
+
G LU
t
H
P
O E
G
O E C P
3.0 µg
C
(–)
H
(–)
D
(–)
G LU
0.35 0.75
C
(–) µg
(–)
C
(–) 3.0
P
(–)
(–) µg
(–) 1.5
C
(–)
(–)
C
pAmino-ZO-2/HisMax (–)
(–)
C
(–)
P
3.0
(–)
C
1.5
D
N
HisMaxB (–) pchSox10/HisMax (–)
G LU
/S
0 0
(e) CAT
pSoxCAT Sox10
SV40 Promoter
*
CAT
100
% Control
CTAGATACACAAAGCCCTCTGTGTAAGA XbaI
80
XbaI
pCAT-Promoter
60
SV40 Promoter
40
CAT
0 20 40 60 80 100
20
% Control
0 HisMaxB pchSox10/HisMax
3.0
(–) µg
(–)
3.0 µg
Fig. 6 Sox10 represses transcriptional activity depending on mGluRs activity (a) Map for construct pSoxCAT; (b) BGC were co-transfected in with indicated amounts of pchSox10/HisMax, pcDNA4/HisMaxB, or pAmino-ZO-2/HisMax; activities are expressed relative to control cells transfected with the reporter plasmid alone (pSoxCAT). In all transfection assays, data plotted are the mean ± SE from at least six independent experiments; ***p < 0.001 versus transfected with the same DNA amount of empty vector by ANOVA. (c) pSoxCAT construct was transfected in BGC (6 lg); 16 h after transfection, cells were treated with Glu (1 mM) or with its metabotropic agonist, DHPG (100 lM); 10 lM CPCCOEt or 300 lM CPPG were separately applied for 30 min
alone or before the stimuli with 1 mM Glu; a-amino-3-hydroxy-5methylisoxazole-4-propionate was applied at 500 lM (30 min). N/S, non-stimulated BGC; ***p < 0.001 versus untreated by ANOVA. (d) pTRE-CAT (1 lg) was co-transfected with 3 lg pchSox10/HisMax, activities are related to BGC co-transfected with empty HisMaxB vector. pSoxCAT and the parenting vector pCAT-Promoter (6 lg) were transfected in BGC; activities are expressed related to pCAT-Promoter; *p < 0.05 by ANOVA. pchSox10/HisMax or parenting pcDNA4/HisMaxB plasmids (6 lg) were transfected in BGC; expression of Xpress-tagged recombinant Sox10 protein (DLYDDDDK, Xpress epitope added) was detected using anti-Xpress antibody (data not shown).
we obtained the same transcriptional repression as when we activated mGluRs with DHPG (Fig. 6).These data strengthen the notion that Sox10 is involved in glial glutamatergic signaling. Molecular mechanisms that regulate Sox10 DNA binding start to be understood. In this sense, some studies have recently proved that Sox10 can be modified at protein level by sumoylation. In addition, it has also been reported that nuclear localization signals or nuclear export signals may regulate the Sox10 nuclear availability in glial cells
(Rehberg et al. 2002; Taylor and Labonne 2005). In this context, we were able to demonstrate that Glu increases the Sox10 binding to DNA in BGC (Fig. 2e). Whether this increase in DNA binding results from a Glu-dependent Sox10 nuclear translocation, an increased expression or both, is not completely clear at this moment but the fact that Glu exposure augments Sox10 mRNA and protein levels (Fig. 5) favors the latter interpretation, because one could expect that Sox10 synthesis takes place in the cytoplasm.
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
908 | I. Cruz-Solis et al.
(a) –435 Sox
AP-1 Sox
–250
Sox Oct–2
–170
Sox
–1/+1
Sox
p435KBPCAT
(b) –435
–250
–170
p170KBPCAT –1/+1 +88
TATA –30
CAT
–1/+1 –170 + 88 CAT TATA –30
Oct-2 Silencer AP-1 GluRE
100
80
80
60
60
% Control
100
***
40
40 20
20
0
0 HisMaxB
(–)
1.5
(–)
(–) µg
1.5
(–) µg
(–)
1.5 µg
pchSox10/HisMax
(–)
(–)
1.5
(–) µg
pAmino–ZO–2/HisMax
(–)
(–)
(–)
1.5 µg
10
B
(c)
ax
sM
Hi
x So
(d)
h
pc
469 bp
KBP
129 bp
S17
0 x1
B ax
sM
Hi
pc
o hS
49 kDa
KBP
44 kDa
Actin
The pharmacological characterization of the Glu effect demonstrates the involvement of Group I mGluRs (Fig. 3). Note that the EC50 values obtained after densitometry of the retarded bands are by no means, indicative of the actual affinity of BGC mGluRs; these values only demonstrate a dose–response effect, characteristic of a receptor-mediated effect. Most possibly, mGluR1 is the receptor involved as it
Fig. 7 Sox10 represses the chkbp gene. (a) In silico analysis of the chkbp promoter performed as indicated in Material and methods. Previously characterized AP-1 and octamer binding factor 2 (Oct-2) sites are denoted together with the transcription start site (broken arrow); (b) p435 kbpCAT or p170 kbpCAT constructs (6 lg) were cotransfected with 1.5 lg of chSox10/HisMax or pcDNA4/HisMaxB or pAmino-ZO-2/HisMax and Glu 1 mM added 12 h post-transfection. BGC were harvested after 48 h to perform CAT reporter assays; ***p < 0.001 versus transfected with empty vector by ANOVA. BGC previously transfected with 6 lg of chSox10/HisMax or the pcDNA4/ HisMaxB empty vector, treated with Glu 1 mM a12 h post-transfection and harvested 48 h post-transfection were used for extracting total RNA and perform RT-PCR to detect KBP mRNA (c) or KBP protein via western blotting (d) using 20 lg of total protein cell extracts and polyclonal antiKBP or monoclonal anti-actin antibodies.
is expressed in chicken BGC (Lopez et al. 1998) and it is linked to phosphatidyl-inositol turnover and Ca2+ release from intracellular stores. This could explain the partial sensitivity of the Glu response to the Ca2+ chelators EDTA and EGTA (Fig. 3d). Transcription factors are used in different ways and the dissection of their specific function in a particular cell type
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
Glutamate-dependent Sox10 transcriptional repression
is complex. BGC are intermingled among the large Purkinje cells ensheathing their synapses and serving not only as sinks for potassium and Glu released at these synapses, but also as activity-dependent providers of glutamine and lactate to the parallel fiber terminals, in a receptor-mediated coupling (Pellerin et al. 2007). Our results broaden our current knowledge of glial–neuronal coupling in the cerebellum: the activity-dependent glial transcriptional control. Furthermore, as depicted in Fig. 7, the Glu effect on Sox10 binding to DNA results in changes in gene expression of a glial specific target gene: chkbp. The identity of other Sox10 targets in BGC, presumably involved in glial/neuronal coupling is currently under rigorous investigation in our labs. Concerning the Sox10 DNA binding site within the promoter stretch from nucleotides )435 to )170 needed for the Glu effect, it is tempting to speculate that the site overlapping the AP-1 site (Fig. 7a) is involved, since, as noted before, this site is responsible for a Glu-dependent up-regulation of chkbp (Aguirre et al. 2000). One could imagine Sox10 as the switch-off of this regulation. Supporting this interpretation is the known cooperativity of members of the Sox family with other transcription factors (Schlierf et al. 2002). The characterization of Glu-induced Sox interactions in BGC will certainly provide a major input to this interpretation. More work is needed to characterize the role of Sox10 in Glu signaling in BGC and by these means support the role of glial cells in synaptic function.
Acknowledgements This work was supported by grants from CONACyT to EL-B (50414) and to AO (54004 and 79502). IC-S and RCZ are supported by CONACyT PhD fellowships. The technical assistance of Miriam Huerta, Luisa Herna´ndez-Kelly, Blanca Ibarra, and Gerardo Marmolejo is acknowledged.
References Aguirre A., Lopez T., Lopez-Bayghen E. and Ortega A. (2000) Glutamate regulates kainate-binding protein expression in cultured chick Bergmann glia through an activator protein-1 binding site. J. Biol. Chem. 275, 39246–39253. Bak L. K., Schousboe A. and Waagepetersen H. S. (2006) The glutamate/GABA-glutamine cycle: aspects of transport, neurotransmitter homeostasis and ammonia transfer. J. Neurochem. 98, 641–653. Bellamy T. C. (2007) Presynaptic modulation of parallel fiber signalling to Bergmann glia. Neuropharmacology 52, 368–375. Bondurand N., Girard M., Pingault V., Lemort N., Dubourg O. and Goossens M. (2001) Human connexin 32, a gap junction protein altered in the X-linked form of Charcot–Marie–Tooth disease, is directly regulated by the transcription factor SOX10. Hum. Mol. Genet. 10, 2783–2795. Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal. Biochem. 72, 248–254.
| 909
Cartharius K., Frech K., Grote K., Klocke B., Haltmeier M., Klingenhoff A., Frisch M., Bayerlein M. and Werner T. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933–2942. Chan K. K., Wong C. K., Lui V. C., Tam P. K. and Sham M. H. (2003) Analysis of SOX10 mutations identified in Waardenburg–Hirschsprung patients: differential effects on target gene regulation. J. Cell. Biochem. 90, 573–585. Cheng Y., Cheung M., Abu-Elmagd M. M., Orme A. and Scotting P. J. (2000) Chick sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Brain Res. Dev. Brain Res. 121, 233–241. Conn P. P. and Pin J. P. (1997) Pharmacology and functions of metabotropic glutamate receptors. Annu. Rev. Pharmacol. Toxicol. 37, 205–237. Coutinho V. and Knopfel T. (2002) Metabotropic glutamate receptors: electrical and chemical signaling properties. Neuroscientist 8, 551– 561. Gallo V. and Ghiani C. A. (2000) Glutamate receptors in glia: new cells, new inputs and new functions. Trends Pharmacol. Sci. 21, 252–258. Ghislain J. and Charnay P. (2006) Control of myelination in Schwann cells: a Krox20 cis-regulatory element integrates Oct6, Brn2 and Sox10 activities. EMBO Rep. 7, 52–58. Girard M. and Goossens M. (2006) Sumoylation of the SOX10 transcription factor regulates its transcriptional activity. FEBS Lett. 580, 1635–1641. Gregor P., Eshhar N., Ortega A. and Teichberg V. I. (1988) Isolation, immunochemical characterization and localization of the kainate sub-class of glutamate receptor from chick cerebellum. EMBO J. 7, 2673–2679. Huerta M., Munoz R., Tapia R., Soto-Reyes E., Ramirez L., RecillasTarga F., Gonzalez-Mariscal L. and Lopez-Bayghen E. (2007) Cyclin D1 is transcriptionally down-regulated by ZO-2 via an E box and the transcription factor c-Myc. Mol. Biol. Cell 18, 4826– 4836. Iino M., Goto K., Kakegawa W. et al. (2001) Glia-synapse interaction through Ca2+-permeable AMPA receptors in Bergmann glia. Science 292, 926–929. Ito Y., Wiese S., Funk N., Chittka A., Rossoll W., Bommel H., Watabe K., Wegner M. and Sendtner M. (2006) Sox10 regulates ciliary neurotrophic factor gene expression in Schwann cells. Proc. Natl Acad. Sci. USA 103, 7871–7876. Iwamoto K., Bundo M., Yamada K., Takao H., Iwayama-Shigeno Y., Yoshikawa T. and Kato T. (2005) DNA methylation status of SOX10 correlates with its downregulation and oligodendrocyte dysfunction in schizophrenia. J. Neurosci. 25, 5376–5381. Jaramillo B. E., Ponce A., Moreno J., Betanzos A., Huerta M., LopezBayghen E. and Gonzalez-Mariscal L. (2004) Characterization of the tight junction protein ZO-2 localized at the nucleus of epithelial cells. Exp. Cell Res. 297, 247–258. Kelsh R. N. (2006) Sorting out Sox10 functions in neural crest development. BioEssays 28, 788–798. Kordes U., Cheng Y. C. and Scotting P. J. (2005) Sox group E gene expression distinguishes different types and maturational stages of glial cells in developing chick and mouse. Brain Res. Dev. Brain Res. 157, 209–213. Kuhlbrodt K., Herbarth B., Sock E., Hermans-Borgmeyer I. and Wegner M. (1998) Sox10, a novel transcriptional modulator in glial cells. J. Neurosci. 18, 237–250. Lerea L. S. (1997) Glutamate receptors and gene induction: signalling from receptor to nucleus. Cell. Signal. 9, 219–226. Lopez T., Lopez-Colome A. M. and Ortega A. (1998) Changes in GluR4 expression induced by metabotropic receptor activation in radial glia cultures. Brain Res. Mol. Brain Res. 58, 40–46.
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
910 | I. Cruz-Solis et al.
Lopez-Bayghen E., Vega A., Cadena A., Granados S. E., Jave L. F., Gariglio P. and Alvarez-Salas L. M. (1996) Transcriptional analysis of the 5¢-noncoding region of the human involucrin gene. J. Biol. Chem. 271, 512–520. Lopez-Bayghen E., Rosas S., Castelan F. and Ortega A. (2007) Cerebellar Bergmann glia: an important model to study neuron-glia interactions. Neuron Glia Biol. 3, 155–167. Mendez J. A., Lopez-Bayghen E., Rojas F., Hernandez M. E. and Ortega A. (2004) Glutamate regulates Oct-2 DNA-binding activity through alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate receptors in cultured chick Bergmann glia cells. J. Neurochem. 88, 835–843. Ortega A., Eshhar N. and Teichberg V. I. (1991) Properties of kainate receptor/channels on cultured Bergmann glia. Neuroscience 41, 335–349. Ovcharenko I., Loots G. G., Giardine B. M., Hou M., Ma J., Hardison R. C., Stubbs L. and Miller W. (2005) Mulan: multiple-sequence local alignment and visualization for studying function and evolution. Genome Res. 15, 184–194. Peirano R. I. and Wegner M. (2000) The glial transcription factor Sox10 binds to DNA both as monomer and dimer with different functional consequences. Nucleic Acids Res. 28, 3047–3055. Peirano R. I., Goerich D. E., Riethmacher D. and Wegner M. (2000) Protein zero gene expression is regulated by the glial transcription factor Sox10. Mol. Cell. Biol. 20, 3198–3209. Pellerin L., Bouzier-Sore A. K., Aubert A., Serres S., Merle M., Costalat R. and Magistretti P. J. (2007) Activity-dependent regulation of energy metabolism by astrocytes: an update. Glia 55, 1251–1262. Pingault V., Bondurand N., Le Caignec C., Tardieu S., Lemort N., Dubourg O., Le Guern E., Goossens M. and Boespflug-Tanguy O. (2001) The SOX10 transcription factor: evaluation as a candidate gene for central and peripheral hereditary myelin disorders. J. Neurol. 248, 496–499. Pompolo S. and Harley V. R. (2001) Localisation of the SRY-related HMG box protein, SOX9, in rodent brain. Brain Res. 906, 143–148. Potterf S. B., Furumura M., Dunn K. J., Arnheiter H. and Pavan W. J. (2000) Transcription factor hierarchy in Waardenburg syndrome: regulation of MITF expression by SOX10 and PAX3. Hum. Genet. 107, 1–6. Rehberg S., Lischka P., Glaser G., Stamminger T., Wegner M. and Rosorius O. (2002) Sox10 is an active nucleocytoplasmic shuttle protein, and shuttling is crucial for Sox10-mediated transactivation. Mol. Cell. Biol. 22, 5826–5834.
Ronesi J. A. and Huber K. M. (2008) Metabotropic glutamate receptors and fragile x mental retardation protein: partners in translational regulation at the synapse. Sci. Signal. 1, pe6. Available online at http://stke.sciencemag.org/about/cite.dt#Citing_literature_SciSig. Rowitch D. (2004) Glial specification in the vertebrate neural tube. Nat. Rev. 5, 409–419. Rutberg S. E., Adams T. L., Olive M., Alexander N., Vinson C. and Yuspa S. H. (1999) CRE DNA binding proteins bind to the AP-1 target sequence and suppress AP-1 transcriptional activity in mouse keratinocytes. Oncogene 18, 1569–1579. Schlierf B., Ludwig A., Klenovsek K. and Wegner M. (2002) Cooperative binding of Sox10 to DNA: requirements and consequences. Nucleic Acids Res. 30, 5509–5516. Schlierf B., Werner T., Glaser G. and Wegner M. (2006) Expression of connexin47 in oligodendrocytes is regulated by the Sox10 transcription factor. J. Mol. Biol. 361, 11–21. Somogyi P., Eshhar N., Teichberg V. I. and Roberts J. D. (1990) Subcellular localization of a putative kainate receptor in Bergmann glial cells using a monoclonal antibody in the chick and fish cerebellar cortex. Neuroscience 35, 9–30. Sottile V., Li M. and Scotting P. J. (2006) Stem cell marker expression in the Bergmann glia population of the adult mouse brain. Brain Res. 1099, 8–17. Steinhauser C. and Gallo V. (1996) News on glutamate receptors in glial cells. Trends Neurosci. 19, 339–345. Stolt C. C., Rehberg S., Ader M., Lommes P., Riethmacher D., Schachner M., Bartsch U. and Wegner M. (2002) Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10. Genes Dev. 16, 165–170. Taylor K. M. and Labonne C. (2005) SoxE factors function equivalently during neural crest and inner ear development and their activity is regulated by SUMOylation. Dev. Cell 9, 593–603. Verkhratsky A. and Kirchhoff F. (2007) Glutamate-mediated neuronalglial transmission. J. Anat. 210, 651–660. Wang J. Q., Fibuch E. E. and Mao L. (2007) Regulation of mitogenactivated protein kinases by glutamate receptors. J. Neurochem. 100, 1–11. Wegner M. (1999) From head to toes: the multiple facets of Sox proteins. Nucleic Acids Res. 27, 1409–1420. Zhu C. Z., Wilson S. G., Mikusa J. P., Wismer C. T., Gauvin D. M., Lynch J. J. III, Wade C. L., Decker M. W. and Honore P. (2004) Assessing the role of metabotropic glutamate receptor 5 in multiple nociceptive modalities. Eur. J. Pharmacol. 506, 107–118.
2009 The Authors Journal Compilation 2009 International Society for Neurochemistry, J. Neurochem. (2009) 109, 899–910
