Human cystic fibrosis embryonic stem cell lines derived on placental mesenchymal stromal cells

RBMOnline - Vol 18. No 5. 2009 704-716 Reproductive BioMedicine Online; www.rbmonline.com/Article/3806 on web 19 March 2009

Article Human cystic fibrosis embryonic stem cell lines derived on placental mesenchymal stromal cells Sandrine Deleu obtained her PhD degree in 2001 in the field of molecular biology at the Université Libre de Bruxelles, Belgium. She completed her post-doctoral studies at the National Institute of Health, North Carolina, USA in the field of cell signaling transduction. In 2004, she joined the Research Laboratory on Human Reproduction, Campus Erasme, Brussels, Belgium and coordinates different projects on human embryonic stem cell research.

Dr Sandrine Deleu S Deleu1,4, E Gonzalez-Merino1, N Gaspard2,4, TMU Nguyen1, P Vanderhaeghen2,4, L Lagneaux6, M Toungouz3, Y Englert1,5, F Devreker1,4,7 1 Research Laboratory on Human Reproduction; 2Institute of Interdisciplinary Research (IRIBHM); 3Cellular and Molecular Therapy Unit, Université Libre de Bruxelles; 4Belgian National Funds for Scientific Research; 5Obstetrics and Gynaecology, Hospital Erasme, Université Libre de Bruxelles; 6Experimental Haematology, Bordet Institute, ULB, Brussels, Belgium 7 Correspondence: e-mail: [email protected]

Abstract This study describes the production of two new human embryonic stem cell (hESC) lines affected by cystic fibrosis. These cell lines are heterozygous compounds, each a carrier of the DF508 mutations associated either with E585X or with 3849+10 kb CmT. The derivation process was performed on irradiated human placental mesenchymal stromal cells and designed to minimize contact with xeno-components. This new source of feeder cells is easy to obtain and devoid of ethical concerns. The cells have a great capacity to proliferate which reduces the need for continuous preparation of new feeder cell lines. In addition, three normal hESC lines were obtained in the same conditions. The five stem cell lines retained hESC-specific features, including an unlimited and undifferentiated proliferation capacity, marker expression and the maintenance of stable karyotype. They also demonstrated pluripotency in vitro, forming cell lineages of the three germ layers, as indicated by immunolocalization of B-tubulin, A-fetoprotein and actin. These new genetic cell lines represent an important in–vitro tool to study the physiological processes underlying this genetic disease, drug screening, and tissue engineering. Keywords: cystic fibrosis, genetic disease, human embryonic stem cells, placental mesenchymal feeder cells

Introduction

704

Permanent human embryonic stem cells (hESC) were first derived from the inner cell mass (ICM) of a blastocyst in 1998 (Thomson et al., 1998). Their ability to proliferate indefinitely in vitro and to differentiate into the widest range of cell types makes them a valuable source of cells for tissue engineering, drug development, disease drug-oriented models and regenerative medicine. On the other hand, the development of preimplantation genetic diagnosis (PGD) during IVF gives a new source of surplus embryos. PGD is a method identifying genetic disorders in IVF-produced embryos, and represents an alternative to prenatal diagnosis. First of all, it was recommended to couples with sex-inherited diseases (Handyside et al., 1990), then PGD was developed for several monogenic diseases such as cystic fibrosis, drepanocytosis, myotony dystrophy 1,

Huntington disease (Harper et al., 2002; Sermon et al., 2004). Embryos diagnosed with a genetic disease cannot be replaced but represent an inestimable source for genetically affected hESC lines (Pickering et al., 2005; Verlinsky et al., 2005; Mateizel et al., 2006; Eiges, 2007). Cystic fibrosis (CF), one of the most frequent genetic disorders, is caused by recessive mutations in the gene called cystic fibrosis transmembrane conductance regulator (CFTR) located on the long arm of chromosome 7. This life-threatening genetic disease is characterized by the obstruction and chronic infection of the respiratory tract and by pancreatic insufficiency. The F508del mutation accounts for two-thirds of all CF patients. A large number of different mutations account for the last third

© 2009 Published by Reproductive Healthcare Ltd, Duck End Farm, Dry Drayton, Cambridge CB23 8DB, UK

Article - Human cystic fibrosis ESC lines - S Deleu et al.

(Castellani et al., 2008). These mutations have been classified into five categories. Class I III mutations are usually associated with pancreatic insufficiency, whereas class IV V mutations with pancreatic sufficiency (Castellani et al., 2008). Genotype and phenotype correlations are, however, not absolute and some ‘mild’ mutations can be associated with severe forms of CF. Moreover, patients who are compound heterozygous for two mutations may face a more severe form of CF. Recent progress in medical therapies has drastically increased the lifespan of patients who may also benefit from a better quality of life. Improvements in medical therapies are, however, still required. Over the past decade, gene therapy, a promising tool, has encountered lots of hurdles including vector inflammation, inefficient delivery and targeting to inappropriate cell types (Gill et al., 2004; Schwiebert, 2004). Cystic fibrosis hESC lines representing different CF genotypes may be highly valuable for research. They could behave differently in various cell types and therefore be of great utility in testing viral tropism and expression patterns (Pickering et al., 2005). Moreover, different mutations have different impacts on CFTR function, and could be compared through the use of different hESC lines. hESC were initially produced in the presence of inactivated mouse fibroblasts (MEF) and a complex culture medium supplemented with fetal calf serum (FCS) (Thomson et al., 1998). ICM were isolated by immunosurgical isolation with the use animal antibodies (Thomson et al., 1998). A great deal of effort was made to limit xeno-contamination with undefined retroviruses or other animal pathogens (Amit et al., 2003) during the production of hESC. Indeed, some nonhuman antigens such as the non-human sialic acid Neu5Gc (N-glycolylneuraminic acid 5) issued from mouse feeder layers were identified in hESC culture. This particular antigen may induce an immune response after cell transplantation in humans (Martin et al., 2005). Mouse feeder cells (MEF) were replaced by human fibroblasts obtained from first trimester placentas (Simon et al., 2005), foreskin or embryonic cells derived from hESC (Stojkovic et al., 2005; Xu et al., 2005). Currently, the FCS is replaced by a synthetic substitute serum for the culture of hESC. However, most laboratories produce and expand human fibroblasts in the presence of FCS that is only removed when fibroblasts are in contact with hESC. Mechanical dissection, laser-assisted isolation (Turetsky et al., 2008) or derivation from a single blastomere (Klimanskaya et al., 2006) are used to bypass some xeno-contaminations. Recently extracellular matrices were successfully introduced (Xu et al., 2001; Amit et al., 2004; Beattie et al., 2005; Klimanskaya et al., 2005; Stojkovic et al., 2005) for derivation and longterm culture of hESC. Culture media are supplemented with conditioned medium from MEF or from human fibroblasts (Xu et al., 2004; Stojkovic et al., 2005), or with a defined cocktail of growth factors (Amit et al., 2004; Beattie et al., 2005). Feeder-free culture methods were shown, however, to induce chromosomal abnormalities in hESC due to the adaptation to more demanding growth conditions and enzymatic passaging methods (Draper et al., 2004; Mitalipova et al., 2005). These matrices are also expensive and still display variations of quality from batch to batch. RBMOnline®

In this study, five new hESC lines were obtained on human cells derived from term placentas. These five lines include two new CF line carriers of F508del/E585X and F508del/3849 C + T. This is the first time that human term placental cells were shown to support derivation and long-term culture of hESC.

Materials and methods Source of embryos and placenta This work was approved by both research ethics committee of the Hospital Erasme, and the Université Libre de Bruxelles, and written informed consent was obtained. IVF-produced human embryos unsuitable for transfer or freezing, which had developed to the blastocyst stage, were allocated to the study. Human term placentas were obtained individually from the delivery room. All patients tested negative for human immunodeficiency virus, hepatitis B and C, syphilis, chlamydia and cytomegalovirus. Two 4-cell stage fresh embryos of low average or poor quality only were put in culture in sequential media (Cook, Belgium) and those developing up to the blastocyst stage with a defined ICM, were used for ESC derivation. Average quality embryos had uneven blastomeres and less than one-third of anucleate fragments, poor quality embryos had uneven blastomeres and r33% of anucleate fragments.

Derivation of feeder layers Feeder cells were obtained from human term placentas. Briefly, pieces from the membrane adjacent to the placenta were dissected and chopped into 1–2 mm2 pieces with a fine pair of scissors. Pieces were rinsed twice with a phosphate-buffered saline solution (PBS; Cambrex, Belgium) and placed into a 20 cm2 dish (Nunc, VWR, Belgium) with a very thin film of medium at 37°C to allow adherence. Following adhesion, explants were washed to remove any debris and unattached explants. Tissue flasks were then randomly distributed between three culture media, i.e. standard medium (A) with fetal bovine serum (FBS; (HyClone, Perbio Science, Aalst, Belgium), and two FBS-free media (see below). After 10 days, fibroblast-like cells covered the plastic surface. When confluence was reached, cells were trypsinized (trypsin 0.05%/EDTA) subcultured or frozen for later use.

Feeder cell preparations Culture dishes (9 cm2; Nunc) were precoated with 0.1% gelatine of porcine origin (Sigma-Aldrich, Belgium) to promote feeder attachment. The confluent monolayers were thoroughly washed with PBS. Cells were then trypsinized to produce a single suspension, counted and plated. In each dish, 1 s 105 feeder cells were plated. Medium was changed every 72 h. When 80% (optimal for either derivation or culture of embryonic stem cells) confluence was reached, the cells were irradiated using 2200 curies of Cesium 137 in a Mark 1-68A irradiator (JL Shepherd and Associates, San Fernando, CA, USA) for 17 min at 428 rad/min.

705

Article - Human cystic fibrosis ESC lines - S Deleu et al.

Culture media tested for the establishment of feeder cell lines Medium A (control medium): Dulbecco’s modified Eagle’s medium (DMEM) Glutamax (Gibco, USA), supplemented with 15% FCS (HyClone, USA), basic, human recombinant fibroblast growth factor (rFGF), (8 ng/ml final concentration; ICN Biomedicals, Belgium), 1% sodium pyruvate (Invitrogen, Belgium), 1% penicillin/streptomycin (Sigma-Aldrich), B-mercaptoethanol (5 × 10–5 final concentration; SigmaAldrich) and 1% non-essential amino acid (Invitrogen). Medium B: DMEM/HAM F12 (Gibco) (v/v) supplemented with 20% serum replacement (Knockout-SR; Invitrogen), basic, human rFGF, (8 ng/ml final concentration, ICN Biomedicals), 1% sodium pyruvate, 1% L-glutamine, 1% penicillin/ streptomycin, B-mercaptoethanol (5 s 10–5 final concentration, Sigma-Aldrich) and 1% non-essential amino acid (Invitrogen). Medium C: DMEM/HAMs F12 (v/v) supplemented with 20% Knockout-SR, basic, human rFGF, (8 ng/ml final concentration), 1% sodium pyruvate, 1% L-glutamine, 1% penicillin/streptomycin (Sigma), B-mercaptoethanol (5 × 10–5 final concentration) and 1% non–essential amino acid, selenium (Sigma) (5 ng/ml final concentration) and transferrin (Sigma) (10 μg/ml final concentration). The absence of mycoplasma germ in the culture medium was assessed by the Venor Gem Mycoplasma detection kit (Minerva Biolabs, Belgium) following the manufacturer’s instructions.

A multiplex PCR protocol was chosen to amplify the F508del mutation in combination with informative intragenic polymorphic markers, allowing indirect detection of the less frequent mutation by identifying the allele segregating with this mutation. After informative testing, the polymorphic markers IVS8CA (for couple 1), IVS6aGATT and IVS17bCA (for couple 2) were chosen for the multiplex PGD PCR. For each primer pair, the forward primer was fluorescently labelled with 6-FAM. After amplification, PCR product electrophoresis was performed on an ABI Prism 3100 DNA Sequencer (Applied Biosystems; Lennik, Belgium) and analysis was carried out using GeneScan and Genotyper softwares (Applied Biosystems). Fluorescent PCR was used to screen preimplantation embryos and hESC lines. Since each couple carried two different mutations, the ΔF508 and the 3849+10 kb CmT mutations for couple 1, and the ΔF508 and E585X mutations for couple 2, a multiplex PCR protocol was chosen to amplify the ΔF508 mutation in combination with informative intragenic polymorphic markers allowing indirect detection of the less frequent mutation by identifying the allele segregating with this mutation. After informative testing, the polymorphic markers IVS8CA (for couple 1), IVS6aGATT and IVS17bCA (for couple 2) were chosen for the multiplex PGD PCR. For each primer pair, the forward primer was fluorescently labelled with 6-FAM. After amplification, PCR product electrophoresis was performed on an ABI Prism 3100 DNA Sequencer (Applied Biosystems) and analysis was carried out using GeneScan and Genotyper software (Applied Biosystems).

Derivation of hESC lines Characterization of feeder cells The expanded cells were characterized at different times by flow cytometric analysis of specific surface antigens. Cells were first incubated for 30 min at room temperature with fluorescein isothiocyanate (FITC), phycoerythin (PE) or PECy5 conjugated primary antibody. Flow cytometric analysis was performed on a Coulter EPICS XL (Coulter, Florida, USA). Tested markers included: haematopoietic lineage markers: CD34 (BD Biosciences Pharmingen, USA), CD133 (Miltenyi Biotech, Bergisch Gladbach, Germany), CD45 (Immunotech, Marseille, France), human leukocyte antigen-DR (HLA-DR; Immunotech); endothelial cell markers: CD31 (Immunotech), kinase insert domain receptor (KDR; BD Biosciences Pharmingen); mesenchymal cell markers: CD73, CD90, CD105, CD146 and CD166 (all from RD Systems, Abingdon, UK), embryonic stem cell marker: SSEA-4 (RD Systems).

Genetic testing of embryos and cell lines for cystic fibrosis

706

PGD embryos were donated by two couples, each carriers of two mutations leading to cystic fibrosis; one couple carried the F508del and the 3849+10 kb CmT mutations, the other carried the F508del and E585X mutations. After intracytoplasmic sperm injection, embryos were cultured in sequential medium (Cook, Belgium) at 37°, in 5% CO2, 5% O2 atmosphere. Up to two blastomeres were retrieved on day 3 from embryos that were at least at the 6-cell stage. Cells were then processed for genetic diagnosis by polymerase chain reaction (PCR).

Day-5 or day-6 human blastocysts were incubated in acid Tyrode’s solution for removal of the zona pellucida. Zona-free blastocysts were rinsed three times with the culture medium and individually transferred to 0.1% gelatine-coated culture dishes containing fresh feeder layers, the specific culture medium supplemented with 10% Plasmanat (Bayer US, USA) and cultured further under oil (Paraffin; Sigma) at 37°C in air. After 3 7 days, ICM that formed a distinct clump of cells were mechanically dissected with a 27-gauge needle and transferred onto fresh feeder cells. The medium consisted then of Knockout (KO)-DMEM (Gibco) supplemented with 20% KO-SR (Invitrogen), basic, human rFGF, (8 ng/ml final concentration; ICN Biomedicals), 1% sodium pyruvate (Invitrogen), 1% L-Glutamax (Invitrogen), B-mercaptoethanol (5 s 10–5 final concentration; Sigma-Aldrich), 1% non-essential amino acid (Invitrogen), selenium (Sigma) (5 ng/ml final concentration), transferrin (Sigma) (5.5 μg/ml final concentration) and human recombinant insulin (Sigma) (10 μg/ ml final concentration). Cultures were performed at 37°C, in 5% CO2 in air. At each passage, individual colonies were manually dissociated with a 27-gauge needle into small pieces. When the colonies were cultured in 25 cm2 flasks, 3 mm diameter beads (Sigma) were used to cut the colonies. Briefly, the medium was discarded from the flask and 2 ml of fresh medium was added together with the beads. The flask was carefully shaken until the colonies were cut into small pieces. The medium was then collected and split equally into fresh feeder 25 cm2 flasks precoated with gelatine.

RBMOnline®

Article - Human cystic fibrosis ESC lines - S Deleu et al.

Freezing/thawing procedure Freezing protocol hESC colonies were cryopreserved by a fast freezing procedure (vitrification) either in straws or in vials. Dissected colony fragments were collected and incubated for 1 min in solution 1: dimethyl sulphoxide (DMSO; BDH AnalaR) 1.07 mol/l and ethylene glycol (Sigma) 1.36 mol/l diluted in holding medium (HM: DMEM supplemented with 20% of KO-serum); then 25 s in solution 2: consisting of DMSO (BDH AnalaR) 2.08 mol/l, ethylene glycol (Sigma) 2.64 mol/l and 0.5 mol/l sucrose (Sigma, Belgium) diluted in HM. After the end of incubation periods, colonies were transferred in closed straws and immediately submerged in liquid nitrogen. For cryopreservation in vials, dissected colony fragments were transferred into a 15ml tube and centrifuged at 1200 rpm for 1 min. The supernatant was removed and the pellet resuspended in 1 ml of the medium 50/50 vol/vol in KO-DMEM/KO-SR and homogenized by up-and-down movements. The solution was then transferred to a vial already containing 0.5 ml of the medium 20/40/40 vol/vol in DMSO/KO-DMEM/KO-SR. After addition of the cells, vials were quickly inverted and inserted in a freezing box and placed at 80°C overnight. On the next day, the vials were plunged into liquid nitrogen.

Thawing protocol Colonies were incubated in a two-step solution consisting of a decreasing concentration of sucrose from 0.2 to 0.1 mol/l. At the end of incubation, colonies were transferred in holding medium for 5 min and finally placed in hES medium and cultured on G-irradiated fibroblasts. For vial thawing, colonies were gently transferred into 10 ml of prewarmed media, and centrifuged at 1200 rpm for 1 min. The medium was aspirated and the pellets resuspended in 1 ml of prewarmed hES medium. Colonies were finally placed in hES medium and cultured on G-irradiated fibroblasts.

Characterization of the ES cell lines Phenotype Immunofluorescence analysis of stem cell surface markers SSEA-1, SSEA-4, TRA-1–60 and TRA-1–81 was performed using the ES cell characterization kit following the manufacturer’s instructions (Chemicon International Inc., USA). Briefly, ES colonies were fixed with 4% paraformaldehyde in PBS (Gibco) for 20 min, permeabilized with 0.1% Triton X-100 diluted in PBS for 10 min. Then the cells were incubated with a blocking solution (4% normal goat serum) for 30 min at room temperature and incubated with the different primary antibodies at a 1/25 dilution overnight at 4°C. Cell analysis was carried out with the secondary antibody [fluorescein-conjugated goat antimouse immunoglobulin G (IgG), Sigma] according to the manufacturer’s instructions, with a fluorescent microscope (BX40; Olympus, Belgium) and the Cytovision software from Applied Imaging, UK. RBMOnline®

For Oct-4 antibody (C-20; Santa Cruz Biotechnology, USA), the dilution used was 1/100, the blocking solution was a 4% bovine serum albumin solution and the secondary antibodies were the following: biotin-conjugated donkey anti-goat IgG antibody (Jackson Immunoresearch, USA) and streptavidin, Alexa Fluor 555 conjugate (Molecular Probes, USA). The alkaline phosphatase (AP) staining was carried out using the Vector red alkaline phosphatase Kit 1 (Vector Laboratories, UK). Briefly, cells were rinsed once with PBS, permeabilized for 5 min with 0.1% Triton X-100, rinsed three times with PBS. Then the solution substrate was added and the dishes were incubated in the dark for 30 min, washed for 5 min with PBS, and finally rinsed with distilled water. The fluorescent images were obtained by an Olympus BX40 microscope and the Cytovision software from Applied Imaging.

Karyotype hESC colonies were incubated in media containing 0.5 μg/ ml colcemid solution (Invitrogen) for 20 min at 37°C in a 5% CO2 in air atmosphere. Colonies were incubated with trypsin/EDTA 0.05% (Gibco) for 5 min at 37°C. The cells were centrifuged, resuspended and incubated with 0.075 mol/l potassium chloride (KCl) for 40 min at 37°C. Following treatment with hypotonic solution, cells were fixed in 3:1 methanol: glacial acetic acid three times and stored overnight at 4°C. On the next day, cells were fixed twice and dropped onto precleaned chilled glass slides. Chromosome spreads were G-banded with banding trypsin solution, Giemsa stained and photographed. At least 20 metaphase spreads were evaluated by a qualified cytogeneticist.

Gene expression Reverse transcription (RT) was carried out to investigate the presence of OCT-4, Rex1, hTERT and Nanog expression. RNA was extracted and reverse transcription (RT) PCR was performed using the RNAqueous-Micro kit (Ambion; Applied Biosystems) according to the manufacturer’s instructions. In short, hESC cells were submerged in 100 μl of ice-cold lysis buffer, treated with ethanol, and centrifuged. Each sample of RNA was eluted in 20 μl of elution buffer. Genomic DNA was degraded by incubation with DNase I for 30 min at 37°C. RNA was reverse transcribed using Maloney murine leukaemia virus RT and random hexameres following the manufacturer’s instructions. PCR was carried out using the primers as described in Table 1. PCR products were run on 2% agarose gels and stained with ethidium bromide. Results were assessed on the presence or absence of the appropriate size PCR products. Different RT negative controls were included to monitor genomic contamination and to test a differentiated cell line. To investigate the HLA typing, DNA was extracted using the High Pure PCR Template Preparation kit (Roche, Switzerland) according to the manufacturer’s instructions. After that, the INNO-LiPA HLA typing test (Innogenetics, Ghent, Belgium) was performed. This test is based on the reverse hybridization principle. Amplified biotinylated DNA material (based on the PCR) is chemically denatured, and the separated strands are hybridized with specific oligonucleotide probes immobilized

707

Article - Human cystic fibrosis ESC lines - S Deleu et al.

Table 1. Primers sequences and conditions for the polymerase chain reaction tests Gene

Forward primer (5am3a)

Reverse primer (5am3a)

Annealing Product size temperature (base pairs) (°C)

Oct-4 Nanog Rex 1 hTert GAPDH

GAAGCTGGAGAAGGAGAAG CATGAGTGTGGATCCAGCTTG ATCCTAAACAGCTCGCAGAAT CGGAAGAGTGTCTGGAGCAAGT GTCAGTGGTGGACCTGACCT

TCTGCTTTGCATATCTCCTG CTCCATCTTCACACGTCTTCAGGTTG GCGTACGCAAATTAAAGTCCAGA GAACAGTGCCTTCACCCTCGA CACCACCCTGTTGCTGTAG

58 64 62 66 62

as parallel lines on membrane-based strips. This is followed by a stringent wash step to remove any mismatched amplified material. After the stringent wash, streptavidin conjugated with alkaline phosphatase is added and bound to any biotinylated hybrid previously formed. Incubation with a substrate solution containing a chromogen results in a purple/ brown precipitate. The reaction is stopped by a wash step, and the reactivity pattern of the probes is recorded. The staining of pluripotent cell markers and the RT-PCR were performed approximately every 30 passages revealing that the cell lines maintained their undifferentiated characteristics along the culture.

302 927 302 257 255

Primary antibodies were mouse monoclonal anti-human nestin (clone 10C2; Chemicon; 1/200), anti-beta-III-tubulin (TuJ1; Covance.UK; 1/500), anti-alpha-fetoprotein (clone C3; Sigma; 1/200), anti-actin alpha-sarcomeric (clone 5C5; Sigma; 1/500). The mouse monoclonal anti-myosin antibody (MF20; 1/5) developed by Donald A Fischman was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242, USA. Secondary antibody was Alexa Fluor 488 donkey anti-mouse IgG (Molecular Probes; 1/500).

In-vitro differentiation Pluripotency of hESC was tested by formation of embryoid bodies and detection of precursors of the three embryonic germ layers by specific antibodies. Cells were grown in suspension without feeder cells for 2 4 weeks in the presence of serum substitute or FBS and spontaneously formed cystic embryoid bodies. Embryoid bodies were fixed in 4% paraformaldehyde overnight at 4°C, rinsed three times in PBS at room temperature, incubated in 30% sucrose overnight at 4°C, embedded in optimum cutting temperature (OCT) resin (Sakura Finetek Inc, Torrance, CA, USA) and cryosectioned (20 μmol/l sections). Cryosections were air dried and then washed three times for 5 min each in PBS to remove excess OCT. Sections were then blocked in PBS supplemented with 5% horse serum and 0.2% Triton-X 100 for 1 h at room temperature.

708

Incubation with primary antibodies was done in PBS supplemented with 1% horse serum and 0.1% Triton-X100 overnight at 4°C. Sections were then washed three times in PBS for 10 min at room temperature and then incubated with secondary antibodies in PBS supplemented with 1% horse serum and 0.1% Triton-X100 for 1 h at room temperature. Sections were then washed three times in PBS for 10 min at room temperature and counterstained with bisbenzimide in PBS (Hoechst #33258; Sigma; 1 μg/ml) then mounted with Glycergel (Dako, Denmark) and analysed by confocal microscopy (Zeiss LSM 510 META).

Results Production of feeder layers Membranes from 10 term placentas were tested. Three media were used and compared for their ability to sustain fibroblastlike cell culture. A first standard medium supplemented with FCS (A), a second medium supplemented only with synthetic substitute serum (B) and a third one supplemented with synthetic substitute serum, transferrin and selenium (C). Differences between culture conditions could already be observed from the beginning of the culture. The medium supplemented with FCS was the only one able to support normal growth of fibroblastlike cells. In the other two culture media, cell growth rapidly decreased and stopped after two or three passages. Attempts were also made to supplement the culture medium with human serum, without success (data not shown). Nevertheless, one line of placental fibroblast-like cells proliferated enough to be used in routine culture to sustain hESC proliferation and derivation. These cells are still used after more than 2 years. These fibroblast-like cells have the great advantage compared with others sources of feeder cells of being used from the first passage to sustain hESC lines. Although the fibroblasts-like cells displayed the specific marker for fibroblasts (human proplyl hydroxylase beta), these cells were further characterized because their morphology was indeed similar to mesenchymal stromal cells. The extensive phenotype analysis performed by flow cytometric analysis of RBMOnline®

Article - Human cystic fibrosis ESC lines - S Deleu et al.

Table 2. Summary of placental mesenchymal stem cell (MSC) characteristics. Phenotype placental-MSC

Passage 1

Passage Passage 2 9

CD166 CD73 HLA-DR CD105 CD90 CD45 CD31 SSEA-4 CD146 CD62 CD34 KDR CD133

95 99 0.5 83 85 4 0.5 18 87 14 0.1 0.2 0.2

94 99 0.4 90 90 3 0.5 47 84 18 0.1 0.2 0.2

83 85 0.3 84.5 69 18 1.1 1.7 75.4 24 2.0 0.5 1.3

The results are expressed as the percentage of positive cells.

specific surface antigens (FACS) effectively demonstrated that the phenotype was close to the one of mesenchymal stem cells (MSC) (Table 2). Both types of cells expressed the specific markers for MSC, CD 166, CD105, CD 90, CD 73, CD 146 and were negative for CD133, CD45, CD34, CD31 or KDR. These cells also have immunomodulatory properties such as being able to inhibit the proliferation of lymphocytes T after phytohaemagglutinin (PHA) activation. The cells were also able to differentiate into osteogenic and adipogenic lineages.

Derivation of hESC lines Out of 118 poor quality embryos donated for research 34 reached the blastocyst stage. Twenty nine were normal and five carried genetic anomalies. Fifty-one per cent of the normal blastocysts originated from embryos with 30 60% of anucleate fragments. The five CF blastocysts originated from embryos of good quality, with