BBRC Biochemical and Biophysical Research Communications 306 (2003) 995–1001 www.elsevier.com/locate/ybbrc
Human malaria parasites display a receptor for activated C kinase ortholog Luciana Madeira,a Ricardo DeMarco,b Marcos L. Gazarini,a Sergio Verjovski-Almeida,b and Celia R.S. Garciac,* a
c
Departamento de Parasitologia, Instituto de Cieˆncias Biom edicas, Universidade de S~ ao Paulo, 05508-900 S~ ao Paulo, SP, Brazil b Departamento de Bioquı´mica, Instituto de Quı´mica, Universidade de S~ ao Paulo, 05508-900 S~ ao Paulo, SP, Brazil Departamento de Fisiologia, Instituto de Biocieˆncias, Universidade de S~ ao Paulo, Rua do Mat~ ao, travessa 14, n321, 05508-900 S~ ao Paulo, SP, Brazil Received 20 May 2003
Abstract Receptors for activated C kinases (RACKs) are scaffold proteins that anchor diverse signaling proteins and are involved in modulating cell cycle. We report the cloning and cellular localization of a RACK ortholog (PfRACK) in the human malaria parasite Plasmodium falciparum. The full-length transcript obtained by 30 and 50 RACE has 1.4 kbp with a predicted ORF of 972 bp, coding for a protein with 323 residues of 35.8 kDa molecular weight and pI 6.38. PfRACK has 59% and 60% identity at the amino acid level to Chlamydomonas reinhardtii and Danio rerio RACKs, respectively, presenting seven WD40 motifs and retaining the conserved domains in repeats III (DVFSVSF) and VI (STINSLCF) that are important for PKC binding. Semi-quantitative RT-PCR revealed that PfRACK is constitutively expressed in the intraerythrocytic stages of P. falciparum. Using confocal microscopy, PfRACK was immunolocalized in all parasite stages, being conspicuously spread throughout the schizont. The high similarity of PfRACK to those previously described in other organisms, as well as its constitutive expression in Plasmodium asexual stages, suggests that it might play a key role in the regulatory processes of malaria parasite life cycle. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Malaria; RACK; Cell signaling; Scaffold protein; Plasmodium falciparum; Confocal microscopy
Malaria parasites have a complex life cycle, composed by several specialized developmental forms both in insect and vertebrate hosts. Their differentiation and cellular division processes must be tightly controlled in accordance with environmental changes and/or internal stimuli, and signal transduction has an essential role in this aspect. Environmental sensing by malaria parasites has been demonstrated by the action of xanthurenic acid on exflagellation of microgametocytes [1,2], and of melatonin in synchronization of intraerythrocytic stages [3,4]. Despite malaria parasite growth inside another cell, calcium signaling is likely to be an important mechanism in the stimulation of intraerythrocytic forms of Plasmodium development [5–7]. It is worth noting that during parasite exflagellation process the production of * Corresponding author. Fax: +5511-3091-7416. E-mail address:
[email protected] (C.R.S. Garcia).
second messengers cGMP, DAG, and inositol-(1,4,5)triphosphate (IP3 ) was described, the latter promoting calcium release from parasiteÕs intracellular stores [8– 10]. As to the intraerythrocytic forms, similarities of Plasmodium calcium handling mechanisms to that known in mammalian cells were reported to occur [11]. Hence, searching for the Plasmodium molecular machinery responsible for controlling cellular events is a fundamental task in malaria. RACKs are proteins that anchor activated protein kinase C (PKC) at translocation site, where PKC can regulate many cellular functions by phosphorylation of target proteins. Binding of RACK stabilizes the PKC active form and increases substrate phosphorylation, despite RACK itself not possessing enzymatic activity [12]. There are at least three subfamilies of PKC isozymes, according to their selectivity to second messengers and lipids, each mediating a unique function [13]. PKC binding to RACK is isozyme-specific, RACK1
0006-291X/03/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0006-291X(03)01074-X
996
L. Madeira et al. / Biochemical and Biophysical Research Communications 306 (2003) 995–1001
being selective for bIIPKC [12], and RACK2 for ePKC [14]. Due to spatial and temporal organization of signaling complexes that RACKs provide, the speed and precision of signaling events can be tightly modulated in response to different stimuli [15]. The presence of RACKs has been reported in several organisms, from lower eukaryotes to mammals [12,16– 18]. RACK orthologs in Trypanosomatidea have been postulated to play a role in controlling cellular division, including protozoan apoptosis, and in early events of the antigen-presentation mechanism mediated by MHC class II molecules [19–21]. In the present work, we describe the cloning of a RACK ortholog in P. falciparum, its expression and cellular localization in intraerythrocytic stages of the parasiteÕs life cycle.
Materials and methods Parasite culture. Plasmodium falciparum (Palo Alto strain) were cultured as described previously [22]. The intraerythrocytic stages of parasites were monitored by Giemsa stain of thin-blood films. Isolation of parasites. Parasites were first released from erythrocytes by treatment with 30 lg ml1 saponin in PBS and centrifugation at 9000g for 10 min at 4 °C. The parasite cell pellet was then washed twice with PBS. Cloning of PfRACK. Three oligonucleotides were designed (PfGbfw, -rv1, and -rv2), based on the sequence of an EST of 150 bp obtained in our laboratory. These oligonucleotides were used to isolate the correspondent full-length cDNA by the rapid amplification of cDNA ends (RACE) technique. Messenger RNA was extracted from saponin-isolated parasites by using lMACS mRNA Isolation kit (Miltenyi Biotec). We used 240 ng mRNA to synthesize cDNA first strand with SuperScript RTII reverse transcriptase and adapter primer of 30 RACE System (Invitrogen), according to manufacturerÕs instructions. This cDNA was used as a template in a polymerase chain reaction using gene specific primer (PfGb-fw) and adapter primer (AUAP). To amplify 50 cDNA end, we employed 50 RACE System (Invitrogen), using 320 ng mRNA in cDNA first strand reaction. The cDNA generated was used as a template in a PCR using gene specific primer (PfGb-rv1) and anchor primer (Invitrogen). Products of this reaction were used as template in a nested-PCR using a second gene specific primer (PfGb-rv2) and AUAP (Invitrogen). All reactions were performed using the following thermal cycling conditions: 95 °C (3 min); 35 cycles of 95 °C (1 min), 55 °C (30 s), and 68 °C (3 min); 68 °C (5 min). Amplified DNA fragments were cloned in pGEM-T vector (Promega) and sequenced. In order to amplify genomic DNA sequence of the P. falciparum receptor for activated C kinase (PfRACK), oligonucleotides PfRACK-fw-BamHI and PfRACK-rv-SacI were used. The PfRACK cDNA and genomic sequences have been deposited in GenBank under Accession Nos. AY174059 and AY174060. Oligonucleotides. The oligonucleotides used in this work were: PfGb-fw, TTTATGGGATTTATCACTTGGTG; PfGb-rv1, GCTGA GACGATTTGTCTATTATCTG; PfGb-rv2, TCAGACGTGTGA CCAATAAATG; PfRACK-fw-BamHI, CGGGATCCGATGGAT AATATAAAAGAAGC; and PfRACK-rv-SacI, TCCGAGCTCG AAACTGAGTGTTTTTTAACTTC. In order to obtain the internal sequence of genomic PfRACK we either used PfRACK-fw2, ATT GGTTATGTGCAGCAACG or PfRACK-rv3, ATCCGTTGCTG CACATAACC. Sequence analysis. Automatic DNA sequencing was performed using an ABI PRISM 377 DNA Sequencer. Sequences obtained were
analyzed by PhredPhrap program [23,24]; resulting contigs were compared to GenBank database sequences using Gapped-BLAST [25]. Open reading frame was predicted by ORF Finder (NCBI), using standard codons. Prediction of molecular weight and pI was obtained with Comput pI/MW (http://www.expasy.ch/tools/). Prediction of transmembrane segments on PfRACK used MEMSAT program [26]. Southern blotting. Genomic DNA was extracted from isolated parasites of an asynchronous asexual P. falciparum culture, digested by EcoRI and BamHI, and used in Southern blotting, according to standard procedures [27]. The sequence of PfRACK coding region was amplified by PCR, 32 P-labeled using Rediprime II random prime labeling system (Amersham–Pharmacia Biotech) and used as a probe. Expression and purification of recombinant PfRACK. Restriction sites for endonucleases BamHI and SacI were introduced in specific oligonucleotides (PfRACK-fw-BamHI and PfRACK-rv-SacI) to amplify the coding region of PfRACK by PCR. Amplified fragment was inserted in expression vector pET21-b (Novagen) in-frame with an amino-terminal T7-tag epitope and a carboxy-terminal hexahistidine. Expression of PfRACK in Escherichia coli BL21(DE3)pLysS was induced by 1 mM IPTG. Recombinant PfRACK was solubilized from inclusion bodies and purified by affinity Ni2þ –NTA Agarose chromatography (Qiagen). Antibodies. To produce polyclonal antibody, purified recombinant PfRACK was submitted to preparative SDS–PAGE (10% acrylamide). Gel pieces containing the recombinant protein were sliced and used as antigen. Antisera were raised in a rabbit by three inoculations with 50– 100 lg of recombinant PfRACK. Polyclonal anti-PfRACK antibody was affinity-purified using standard Western strip technique [28]. Western blotting. Asynchronous parasites were saponin-isolated in the presence of protease inhibitors (leupeptin, pepstatin A, antipain, and chymostatin at 20 lg ml1 and benzamidine at 0.5 mM). Isolated parasites were lysed in 20 mM Tris–HCl, pH 7.5, containing 2 mM EDTA, 250 mM sucrose, 0.1% Triton X-100, and protease inhibitors and centrifuged at 2000g for 2 min (4 °C) to pellet non-lysed parasites; supernatant was used as a source of total parasite proteins. Protein was quantified by Pierce BCA kit. Total parasite proteins (or affinity-purified recombinant PfRACK) were submitted to SDS–PAGE (10% acrylamide). After electrophoresis, proteins were transferred to nitrocellulose membrane, blocked overnight at 4 °C with 5% non-fat milk in PBS, and then incubated with anti-T7-tag mAb (Novagen—dilution 1:5000) or affinity-purified anti-PfRACK antibody (1:2) for 4 h or overnight, respectively. Subsequently, membranes were washed four times with 0.1% Tween 20 in PBS and incubated with secondary peroxidase-conjugated antibody. Peroxidase activity was detected by ECL technique (Amersham Life Science). Semi-quantitative RT-PCR. Parasites were synchronized by sorbitol treatment [29]. Parasites were saponin-isolated after 18, 24, and 50 h of sorbitol treatment, for extraction of total RNA by TRIzol method (Invitrogen). RNA was treated with RQ1 RNase-free DNase (Promega) in the presence of RNasin Ribonuclease inhibitor (Promega) for 1 h at 37 °C. Reverse transcriptions of 1 lg DNase-treated RNA sample from each stage were performed with SuperScript RT-II (Invitrogen), and three different dilutions of generated cDNA (5, 2, and 1) were used in a 30-cycle PCR for amplification of a 500 bp fragment of PfRACK coding region with primers PfGb-fw and PfRACK-r3. The same amount (5 ll) of each reaction product was submitted to electrophoresis in a 1.2% agarose gel and transferred to nylon membrane, which was hybridized with PfRACK probe (as in Southern-blot procedure). Image was analyzed by PhosphorImage (Molecular Dynamics, USA). Immunolocalization. Smears of P. falciparum infected red blood cells (IRBC) were fixed with 100% ice-cold methanol for 1 min and washed once with PBS. The slides were blocked and IRBC permeabilized with a solution of 3% BSA–0.05% saponin in PBS for 1 h at 37 °C, and incubated overnight at 4 °C with anti-PfRACK purified antibody diluted in 0.5 volume of 3% PBS–BSA. Subsequently, slides
L. Madeira et al. / Biochemical and Biophysical Research Communications 306 (2003) 995–1001 were washed three times with PBS and incubated with FITC-conjugated goat anti-rabbit IgG (dilution 1:200) for 30 min at room temperature. Imaging acquisition was performed with a LSM 510 laser scanning microscope (Carl Zeiss) using LSM 510 software, version 2.5. Image magnification was obtained with a 100 oil immersion objective. Samples were excited at 488 nm (for FITC) with an argon laser and the emitted fluorescence was collected using a 505–530 nm band pass filter.
997
Results Cloning and sequence analysis of PfRACK The full-length cDNA of PfRACK was obtained from P. falciparum mRNA using three sequence-specific oligonucleotides (PfGb-fw, -rv1, and -rv2; see Fig. 1A),
Fig. 1. Cloning and sequence of P. falciparum receptor for activated C kinase (PfRACK). (A) Schematic representation of the strategy that was used to clone the full-length transcript of PfRACK from the 150 bp initial clone. The PfRACK specific oligonucleotides utilized in RACE 30 (Fw) and 50 (RV1 and 2) and the respective fragments obtained are shown. (B) Fragments amplified by PCR (lane 1) and nested-PCR (lane 2) with RACE 30 and 50 protocols, respectively, as described in Materials and methods. Arrows point to the fragments that constituted a single contig sequence for PfRACK full-length cDNA. (C) Nucleotide and deduced aminoacid sequences of the PfRACK. Solid rectangle encloses the consensus sequence for ribosomal binding in mRNA. In bold, the presumed translational start and terminal sites, and asterisk marks the stop codon. Underlined is the codon that is interrupted by the single intron of PfRACK gene. Solid and dotted circles enclose the putative domains for binding of RACK to PKC, which are present in repeats III and VI, respectively. Dotted rectangles enclose three putative polyadenylation signal sequences—note that the last two are superimposed.
998
L. Madeira et al. / Biochemical and Biophysical Research Communications 306 (2003) 995–1001
which were designed to perform the RACE technique, as described under Materials and methods. Two fragments of approximately 500 and 900 bp obtained by 50 and 30 RACE, respectively (Fig. 1B), constituted a contig sequence of 1.4 kb that showed high degree of identity to receptors for activated C kinase (RACKs) from several organisms (see Table 1). The predicted open reading frame (ORF) of 972 bp codes for a 323 residue protein (Fig. 1C), which was named PfRACK—P. falciparum receptor for activated C kinase. It has a molecular weight of 35.8 kDa and pI 6.38, and according to the prediction obtained with the MEMSAT program [26] it does not possess any transmembrane hydrophobic stretch of aminoacids. The cDNA 50 UTR possesses a consensus sequence for ribosomal binding to mRNA (AAATAAA) immediately before the ATG start codon, which may be important for gene transcription (Fig. 1C). Three possible polyadenylation sites are postulated to be present at the cDNA 30 UTR, the last one located 57 bases upstream from the poly(A) tail (Fig. 1C). PfRACK genomic sequence was amplified by PCR from P. falciparum genomic DNA (see Materials and methods), and the resulting fragment revealed the presence of a 572 bp intron, which interrupts the coding region at the 44th codon (GAT) and is flanked by 50 GT and 30 AT typical splicing sites. A high A + T content was observed for this intron (80.6%) in contrast to the coding region (66.7%). Using the coding region of PfRACK as a probe in Southern blot of P. falciparum genomic DNA digested with EcoRI and BamHI endonucleases, which do not cleave the cDNA sequence, a unique band was observed with both single and double digestions, suggesting that PfRACK is a single copy gene (Fig. 2). These data are in line with the result of BLASTn using the P. falciparum Genome Databank (PlasmoDB), where it was found that this gene is located in chromosome 8 of the parasite. PfRACK protein has seven conserved cores of repeating units that fit to the conserved pattern [GH– X23–41 –WD] described for WD-40 repeats by Neer et al.
Fig. 2. Southern blot using genomic DNA from P. falciparum and the radiolabeled ORF sequence of PfRACK as probe. EcoRI and BamHI refer to the different enzymes used (+) or not ()) to digest the genomic DNA.
Fig. 3. Comparison of PfRACK transcription levels in different stages of P. falciparum intraerythrocytic stages by using semi-quantitative RT-PCR. Parasites were isolated 50 (R: ring), 18 (T: trophozoite), and 24 h (S: young schizont) after sorbitol synchronization, and total RNA was extracted and DNase treated. Equal amounts of total RNA (1 lg) from each stage were used in reverse transcription reactions, and cDNAs generated were used as template for PCRs in three dilutions (5, 2, and 1 for lanes 1–3, respectively), for amplification of a PfRACK fragment. Aliquots of 5 ll from each reaction were submitted to electrophoresis in agarose gel, transferred to nitrocellulose membranes, and hybridized with PfRACK coding region as a probe.
[30]. Comparison of PfRACK with the sequence of rat RACK1 showed that two domains in repeats III and VI (r-III and -VI) that are important for RACK1 binding
Table 1 Top 10 proteins with highest identities to the deduced PfRACK amino acid sequence Protein
Organism
Accession Nos.
Identity (%)
E value
Cblp RACK RACK RACK1 G protein b subunit-like G protein b2 subunit-like1 RACK1 RACK1 RACK RACK
C. reinhardtii D. rerio Oreochromis niloticus Euprymna scolopes Mus musculus Homo sapiens Gallus gallus Rattus norvegicus Hydra vulgaris Xenopus laevis
P25387 NP_571519 AAB81618 AAF22119 I49700 NP_006089 P25388 NP_570090 Q25189 AF105259
59 60 59 60 59 59 59 58 58 58
3e ) 106 1e ) 98 1e ) 98 5e ) 98 6e ) 98 8e ) 98 9e ) 98 2e ) 97 4e ) 97 7e ) 97
Comparison by BLASTp to the nr database (GenBank).
L. Madeira et al. / Biochemical and Biophysical Research Communications 306 (2003) 995–1001
999
to protein kinase C (PKC) [11] are almost totally conserved in PfRACK, with two conservative substitutions in r-III (Leu ! Phe; Ala ! Ser), two in r-VI (Asp ! Ser; Ala ! Ser), and a single non-conservative substitution in r-VI (Ile ! Thr) (see Fig. 1). PfRACK expression and immunolocalization The transcription levels of PfRACK mRNA in P. falciparum parasites isolated after 18 (trophozoite), 24 (young schizont), and 50 h (ring) of sorbitol synchronization were investigated by semi-quantitative RTPCR. Fig. 3 shows that PfRACK is constitutively transcribed in all these stages, apparently maintaining similar transcription levels along the intraerythrocytic cycle. This result demonstrates that PfRACK could be used as a control marker gene for constitutive transcription in this part of the asexual life cycle, a characteristic that is very difficult to find among Plasmodium genes, which in general are differentially expressed along the intraerythrocytic stages [31].
Fig. 4. Analysis of production and purification of polyclonal antiPfRACK antibodies. (A) Purified recombinant PfRACK is recognized by anti-T7-tag mAb and by both anti-PfRACK serum and affinitypurified antibody. Lane 1: Coomassie blue-stained SDS–PAGE of purified recombinant PfRACK. Lanes 2–4: corresponding Western blots labeled with anti-T7-tag mAb (lane 2), immune serum antiPfRACK (lane 3), and affinity-purified anti-PfRACK antibody (lane 4). (B) Affinity-purified anti-PfRACK antibody recognizes specifically the native PfRACK in total protein extracts of intraerythrocytic P. falciparum. Lane 1: Coomassie blue-stained SDS–PAGE of total parasite proteins. Lane 2: corresponding Western blot developed with affinity-purified anti-PfRACK antibody.
Fig. 5. Immunolocalization of PfRACK in P. falciparum intraerythrocytic stages. (R) ring, (T) trophozoite, and (S) schizont. Methanol-fixed infected erythrocytes were blocked with BSA and incubated with affinity-purified anti-PfRACK antibody. Fluorescence measurements obtained with confocal microscopy correspond to secondary FITC anti-rabbit IgG antibody emission. (A) Phase contrast; (B) immunofluorescence; and (C) merged image.
1000
L. Madeira et al. / Biochemical and Biophysical Research Communications 306 (2003) 995–1001
In order to investigate PfRACK cellular localization in different intraerythrocytic stages of P. falciparum, we directionally cloned the coding region of PfRACK in vector pET-21b (Novagen) in-frame with an aminoterminal T7-tag and a carboxy-terminal hexahistidine, creating a recombinant PfRACK with a predicted molecular weight of 39.1 kDa. The expressed protein was purified from E. coli inclusion bodies and subsequently used for generating a rabbit polyclonal anti-PfRACK antibody. Western-blot analysis demonstrated that purified PfRACK was recognized by anti-T7-tag mAb and by anti-PfRACK antibody (Fig. 4A). Furthermore, Western blot with total parasite proteins showed that the affinity-purified anti-PfRACK antibody recognizes specifically a single 34.6 kDa protein band (Fig. 4B). The affinity-purified anti-PfRACK antibody was used for immunolocalization of PfRACK in the intraerythrocytic stages of P. falciparum, using confocal microscopy. Fig. 5 shows an increase of fluorescence accompanying the development of the parasite, from ring up to schizont stage, revealing that PfRACK expression occurs along the whole intraerythrocytic life cycle. Negative controls without primary antibodies resulted in no labeling in erythrocytes or parasites (data not shown).
Discussion In the present work a receptor for activated C kinase (RACK) ortholog was cloned in P. falciparum malaria parasite. Its predicted protein, named PfRACK, presents seven Trp–Asp repetitive motifs and belongs to the ancient family of WD-repeat proteins, which includes regulatory proteins that participate in a broad range of cellular processes [30]. RACKs play a fundamental role in eukaryotic cells, acting as scaffold proteins that approximate enzymes and their substrates in specific subcellular sites [15]. Semi-quantitative RT-PCR was used to quantify the transcription levels of PfRACK during the development of P. falciparum in erythrocyte, and it was found that PfRACK is constitutively transcribed in all intraerythrocytic stages (Fig. 3). In addition, immunolocalization studies revealed that PfRACK abundance apparently increases along the maturation process of P. falciparum. PfRACK shows higher similarity to RACK1 than RACK2 and has the two conserved domains important for PKC binding, which suggests a potential cellular function. Up to the moment, a canonical Plasmodium PKC has not been identified in the genome, although about 60% of its predicted proteins did not have similarity to any proteins in other organisms [32]. It is worth noting that other parasites also display RACK orthologs: Leishmania infantum, Crithidia fas-
ciculata, and Trypanosoma brucei [17,19–21]. The cellular function of RACK orthologs in Trypanosomatidea begins to be delineated. Using a genetically encoded peptide library, Gonzalez-Aseguinolaza et al. [21] found that L. infantum RACK specifically binds several phage clones encoding aminoacid sequences that are present in DNA and RNA polymerases, DNA regulation and binding proteins, and in the b-chain of MHC class II, suggesting a role for RACK in the control of cellular division and in the early events of the antigen-presentation mechanism. Trypanosoma brucei rhodesiense RACK transcripts were found to be up-regulated in procyclic forms during ConA-induced apoptosis, and in terminally differentiated bloodstream forms of these parasites [19,20]. These forms have stopped division and thus the survival relies on ingestion by insect vector. The authors propose that apoptotic process may be essential to remove these Ôstumpy formÕ parasites from mammalian bloodstream, avoiding a massive parasite lysis and subsequent immune responses [19]. The present finding of a receptor for activated C kinase ortholog being expressed in all intraerythrocytic stages of P. falciparum suggests an essential role for this protein in malaria parasitesÕ asexual life cycle. In view of the importance of RACKs in many aspects of cell cycle in all eukaryotes, and its interaction with a broad range of signaling proteins, further studies to elucidate its intracellular mechanisms in Plasmodium are granted.
Acknowledgments This research was funded by grants from Fundacßa~o de Amparo a Pesquisa do Estado de S~ao Paulo (FAPESP) to C.R.S.G. and S.V.A., and from Conselho Nacional de Desenvolvimento Cientıfico e Tecnol ogico (CNPq) to S.V.A., L.M., R.D., and M.L.G. received fellowships from FAPESP.
References [1] O. Billker, V. Lindo, M. Panico, A.E. Etienne, T. Paxton, A. Dell, M. Rogers, R.E. Sinden, H.R. Morris, Identification of xanthurenic acid as the putative inducer of malaria development in the mosquito, Nature 392 (1998) 289–292. [2] G.E. Garcia, R.A. Wirtz, J.R. Barr, A. Woolfitt, R. Rosenberg, Xanthurenic acid induces gametogenesis in Plasmodium, the malaria parasite, J. Biol. Chem. 273 (1998) 12003–12005. [3] C.T. Hotta, M. Gazarini, F.H. Beraldo, F.P. Varotti, C. Lopes, R.P. Markus, T. Pozzan, C.R.S. Garcia, Calcium-dependent modulation by melatonin of the circadian rhythm in malarial parasites, Nat. Cell Biol. 2 (2000) 466–468. [4] C.R.S. Garcia, R.P. Markus, L. Madeira, Tertian and quartan fevers: temporal regulation in malarial infection, J. Biol. Rhythms 16 (2001) 436–443. [5] C.R.S. Garcia, Calcium homeostasis and signaling in the bloodstage malaria parasite, Parasitol. Today 15 (1999) 488–491. [6] M.L. Gazarini, A.P. Thomas, T. Pozzan, C.R.S. Garcia, Calcium signaling in a low calcium environment: how the intracellular
L. Madeira et al. / Biochemical and Biophysical Research Communications 306 (2003) 995–1001
[7]
[8]
[9]
[10]
[11]
[12]
[13] [14]
[15] [16]
[17]
[18]
[19]
malaria parasite solves the problem, J. Cell Biol. 161 (2003) 103– 110. F.P. Varotti, F.H. Beraldo, M.L. Gazarini, C.R.S. Garcia, Plasmodium falciparum malaria parasites display a THG-sensitive Ca2þ pool, Cell Calcium 33 (2003) 137–144. F. Kawamoto, R. Alejo-Blanco, S.L. Fleck, Y. Kawamoto, R.E. Sinden, Possible roles of Ca2þ an cGMP as mediators of the exflagellation of Plasmodium berghei and Plasmodium falciparum, Mol. Biochem. Parasitol. 42 (1990) 461–480. D.J. Carucci, A.A. Witney, D.K. Muhia, D.C. Warhurst, P. Schaap, M. Meima, J.L. Li, M.C. Taylor, J.M. Kelly, D.A. Baker, Guanylyl cyclase activity associated with putative bifunctional integral membrane proteins in Plasmodium falciparum, J. Biol. Chem. 275 (2000) 22147–22156. S.K. Martin, M. Jett, I. Scheneider, Correlation of phosphoinositide hydrolysis with exflagellation in the malaria microgametocyte, J. Parasitol. 80 (1994) 371–378. A.P. Passos, C.R.S. Garcia, Inositol 1,4,5-trisphosphate induced Ca2þ release from chloroquine-sensitive and -insensitive intracellular stores in the intraerythrocytic stage of the malaria parasite P. chabaudi, Biochem. Biophys. Res. Commun. 245 (1998) 155– 160. D. Ron, C.H. Chen, J. Caldwell, L. Jamieson, E. Orr, D. MochlyRosen, Cloning of an intracellular receptor for protein kinase C: a homolog of the b subunit of G proteins, Proc. Natl. Acad. Sci. USA 91 (1994) 839–843. A.C. Newton, Protein kinase C: structure, function and regulation, J. Biol. Chem. 270 (1995) 28495–28498. M. Csukai, C.H. Chen, M.A. DeMatteis, D. Mochly-Rosen, The coatomer protein b0 -COP, a selective binding protein (RACK) for protein kinase Ce, J. Biol. Chem. 272 (1997) 29200–29206. D. Schechtman, D. Mochly-Rosen, Adaptor proteins in protein C-mediated signal transduction, Oncogene 20 (2001) 6339–6347. J.A. Schloss, A Chlamydomonas reinhardtii gene encodes a G protein b subunit-like polypeptide, Mol. Gen. Genet. 221 (1990) 443–452. S. Taladriz, G. Gonzalez-Aseguinolaza, A. Marquet, V. Larraga, Cloning, molecular analysis and differential cell localization of the p36 RACK homologue antigen from the parasite protozoon Crithidia fasciculata, FEBS Lett. 443 (1999) 375–380. M. Won, S.K. Park, K.L. Hoe, Y.H. Jang, K.S. Chung, D.U. Kim, H.B. Kim, H.S. Yoo, Rkp1/Cpc2, a fission yeast RACK1 homolog, is involved in actin cytoskeleton organization through protein kinase C, Pck2, signaling, Biochem. Biophys. Res. Commun. 282 (2001) 10–15. S.C. Welburn, N.B. Murphy, Prohibitin and RACK homologues are up-regulated in trypanosomes induced to undergo apoptosis and in naturally occurring terminally differentiated forms, Cell. Death Diff. 5 (1998) 615–622.
1001
[20] K.R. Matthews, K. Gull, Identification of stage-regulated and differentiation-enriched transcripts during transformation of the African trypanosome from its bloodstream to procyclic form, Mol. Biochem. Parasitol. 95 (1998) 81–95. [21] G. Gonzalez-Aseguinolaza, S. Taladriz, A. Marquet, V. Larraga, Molecular cloning, cell localization and binding affinity to DNA replication proteins of the p36/LACK protective antigen from Leishmania infantum, Eur. J. Biochem. 259 (1999) 909–916. [22] W. Trager, J.B. Jensen, Human malaria parasites in continuous culture, Science 193 (1976) 673–675. [23] B. Ewing, L. Hillier, M.C. Wendl, P. Green, Base-calling of automated sequencer traces using phred. I. Accuracy assessment, Genome Res. 8 (1998) 175–185. [24] B. Ewing, P. Green, Base-calling of automated sequencer traces using phred. II. Error Probabilities, Genome Res. 8 (1998) 186–194. [25] S.F. Altschul, T.L. Madden, A.A. Sch€affer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389–3402. [26] D.T. Jones, W.R. Taylor, J.M. Thornton, A model recognition approach to the prediction of all-helical membrane protein structure and topology, Biochemistry 33 (1994) 3038–3049. [27] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, second ed., Cold Spring Harbor, New York, 1989. [28] A. Adisa, F.R. Albano, J. Reeder, M. Foley, L. Tilley, Evidence for a role for a Plasmodium falciparum homologue of Sec31p in the export of proteins to the surface of malaria parasite-infected erythrocytes, J. Cell Sci. 114 (2001) 3377–3386. [29] C. Lambros, J.P. Vanderberg, Synchronization of Plasmodium falciparum erythrocytic stages in culture, J. Parasitol. 65 (1979) 41–45. [30] E.J. Neer, C.J. Schmidt, R. Nambudripad, T.F. Smith, The ancient regulatory-protein family of WD-repeat proteins, Nature 371 (1994) 297–300. [31] E. Calvo, C. Rubiano, A. Vargas, M. Wasserman, Expression of housekeeping genes during the asexual cell cycle of Plasmodium falciparum, Parasitol. Res. 88 (2002) 267–271. [32] M.J. Gardner, N. Hall, E. Fung, O. White, M. Berriman, R.W. Hyman, J.M. Carlton, A. Pain, K.E. Nelson, S. Bowman, I.T. Paulsen, K. James, J.A. Eisen, K. Rutherford, S.L. Salzberg, A. Craig, S. Kyes, M.S. Chan, V. Nene, S.J. Shallom, B. Suh, J. Peterson, S. Angiuoli, M. Pertea, J. Allen, J. Selengut, D. Haft, M.W. Mather, A.B. Vaidya, D.M. Martin, A.H. Fairlamb, M.J. Fraunholz, D.S. Roos, S.A. Ralph, G.I. McFadden, L.M. Cummings, G.M. Subramanian, C. Mungall, J.C. Venter, D.J. Carucci, S.L. Hoffman, C. Newbold, R.W. Davis, C.M. Fraser, B. Barrell, Genome sequence of the human malaria parasite Plasmodium falciparum, Nature 419 (2002) 498–511.
