Increased c-myb mRNA Expression in Barrett\'s Esophagus and Barrett\'s-Associated Adenocarcinoma

Journal of Surgical Research 99, 301–306 (2001) doi:10.1006/jsre.2001.6186, available online at http://www.idealibrary.com on

Increased c-myb mRNA Expression in Barrett’s Esophagus and Barrett’s-Associated Adenocarcinoma Jan Brabender, M.D.,* ,§ ,1 Reginald V. Lord, M.D.,† Kathleen D. Danenberg, M.S.,* Ralf Metzger, M.D.,§ Paul M. Schneider, M.D.,§ Ji Min Park, M.S.,* Dennis Salonga, M.S.,* Susan Groshen, Ph.D.,‡ Denice D. Tsao-Wei, Ph.D.,‡ Tom R. DeMeester, M.D.,† Arnulf H. Ho¨lscher, M.D.,§ and Peter V. Danenberg, Ph.D.,* *Department of Biochemistry and Molecular Biology, †Department of Surgery, and ‡Department of Biostatistics and Epidemiology, USC/Norris Comprehensive Cancer Center, University of Southern California Keck School of Medicine, Los Angeles, California 90033; and §Department of Visceral and Vascular Surgery, University of Cologne 50931, Germany Submitted for publication January 9, 2001; published online May 14, 2001

Background. Esophageal adenocarcinoma develops through a multistage process which is characterized histopathologically by progression from Barrett’s intestinal metaplasia to Barrett’s esophagus with dysplasia and ultimately to adenocarcinoma. The genetic basis of this process is increasingly well understood, but no studies have examined the role of the transcription factor c-myb in this disease. Material and methods. c-myb mRNA expression levels were measured using a quantitative reverse transcription-polymerase chain reaction (RT-PCR) method in specimens of Barrett’s intestinal metaplasia (n ⴝ 16), adenocarcinoma (n ⴝ 22), matching normal squamous esophagus tissues (n ⴝ 38), and normal squamous esophagus tissues from patients without Barrett’s esophagus or chronic gastroesophageal reflux disease (n ⴝ 10). Results. The median c-myb mRNA expression levels were significantly increased in Barrett’s intestinal metaplasia tissues compared to normal esophagus tissues (P ⴝ 0.013) and in Barrett’s-associated adenocarcinoma tissues compared to normal squamous esophagus tissues (P ⴝ 0.001). The c-myb expression levels increased progressively and significantly in histopathologically worse tissue types, with an increase from normal squamous esophagus mucosa to Barrett’s intestinal metaplasia, and from Barrett’s intestinal metaplasia to adenocarcinoma of the esophagus (P ⴝ 0.002). Median c-myb expression levels were also significantly higher in histologically normal squamous 1 To whom correspondence should be addressed at USC/Norris Comprehensive Cancer Center, 1441 Eastlake Avenue, NOR 5318, Los Angeles, CA 90033. Fax: (323) 865-0105. E-mail: [email protected].

esophagus tissues from cancer patients compared to normal esophagus tissues from patients without cancer (P < 0.001) and a control group without evidence of Barrett’s esophagus or gastroesophageal reflux disease (P ⴝ 0.003). Very high c-myb mRNA expression levels were found only in patients with cancer. Conclusion. These findings suggest that upregulation of c-myb mRNA expression is an early event in the development of Barrett’s esophagus and associated adenocarcinoma, that high c-myb mRNA expression levels may be a clinically useful biomarker for the detection of occult adenocarcinoma, and that a widespread cancer “field” effect is present in the esophagus of patients with Barrett’s-associated adenocarcinoma. © 2001 Academic Press Key Words: c-myb; gene expression; esophagus; Barrett’s esophagus; esophageal neoplasia; esophageal adenocarcinoma.

INTRODUCTION

The main risk factor for esophageal adenocarcinoma is the presence of Barrett’s esophagus, a disease in which the normal squamous lining of the distal esophagus is replaced by columnar epithelium in response to chronic gastroesophageal reflux [1, 2]. Barrett’s esophagus is a multistage disease in which Barrett’s intestinal metaplasia (IM) progresses in some patients to low-grade dysplasia, high grade dysplasia, and eventually adenocarcinoma. Although the survival statistics for esophageal cancer have improved considerably during the last decade, the long-term survival and cure rates for both adenocarcinoma and squamous cell car-

301

0022-4804/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

302

JOURNAL OF SURGICAL RESEARCH: VOL. 99, NO. 2, AUGUST 2001

cinoma of the esophagus remain among the lowest of all adult cancers [3]. Patients with known Barrett’s esophagus undergo regular surveillance endoscopy in order to detect cancers at an early stage [4]. The high incidence of occult adenocarcinomas found in esophagectomy specimens from patients who underwent resection for high grade dysplasia without a preoperative diagnosis of cancer shows that conventional histopathalogic methods can be insensitive for detecting cancer [4, 5]. Identification of biomarkers that are significantly associated with each Barrett’s stage and with an increased risk of progression to cancer would therefore be helpful for selecting patients with this disease who should undergo surgical resection or less invasive measures. The transcription factor c-myb has a well-defined role in the differentiation and proliferation of immature hemopoietic cells. c-myb is essential for the maintenance of immature cells of all lineages except megakaryocytes [6, 7], and decreased expression of c-myb is observed during maturation of cells along the myeloid and erythroid lineages [8, 9]. Expression studies indicate that c-myb downregulation is a prerequisite for differentiation in this lineages [8 –11]. Although c-myb expression was initially thought to be restricted to the hemopoietic system, it has subsequently been reported in nonhemopoietic tissues and cell lines, including lung, breast, colon carcinomas, neuroblastomas, osteogenic sarcomas, and melanomas [12]. Elevated levels of c-myb mRNA and protein expression have been detected in human colonic carcinomas and premalignant adenomatous polyps, suggesting that upregulated c-myb expression may lead to hyperproliferation of colonic mucosa and therefore plays an important role in the early neoplastic progression of colonic carcinogenesis [13, 14]. However, the role of c-myb mRNA expression in Barrett’s esophagus and associated adenocarcinoma has not been elucidated. The aim of this study was to assess the prevalence of c-myb mRNA expression in the development and progression of Barrett’s esophagus and associated adenocarcinoma, and to investigate the potential of c-myb quantitation in the clinical management of this disease. MATERIALS AND METHODS Tissue samples. Eighty-six tissue samples obtained at endoscopy and operation from 16 patients with Barrett’s intestinal metaplasia without adenocarcinoma (BE group), 22 patients with Barrett’sassociated esophageal adenocarcinoma (EA group), and 10 patients with no symptomatic, endoscopic, or histopathologic evidence of Barrett’s esophagus or chronic gastroesophageal reflux disease (control group) were collected and immediately frozen in liquid nitrogen. There were 31 men and 17 women, with a mean age of 58.3 years (range 24 to 76 years). Endoscopic biopsies were obtained according to a protocol that required biopsy at 2-cm intervals from each quad-

rant (anterior, posterior, and right and left lateral positions) of the visible length of Barrett’s mucosa and an additional biopsy from the normal appearing squamous mucosa of the esophagus. Normal esophagus biopsies were taken at least 4 cm proximal to the macroscopically abnormal epithelium. Part of the specimen or an adjacent specimen was fixed in formalin and paraffin for histopathological examination. Specimens were classified as intestinal metaplasia if intestinal metaplasia but no dysplasia or cancer was present. Only the highest grade pathologic lesion from each patient and a specimen of normal squamous epithelium were included in the study. Thus, Barrett’s dysplasia and intestinal metaplasia tissues from patients with adenocarcinoma were not included. Using these criteria, the following tissue samples were analyzed for c-myb mRNA expression: Barrett’s intestinal metaplasia (n ⫽ 16) and matching normal squamous tissue (n ⫽ 16) in the BE group, Barrett’s adenocarcinoma of the esophagus (n ⫽ 22) and matching normal squamous esophagus tissues (n ⫽ 22) in the EA group, and normal squamous esophagus tissues (n ⫽ 10) in the control group, for a total of 86 specimens. RNA extraction and cDNA synthesis. Total RNA was isolated by a single-step guanidinium isothiocyanate method using the QuickPrep Micro mRNA purification kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ) according to the manufacturer’s instructions [15]. Isolated mRNA was dissolved in 50 ␮l of 5 mmol/L Tris-HCl (pH 7.5). For cDNA synthesis, 20 ␮l 5X MMLV buffer (containing 250 mM Tris-HCl, pH 8.3; 375 mM KCl; 15 mM MgCl 2; Life Technologies, Gaithersburg, MD), 10 ␮l DTT (100 mM; Life Technologies), 10 ␮l dNTP (each 10 mM; Amersham Pharmacia Biotech), 0.5 ␮l random hexamers (50 OD dissolved in 550 ␮l of 10 mM Tris-HCl, pH 7.5, and 1 mM EDTA; Amersham Pharmacia Biotech), 2.5 ␮l BSA (3 mg/ml in 10 mM Tris-HCl, pH 7.5; Amersham Pharmacia Biotech), 2.5 ␮l RNAse inhibitor (5X 1000 units; Amersham Pharmacia Biotech), 5 ␮l MMLV reverse transcriptase (200 U/␮l; Life Technologies), added to a total volume of 50.5 ␮l. PCR quantification of mRNA expression. Quantitation of c-myb cDNA and an internal reference cDNA (␤-Actin) was done using a fluorescence detection method (ABI PRISM 7700 sequence detection system (Taqman) Perkin Elmer (PE) Applied Biosystems, Foster City, CA), as described [16, 17]. In brief, this method uses a duallabeled fluorogenic oligonucleotide probe that anneals specifically within the forward and reverse primers. Laser stimulation within the capped wells containing the reaction mixture causes emission of a 3⬘ quencher dye (TAMRA) until the probe is cleaved by the 5⬘ to 3⬘ nuclease activity of the DNA polymerase during PCR extension, causing release of a 5⬘ reporter dye (6FAM). Production of an amplicon thus causes emission of a fluorescent signal that is detected by the Taqman’s CCD (charge-coupled device) detection camera, and the amount of signal produced at a threshold cycle within the purely exponential phase of the PCR reflects the starting copy number of the sequence of interest. Comparison of the starting copy number of the sequence of interest with the starting copy number of the reference gene provides a relative gene expression level. The PCR mixture consisted of 600 nM of each primer (Table 1), 200 nM probe (Table 1), 5 U AmpliTaq Gold Polymerase, 200 ␮M each dATP, dCTP, dGTP, 400 ␮M dUTP, 5.5 mM MgCl 2, and 1X Taqman Buffer A containing a reference dye, to a final volume of 25 ␮l (all reagents Perkin Elmer). Cycling conditions were 50°C for 10 s, 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Statistical analysis. TaqMan analyses yield values that are expressed as ratios between two absolute measurements (gene of interest/internal reference gene). c-myb expression levels in adenocarcinoma, Barrett’s intestinal metaplasia, and normal squamous esophagus tissues were compared using the Kruskal-Wallis test to identify significant differences in expressions among the histopathologic groups. The Kruskal-Wallis test was also used to compare the three groups of normal esophagus tissues. When the overall KruskalWallis test (comparing three groups) was significant at the 0.05 level,

BRABENDER ET AL.: c-myb EXPRESSION IN BARRETT’S ESOPHAGUS

TABLE 1 PCR Primers and Probes Forward primer: c-myb 1012F [23 bp] a Sequence: TGCTCCTAATGTCAACCGAGAAT Reverse primer: c-myb 1147R [22 bp] Sequence: ACAGGTGCACTGTCTCCATGAG TaqMan probe: c-myb 1046T [29 bp] Sequence: ACAGCAGGTGCTACCAACACAGAACCACA Forward primer: ␤-actin 592F [18 bp] Sequence: TGAGCGCGGCTACAGCTT Reverse primer: ␤-actin 651R [22 bp] Sequence: TCCTTAATGTCACGCACGATTT TaqMan probe: ␤-actin 611T [18 bp] Sequence: ACCACCACGGCCGAGCGG a

bp, base pairs.

pairwise comparisons were based on the Mann-Whitney test and the nominal P value was reported. The Wilcoxon signed-rank test was used for comparison of paired tissues. Statistical significance (with two-sided tests) was set at the 0.05 level.

RESULTS

c-myb mRNA expression was observed by RT-PCR in 83 of 86 (96.5%) samples analyzed. Only three tissue samples, comprising two normal squamous esophagus and one adenocarcinoma tissues showed no detectable c-myb mRNA expression. The median values and ranges of c-myb mRNA expression in tissues from patients with adenocarcinoma of the esophagus (n ⫽ 22), Barrett’s intestinal metaplasia (n ⫽ 16), and no evidence of Barrett’s esophagus (n ⫽ 10) are shown in Table 2. Figure 1 shows that c-myb expression levels increased progressively and significantly in histopathologically worse tissue types, with an increase from normal squamous esophagus mucosa to Barrett’s intestinal metaplasia, and from Barrett’s intestinal metaplasia to adenocarcinoma of the esophagus (P ⫽ 0.002, Kruskal-Wallis test, comparing three groups). As shown in Fig. 1, the median c-myb expression was significantly higher in Barrett’s tissues compared to matching normal esophagus tissue from patients without cancer (P ⫽ 0.013, Wilcoxon test) and in adenocarcinoma tissues compared to normal squamous esophagus tissues (P ⫽ 0.001, Mann-Whitney test). Very high c-myb expression levels ([c-myb/␤-Actin] greater than 4.8) were only detected in patients with adenocarcinoma. These very high levels were detected 3 of 22 patients, including 2 patients with high expression levels in both tissues examined. Overall, the three groups of normal esophagus tissue revealed substantial differences in c-myb expression levels (P ⬍ 0.001, Kruskal-Wallis test). The median c-myb mRNA expression in the group of histologically normal squamous esophagus tissues from patients

303

with adenocarcinoma (n ⫽ 22; median expression, 0.745; range, 0.00 –2.51) was significantly higher than the median c-myb expression found in normal squamous esophagus tissues from patients with Barrett’s esophagus only (n ⫽ 16, median expression, 0.355; range, 0.00 – 0.65; P ⬍ 0.001; Mann-Whitney test) and normal squamous esophagus tissues obtained from the control group (n ⫽ 10; median expression, 0.23; range, 0.17– 0.77; P ⫽ 0.003; Mann-Whitney test; Fig. 2). DISCUSSION

This study demonstrates that c-myb mRNA expression is upregulated in Barrett’s esophagus and Barrett’s-associated esophageal adenocarcinomas. c-myb expression was increased even in Barrett’s intestinal metaplasia tissues, indicating that induction of the expression of this gene is an early event in the Barrett’s adenocarcinoma progression. There was considerable variation of c-myb mRNA expression levels in tissues at each Barrett’s stage, but analysis of grouped results showed that there was a significant progressive elevation of c-myb expression through the stages of Barrett’s intestinal metaplasia to adenocarcinoma of the esophagus. Our findings complement the results of previous studies that found increased c-myb expression in various types of tumors and premalignant gastrointestinal tissues. Torelli et al. reported increased c-myb RNA expression in 6 of 10 analyzed human colon carcinoma tissues [14]. Ramsay et al. found elevated c-myb protein expression in all colon carcinoma samples investigated. c-myb levels in adenomatous colon polyps were intermediate between matching normal and tumor tissues, with higher levels in the more dysplastic polyps [13]. These results suggest that upregulation of c-myb expression is a somewhat specific effect leading to hyperproliferation rather than simply a function of generalized inflammation. The likelihood that c-myb plays a crucial role in human neoplastic transformation is also supported by studies which implicated c-myb in the regulation of cell survival during hematopoiesis via induction of bcl-2 gene expression [18 –21]. Thompson et al. demonstrated a decrease in c-myb expression during the commitment of human colon cells during differentiation and proliferation [22]. Decreased levels of c-myb were accompanied by a decrease in bcl-2 expression, suggesting that the transcription factor c-myb has a crucial role in regulating the balance between proliferation, differentiation, and apoptosis in the colonic crypt. Furthermore, they hypothesized that elevated c-myb levels lead to persistence of bcl-2 expression, thus protecting cells from programmed cell death [22]. It has also been reported that inhibition of c-myb expression using antisense oligonucleotide treatment in human

304

JOURNAL OF SURGICAL RESEARCH: VOL. 99, NO. 2, AUGUST 2001

TABLE 2 c-myb mRNA Expression Levels in Different Tissues c-myb expression Pathology

n

EA group Adenocarcinoma Normal esophagus BE group Intestinal metaplasia Normal esophagus Control group Normal esophagus

22

Median

Range

Percentiles (25th–75th)

P*

1.11 0.75

0.00–5.93 0.00–2.51

0.45–3.40 0.56–0.97

n.s.

0.73 0.35

0.05–4.75 0.00–0.65

0.33–1.18 0.17–0.48

0.013

0.23

0.17–0.77

0.18–0.33

16

10

Note. EA (adenocarcinoma group), BE (Barrett’s esophagus group). *Based on Wilcoxon signed-rank test for paired samples.

colon carcinoma cell lines resulted in inhibition of malignant cell growth and reduced tumor burden [23]. Our finding that very high levels of c-myb mRNA expression ratios were found only in patients with cancer indicates that c-myb expression quantitation might be a clinically useful biomarker for the diagnosis of malignancy in patients with Barrett’s esophagus. We anticipate that analysis of a larger dataset might lead to the identification of precise threshold levels above which the likelihood that tumor is present can be estimated with some accuracy. The molecular diagnosis and staging of Barrett’s esophagus and Barrett’sassociated adenocarcinoma will require the assessment of a panel of other genes. Studies from this insti-

tution and elsewhere suggest that there are at least several other genes that have significantly different expression or mutation frequencies at different Barrett’s stages [24 –30]. c-myb expression levels in this study were significantly higher in the group of histologically normal squamous esophagus tissues from patients with cancer (EA group) compared with the group of histologically normal squamous esophagus tissues from patients without cancer (BE group) and no evidence of Barrett’s esophagus or chronical gastroesophageal reflux (control group). This may indicate that genetic changes in histologically normal tissue precede the appearance of morphologic changes in this disease. The normal

FIG. 1. Box and whisker plots of relative c-myb mRNA expression levels for each histologic subtype. The boxes show the 25th and 75th percentile (interquartile) ranges. Median values are shown as a horizontal black bar within each box. The whiskers show levels outside the 25th and 75th percentiles but exclude far outlying values, which are shown above the boxes. The zero mark for relative c-myb expression on the vertical axis has been elevated to allow the lower limits of the boxes and whiskers to be seen.

BRABENDER ET AL.: c-myb EXPRESSION IN BARRETT’S ESOPHAGUS

305

FIG. 2. Box and whisker plots of relative c-myb mRNA expression levels for normal squamous esophagus tissues from patients with adenocarcinoma of the esophagus (EA group), patients with Barrett’s esophagus (BE group), and a control group without evidence of Barrett’s esophagus or chronical gastroesophageal reflux disease (control group).

esophagus biopsies were from areas that were well separate from macroscopic disease, indicating further that there is probably a very widespread oncogenic “field” effect in the esophagus in cancer patients. We have found similar evidence for the presence of a cancer field in patients with esophageal adenocarcinoma in studies of telomerase reverse transcriptase (hTERT) and retinoic acid receptor (RAR) mRNA expression [24, 27, 29]. The presence of a field effect should theoretically increase the usefulness of gene expression measurements as biomarkers for cancer detection in Barrett’s esophagus, because finding a very high or “cancerlevel” c-myb expression level in any area of the esophagus, even in histologically normal squamous epithelium, could suggest the presence of an occult cancer. In this study, we used a recently developed real-time PCR method (Taqman) [16, 17] for quantitation of c-myb mRNA expression. Although competitive PCR technologies have been advanced to perform quantitation [31, 32] they are difficult to perform with great facility and accuracy. The method is based on real-time analysis of PCR amplification and has several advantages over other quantitative PCR methods [33]. The real-time PCR method does not require post-PCR sample handling, thereby avoiding problems related to carryover. It has a high sample throughput and possesses a wide dynamic range, meaning that the samples do not have to contain equal starting amounts of total DNA. Finally, real-time PCR makes DNA quantitation much more precise and reproducible, being based on C t

values established in the early exponential phase of PCR, when none of the reagents is rate-limiting, rather then end point measurements of the amount of accumulated PCR product. Real-Time PCR has high intraassay and interassay reproducibility and gives statistically confident values. CONCLUSION

Upregulation of c-myb mRNA expression is an early event in the Barrett’s multistage process. There was a progressive, significant increase in c-myb expression through the stages of Barrett’s intestinal metaplasia to adenocarcinoma of the esophagus. The presence of cancer is associated with an extensive field effect in the esophagus. All patients with very high c-myb expression levels had cancer, suggesting that c-myb quantification may be clinically useful for the detection of occult cancer in patients with Barrett’s esophagus. REFERENCES 1.

Spechler, S. J., Goyal, R. K. Barrett’s esophagus. N. Engl. J. Med. 315: 362, 1986. 2. Cameron, A. J., and Lomboy, C. T. Barrett’s esophagus: Age, prevalence, and extent of the columnar epithelium. Gastroenterology 103: 1241, 1992. 3. Greenlee, R. T., Murray, T., Bolden, S., and Wingo, P. A. Cancer statistics, 2000. CA. Cancer J. Clin. 50: 7, 2000. 4. Peters, J. H., Clark, G. W., Ireland, A. P., Chandrasoma, P., Smyrk, T. C., and DeMeester, T. R. Outcome of adenocarcinoma arising in Barrett’s esophagus in endoscopically surveyed and

306

5.

6. 7. 8.

9.

10.

11.

12. 13.

14.

15.

16. 17. 18.

19.

20.

21.

22.

JOURNAL OF SURGICAL RESEARCH: VOL. 99, NO. 2, AUGUST 2001 nonsurveyed patients. J. Thorac. Cardiovasc. Surg. 108: 813, 1994. Altorki, N. K., Sunagawa, M., Little, A. G., and Skinner, D. B. High-grade dysplasia in the columnar-lined esophagus. Am. J. Surg. 161: 97, 1991. Shen Ong, G. L. The myb oncogene. Biochim. Biophys. Acta 1032: 39, 1990. Weston, K. M. The myb genes. Semin. Cancer Biol. 1: 371, 1990. Mucenski, M. L., McLain, K., Kier, A. B., Swerdlov, S. H., Schreiner, C. M., Miller, T. A., Pietryga, D. W., Scott, W. J. J., and Potter, S. S. A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65: 677, 1991. Badiani, P., Corbella, P., Kioussis, D., Marvel, J., and Weston, K. Dominant interfering alleles define a role for c-myb in T-cell development. Genes Dev. 8: 770, 1994. Danish, R., el Awar, O., Weber, B., Langmore, J., Turka, L. A., Ryan, J. J., and Clarke, M. F. C-myb effects kinetic events during MEL cell differentiation. Oncogene 7: 901, 1992. Patel, G., Kreider, B., Rovera, G., and Reddy, E. P. V-Myb blocks granulocyte colony-stimulating factor-induced myeloid cell differentiation but not proliferation. Mol. Cell. Biol. 13: 2269, 1993. Thompson, M. A., and Ramsay, R. G. Myb: An old oncoprotein with new roles. Bioassays 17: 341, 1995. Ramsay, R. G., Thompson, M. A., Hayman, J. A., Reid, G., Gonda, T., and Whitehead, R. H. Myb expression is higher in malignant human colonic carcinoma and premalignant adenomatous polyps than in normal mucosa. Cell Growth Differ. 3: 723, 1992. Torelli, G., Venturelli, D., Colo, A., Zanni, C., Selleri, L., Moretti, L., Calabretta, B., and Torelli, U. Expression of c-myb protooncogene and other cell-cycle related genes in normal and neoplastic human colonic mucosa. Cancer Res. 47: 5266, 1987. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156, 1987. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. Real time quantitative PCR. Genome Res. 6: 986, 1996. Gibson, U. E., Heid, C. A., and Williams, P. M. A novel method for real time quantitative RT-PCR. Genome Res. 6: 995, 1996. Frampton, J., Ramquist, T., and Graf, T. v-Myb of E26 leukemia virus up-regulates bcl-2 and suppresses apoptosis in myeloid cells. Genes Dev. 10: 2720, 1996. Taylor, D., Badiani, P., and Weston, K. A. A dominant interfering Myb mutatant causes apoptosis in T-cells. Genes Dev. 10: 2732, 1996. Sala, A., Casella, I., Grasso, L., Bellon, T., Reed, J. C., Miyashita, T., and Peschle, C. Apoptotic response to oncogenic stimuli: Cooperative and antagonistic interactions between c-myb and the growth suppressor p53. Cancer Res. 56: 1991, 1996. Salomoni, P., Perrotti, D., Martinez, R., Francheschi, C., and Calabretta, B. Resistance to apoptosis in CTLL-2 cells constitutively expressing c-Myb is associated with induction of bcl-2 expression and Myb-dependent regulation of bcl-2 promoter activity. Proc. Natl. Acad. Sci. USA 94: 3296, 1997. Thompson, M. A., Rosenthal, M. A., Ellis, S. L., Friend, A. J., Zorbas, M. I., Whitehead, R. H., and Ramsay, R. G. c-myb down-regulation is associated with human colon cell differentiation, apoptosis, and decreased bcl-2 expression. Cancer Res. 58: 5168, 1998.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

Del Bufalo, D., Cucco, C., Leonetti, C., Citro, G., D’Agnano, I., Benassi, M., Geiser, T., Yon, G., Calabretta, B., and Zupi, G. Effect of Cisplatin and c-myb antisense posphorothioate oligodeoxynucleotides combination on a human colon carcinoma cell line in vitro and in vivo. Br. J. Cancer 74: 387, 1996. Lord, R. V., Salonga, D., Danenberg, K. D., Peters, J. H., DeMeester, T. R., Park, J. M., Johannson, J., Skinner, K. A., Chandrasoma, P., DeMeester, S. R., Bremner, C. G., Tsai, P. I., and Danenberg, P. V. Telomerase reverse transcriptase expression is increased early in the Barrett’s metaplasia, dysplasia, carcinoma sequence. J. Gastrointest. Surg. 4: 135, 2000. Schneider, P. M., Casson, A. G., Levin, B., Garewal, H. S., Hoelscher, A. H., Becker, K., Dittler, H. J., Cleary, K. R., Troster, M., Siewert, J. R., and Roth, J. A. Mutations of p53 in Barrett’s esophagus and Barrett’s cancer: A prospective study of ninety-eight cases. J. Thorac. Cardiovsc. Surg. 111: 323, 1996. Hayashi, K., Metzger, R., Salonga, D., Danenberg, K., Leichman, L. P., Fink, U., Sendler, A., Kelsen, D., Schwartz, G. K., Groshen, S., Lenz, H. J., and Danenberg, P. V. High frequency of simultaneous loss of p16 and p16beta gene expression in squamous cell carcinoma of the esophagus but not adenocarcinoma of the esophagus or stomach. Oncogene 15: 1481, 1997. Park, J. M., Danenberg, K. D., Lord, R. V., Peters, J. H., DeMeester, T. R., Bremner, C. G., Salonga, D., Kiyabu, M., Crookes, P., Hagen, J., DeMeester, S. R., Nazarian, A., Tsai, P. I., and Danenberg, P. V. Induction of vascular endothelial growth factor and basic fibroblast growth factor expression in Barrett’s esophagus and Barrett’s associated adenocarcinomas. Proc. Am. Assoc. Cancer Res. 40: A1519, 1999. Lord, R. V., Danenberg, K. D., Peters, J. H., DeMeester, T. R., Bremner, C. G., Salonga, D., Park, J. M., Tsai, P. I., Kiyabu, M., Johansson, J. L., Skinner, K., Theisen, J., Crookes, P., Hagen, J., DeMeester, S. R., Hamoui, N., Fernando, D., Singer, J., and Danenberg, P. V. Increased COX-2 and iNOS expression and decreased COX-1 expression in Barrett’s esophagus and Barrett’s associated adenocarcinomas. Proc. Annu. Meet. Am. Assoc. Cancer Res. 40: A2109, 1999. Lord, R. V., Tsai, P. I., Danenberg, K. D., Peters, J. H., DeMeester, T. R., Salonga, D., Park, J. M., Crookes, P. F., and Danenberg, P. V. Increase in retinoic acid receptor-␣ expression and decrease in retinoic acid receptor-␥ expression in the Barrett’s metaplasia, dysplasia, adenocarcinoma sequence. Surgery, 2000, in press. Brabender, J., Lord, R. V., Danenberg, K. D., Metzger, R., Schneider, P. M., Uetake, H., Kawakami, K., Park, J. M., Salonga, D., Peters, J. H., DeMeester, T. R., Ho¨lscher, A. H., and Danenberg, P. V. Upregulation of ornithine decarboxylase mRNA in Barrett’s esophagus and Barrett’s associated adenocarcinoma. J. Gastrointest. Surg., in press. Lubin, M. B., Elashoff, J. D., Wang, S. J., Rotter, J. I, and Toyoda, H. Precise gene dosage determination by polymerase chain reaction: Theory, methodology, and statistical approach. Mol. Cell. Probes 5: 301, 1991. Celi, F. S., Cohen, M. M., Antonarakis, S. E., Wertheimer, E., Roth. J., and Shuldiner, A. R. Determination of gene dosage by a quantitative adaption of the polymerase chain reaction (gdPCR): Rapid detection of deletions and duplications of gene sequences. Genomics 21: 304, 1994. Chiang, P. W., Beer, D. G., Wie, W. L., Orringer, M. B., and Kurnit, D. M. Detection of erbB-2 amplifications in tumors and sera from esophageal carcinoma patients. Clin. Cancer Res. 5: 1381, 1999.