Mdr1P-glycoprotein expression in natural killer (NK) cells enriched from peripheral or umbilical cord blood

Cancer Letters, 69 (1993) 139- 148 Elsevier Scientific Publishers Ireland

139 Ltd.

M&I/P-glycoprotein expression in natural killer (NK) cells enriched from peripheral or umbilical cord blood Annette Wilisch”, Andrea Nollera, Rupert Volkmar Niisslerd, Dietrich Niethammerb,

Handgretingerb, Stefan Weger’, Hans Probsta and Volker Gekeler”

aPhysiologisch-chemisches Insritut. Universitiit Tiibingen. 7400 Tiibingen, ‘Universitiitskinderklinik. Riimelinstra& 13, 7400 Tiibingen. ‘Deutsches Krebsforschungszenrrum, 6900 Heidelberg and dKIinikum Grophadern, 8000 Miinchen (Germany) (Received (Accepted

6 January 1993) 15 January 1993)

Summary The sensitivity to antineoplastic agents of subpopulations of haematopoietic cells during cancer chemotherapy is an open question. The performance of natural killer (NK) cells, possibly assisting the elimination of tumour cells under drug treatment might be of particular interest. We examined the expression of the transmembrane multidrug transporter m&l/P-glycoprotein in NKcells (CD567 enriched from the peripheral blood or the umbilical cord blood from healthy donors by indirect immunocytofluorescence using the monoclonal P-glycoprotein antibody C219 and a polymerase chain reaction (PCR) approach with amplimers specific for the human mdrl cDNA. As the antibody C219 apparently cross-reacts with the human mdr3 gene product whose functions are as yet unclear we also checked expression of this gene by PCR using mdr3 specific amplimers. Distinct, but rather inhomogeneous mdrl/P-glycoprotein expression was found in NK-cells enriched from the peripheral blood. NK-cells enriched from the umbilical cord blood showed quite strong mdrl expression levels throughout, exceeding the values found in the moderately multidrug-resistant cell line CCRF VCR 100 which is permanently Correspondence to; Volker Gekeler. Physiologisch-chemisches Institut, Universitlt Tiibingen, Hoppe-Seyler-StraOe 4, D-7400 Tiibingen, Germany. 0304-3835/93/$06.00 0 1993 Elsevier Scientific Printed and Published in Ireland

Publishers

Ireland

cultivated in the presence of 100 @ml vincristine. Mdrl/P-glycoprotein expression was mirrored by lowered sensitivities of the cultivated NK-cells towards actinomycin D or adriamycin. The drug sensitivity could be modulated by treatment of the cells with the immunosuppressive drug cyclosporin A. Expression of the mdr3 gene was low or absent in all NK-cell samples examined so far.

Keywords: P-glycoprotein; mdr genes; natural er cells; multiple drug resistance; cyclosporin

killA

Introduction Natural killer (NK) cells comprise 10-150/o of human peripheral blood lymphocytes. They represent a heterogeneous lymphoid, bone marrowderived cell population, mostly exhibiting the morphology of large granular lymphocytes. NK-cells are operationally defined by their ability to lyse certain target cells, i.e. tumour cells and virus infected cells, without major histocompatibility complex (MHC) restriction. Although their functions in vivo, i.e. in regulation of haematopoiesis, are not fully understood, NK-cells might be an important endogeneous factor in the rejection of tumours and prevention of metastases [16] which eventually could be used in adoptive immunotherapy for the treatment of cancer [24,25,30]. The impact of chemotherapy regimens on this leukocyte Ltd.

140

subpopulation might be of interest. The expression of the ATP-dependent drug efflux pump mdrllPglycoprotein which was shown to be functionally linked to the resistance of tumour cells to a variety of drugs in vitro [18] is discussed as one of the mechanisms conferring multiple drug resistance (MDR) to tumour cells in vivo [14,22,27]. In normal human tissues distinct variations of mdrl/Pglycoprotein expression were seen. Whereas high levels were found in tissues with excretory functions like kidney, liver, colon and the adrenal gland, mdrl expression was low or absent in spleen, bone marrow or lymphocytes [9,35]. Haematopoietic cells, however, represent a very heterogeneous population and the P-glycoprotein appears to be differentially expressed in some of them. Thus, the distinct expression of the Pglycoprotein multidrug transporter was seen in stromal macrophages of various human tumours [32] and in haematopoietic progenitor cells with highest levels in cells displaying characteristics of pluripotent stem cells (CD34+) [3]. Moreover, the elevated efflux activity for the dye rhodamine 123 which presumably is transported by the Pglycoprotein, was observed in a T-cell subset exhibiting cytotoxic qualities 1261. We, hence, analysed mdr gene expression and drug sensitivities in another species of haematopoietic cells possessing cytotoxic qualities, i.e. NK-cells which were immunochemically enriched as non-plastic adherent. CD56+ cells from peripheral or umbilical cord blood. Materials and Methods Cell lines The culturing and selection of multidrugresistant sublines of the human T-lymphoblastoid cell line CCRF-CEM (ATCC CCL 119) were described recently [ 10,271. The multidrugresistant sublines CCRF VCR 100 and CCRF ACTD 400 were permanently cultivated in the presence of 100 rig/ml vincristine, or 400 @ml actinomycin D, respectively. The human Tlymphoblastoid ceil line MOLT4B. a subline of MOLT4 (ATCC CRL 1582) and the human hepatoma cell line HepG2 (ATCC HB 8065) were kindly provided by the colleagues listed.

Enrichment of subsets of haematopoietic cells Of 50 ml peripheral blood from adult healthy donors or umbilical cord blood, the mononuclear cell fraction was obtained by standard FicollHypaque technique (Lymphoprep, Nycomed, Oslo, Norway). For enrichment of NK-cells according to 115,361 the mononuclear cells were depleted of monocytes by plastic adherence and further depleted of T- and B-lymphocytes by labelling with the monoclonal antibodies Leu4 (antiCD3; Becton-Dickinson, Heidelberg, Germany), Leu12 (anti-CD19; Becton-Dickinson), LeuM3 (anti-CD14; Becton-Dickinson) and anti-glycophorin (dianova, Hamburg, Germany) followed by incubation with goat-anti-mouse-coated immunobeads (dianova). Immunorosettes were removed by placing the cell suspension into a magnetic field generated by a permanent magnet (Miltenyi Biotec, Bergisch Gladbach, Germany). The isolated cells were checked for NK-enrichment by staining with the FITC-labeled antibody Leu19 (CD56; Becton-Dickinson) and analysis in a flow cytometer (FACScan; Becton-Dickinson). Enrichment of CD56+ cells was consistently ~75%. No staining was seen in these enriched NK-cell fractions using anti-CD3. Parts of the enriched NKcells were further incubated with 1000 units/ml human recombinant interleukin-2 (Proleukin, Euro-Cetus, Frankfurt, Germany) for up to 3 days in RPM1 1640 medium supplemented with 10% fetal calf serum, or up to 3 weeks in RPM1 1640 medium supplemented with 10% human AB serum. In a similar fashion, T-lymphocyte or Blymphocyte (90-95%) fractions were obtained by negative selection from mononuclear cells from the peripheral blood, i.e. using pan T (CDl9), or pan B (CD2) monoclonal antibodies (dianova). Indirect immunocytofluorescence Cell suspensions were spotted onto gelatine coated slides, fixed in -20°C cold acetone (fluorescence free, Merck, Darmstadt, Germany) and stored at -80°C. According to [40] we used the streptavidin-biotin-phycoerythrin cytochemical staining kit (Amersham). The fixed cells were incubated for 2 h with the monoclonal Pglycoprotein-specific antibody C219 [19] obtained from Isotopen Diagnostik CIS (Dreieich, Ger-

141

many) at a concentration of 10 &ml. After washing, the cells were incubated with biotinylated sheep-anti-mouse second antibody, and then with the streptavidin-biotinylated-R-phycoerythrincomplex (Amersham). After addition of a stabilizer (Amersham) to prevent rapid fading of the phycoerythrin-fluorescence, the slides were dried and cover-slipped. For control, aliquots of the same cell samples were stained using mouse isotype IgG2a (Coulter Electronics, Krefeld, Germany) instead of the P-glycoprotein-specific antibody C219. Counterstaining was performed with Meyer’s hematoxylin (Merck). In vitro drug sensitivity

Drug sensitivities of cells were monitored by measuring the inhibition of RNA biosynthesis by actinomycin D, or the inhibition of DNA biosynthesis by adriamycin through determination of incorporation rates of [3H]uridine, or [3H]thymidine, respectively, into the acid insoluble material of cells as described [lo]. Briefly, proliferating cell populations were incubated for about 18 h with 2.5 nCi/ml [14C]thymidine to obtain a reference label. Then, the cells were transferred to fresh medium and 2 h later aliquots of the cells were incubated for 2 h in the presence of various drug doses (a sample without drug served as control). After a final lo-min incubation with 5 @i/ml [3H]uridine, or 5 &i/ml [ 3H] thymidine, respectively, the acid precipitable 3H- and 14C-labelled radioactivity was determined. 3H to 14C counts/ min of the control sample was set loo%, the ratios found in drug treated cells were expressed as percentages thereof. Polymerase

chain reaction

(PCR)

The preparation of total cellular RNA, the synthesis of cDNA using random hexaoligonucleotide primers and the RAV2 reverse transcriptase (Amersham, Braunschweig, Germany) and the PCR were performed as described [l 11, essentially according to [6]. The sequences of the mdrl specitic [4] primers are: GGAGAGATCCTCACCAAGCG (sense) and GTTGCCAACCATAGATGAAGG (antisense) [l 11; the sequences of the mdr3 specific primers are: CTTTCAAGCAGTAGCCACG (sense) and TGTGCCCTCATCAGGGT

(antisense) [6,40]; the sequences of the &m (human &-microglobulin) specific primers are: ACCCCCACTGAAAAAGATGA (sense) and ATCTTCAAACCTCCATGATG (antisense) [6]. The amount of cDNA equivalent to 200 ng of total RNA was used for PCR. A l/5-vol. of the reaction mixture was analyzed, respectively, by electrophoresis on a 2% agarose, or a 10% polyacrylamide gel after ethidium bromide staining. Controls containing the same primer pairs used for PCR with either (i) human genomic DNA, or (ii) without any template, were performed in parallel. As size markers we used the DNA size marker VIII from Boehringer (mixture of Hpa II and Dra I/Hind III digests of the plasmid pUCBM21 comprising fragments of the following sizes (bp): 1114, 900, 692, 501, 489, 404, 320, 242, 190, 147. 124, 110, 67, 37, 34, 34, 26, 19). For evaluation of the signal intensities by the Ultroscan XL laserdensitometer (Pharmacia-LKB, Freiburg, Germany) we photographed the gels (Polaroid 665) and used the negatives. Results P-glycoprotein expression was monitored in various preparations of NK-cell populations enriched from peripheral blood or umbilical cord blood (UCB) by indirect immunocytofluorescence using the antibody C219. For comparison we evaluated the staining of the T-lymphoblastoid cell line CCRF-CEM and the multidrug-resistant CCRF-CEM sublines CCRF VCR 100 (Fig. 1A) and CCRF ACTD 400 (Fig. 1B). These MDR sublines exhibit ‘relative resistances’ (determined by a 72-h cell proliferation assay), for instance, of 260-fold and 2830-fold to vincristine, of 24-fold and 71-fold to adriamycin, or IO-fold and 570-fold to actinomycin D, respectively [13,27]. The staining of cultivated, IL-2 treated NK-cells enriched from peripheral blood is exemplified in Fig. 1C (NK-1, 78% CD56+). Altogether, 10 different NK-cell preparations from PBMC were analysed by C219 immunostaining which turned out to be distinct, but somewhat inhomogeneous (more than 50% of the cells were clearly stained in 7 preparations, in 3 preparations only about 25% were distinctly stained). On the other hand, in all of the

examined 7 different preparations of NK-cells enriched from umbilical cord blood (UCB) samples consistently more than 75% of the cells were distinctly stained by the antibody C219, at least comparable to the signals obtained with multidrug-resistant CCRF VCR 100 cells. This is exemplified in the Fig. 1D (NK-UCB-3, 95% CD56+) and Fig. 1E (NK-UCB-2, 97% CD56”). No significant difference was seen between untreated and IL-2 treated NK-cell samples applying this methodical approach. Samples of unseparated peripheral blood mononuclear cells (PBMC) showed a quite inhomogeneous immunostaining (exemplified in Fig. 1F). The immunostaining of B-lymphocytes (very low, Fig. lG), or Tlymphocytes (moderate, Fig. 1H) enriched from a single PBMC sample is shown for comparison. Under the conditions employed, no significant staining was seen with cell samples of the Tlymphoblastoid cell lines CCRF-CEM or MOLT4B which were routinely included as controls. For a further substantiation of our observation we, occasionally, examined drug sensitivities of cultivated populations of enriched NK-cells by a rather short term [3H]uridine or t3H]thymidine incorporation assay according to [lo]. Hereby, compared with the T-lymphoblastoid cell lines CCRF-CEM and MOLT4B, NK-cells enriched from UCB showed an about 2-fold (Fig. 2C), or 4fold (Fig. 2E) lowered sensitivity to actinomycin D, respectively. The latter value is practically identical to the value found applying this short-term drug sensitivity assay on the MDR subline CCRF VCR 100 (this short term assay usually delivers lower ‘relative resistances’ than the 72-h growth assay). Lowered actinomycin D sensitivity (- 2fold) was seen with NK-cells enriched from PBMC (Fig. 2D). Partly, we examined in parallel experiments the adriamycin sensitivities of the NK-cells, as well. The MDR subline CCRF VCR 100 showed here an approximately 2-fold lowered drug sensitivity compared to the parental cell line CCRF-CEM (Fig. 2G and 2K). NK-cells enriched from UCB, though, exhibited about 4-fold lowered sensitivity (Fig. 2H and 21) to adriamycin which could be modulated by coincubation of the cells with the immunosuppressive drug cyclosporin

250

200

150

100

50

2500

L

2000

1500

1000

500

--rG

H

1I 1

J

Fig. 2. Inhibition of the [3H]uridine incorporation by actinomycin D (ICsa + S.D.) into the acid insoluble material of the T-lymphoblastoid cell line CCRF-CEM (A); the Tlymphoblastoid cell line MOLT4B (B); cultivated NK-cells from umbilical cord blood (NK-UCB-1, 92% CD56+) (C); cultivated NK-cells from peripheral blood (NK-2, 88% CD56+) (D); cultivated NK-cells from umbilical cord blood (NK-UCB-2, 97% CD56+) (E); the MDR subline CCRF VCR 100 (F). Inhibition of the [3H]thymidine incorporation by adriamycin (IC,, f SD.) into the acid insoluble material of the T-lymphoblastoid cell line CCRF-CEM (G); NK-cells enriched from umbilical cord blood (NK-UCB-2, 97% CD56+) (H); or (NK-UCB-3, 95% CD56+) (I); the NK-UCB-3 cells treated with 2 pM cyclosporin A (Sundimmun) (J); the MDR subline CCRF VCR 100 (K).

A, an established MDR modulator [33,37] and Pglycoprotein inhibitor [34]. For a semiquantitative mdrl gene expression analysis of the NK-cell samples we applied PCR for amplification of mdrl cDNA fragments after reverse transcription of total cellular RNA from the

144

various sources. Moreover, as the monoclonal antibody C219 was reported to cross-react with the mdr3 gene product according to [31], we analyzed mdr3 gene expression in the cell samples, too, applying mdr3 specific amplimers described recently [6]. RNA prepared from the human hepatoma cell line HepG2 that is expressing the mdr3 gene [39], was taken as a positive control. Using human genomic DNA for PCR no amplified material was seen with the mdr amplimers whatsoever (data not shown), probably because of the introns located between the primer sequences [5,20]. As a control for the amount of cDNA present in the samples, primers specific for the human µglobulin gene were used in parallel experiments [6, 291. Some results are shown in Fig. 3.

A 1

mdrl

*

B2m

F

2

3

4

5

6

7

8

9

-~~---c”kr(--*’

-

z

B

---_------

123456709 Z=

mdr3

For summary, the data are listed in Table I. The latter represents the means of 2 to 3 independent PCR experiments with standard deviations usually less than 15%. In the lower range of the expression levels, i.e. below about 40 arbitrary units, standard deviations were higher, though, for instance in case of the parental cell line we measured 19 f 5 (n = 3) arbitrary units for mdrl gene expression (the signal intensities seen with material of the cell line CCRF VCR 100 were arbitrarily set 100). An increase (-5-fold) in mdrl gene expression monitored in the MDR subline CCRF VCR 100 by PCR is in good agreement with data obtained by series of slot-blot hybridization experiments using RNA from the same cell lines [ 131. The examination of 2 NK-cell samples prepared from peripheral blood revealed rather different mdrl gene expression levels. The sample NK-1 (78% CD56+) showed a value comparable to that of the MDR cell line CCRF VCR 100, while mdrl gene expression in the sample NK-2 (88% CD56+) turned out to be substantially lower which, however, nicely corresponds to the only about 2-fold lowered sensitivity of these cells towards actinomycin D (compared to the cell line CCRFCEM, Fig. 2). The PCR analysis of the samples NK-UCB-2 (97% CD56+), on the other hand,

w = -

Table I.

Fig. 3. (A) M&l gene expression analysis by PCR applying 30 cycles for amplification of a 229-bp fragment (arrowhead) of the human m&l/P-glycoprotein gene, or (B) mdr3 gene expression analysis by PCR applying 37 cycles for amplification of a 771-bp fragment (arrow-head) of the human mdr3 gene, respectively, from reverse transcribed total RNA prepared from the following cell samples: CCRF-CEM (2); CCRF VCR 100 (3); human hepatoma cell line HepG2 (4); enriched NK-cells (NK2, 88% CD56+) (5); enriched NK-cells (NK-I. 78% CD56+); NK-cells enriched from umbilical cord blood (NK-UCB-2,97% CD56+); B-lymphocytes (8); T-lymphocytes (9). The ethidium bromide stained gels were photographed using a Polaroid 665 negative film which was photographed again to obtain the stained DNA as dark signals for better visualization. The size marker was loaded in lane 1. To control the amount of cDNA in each sample, PCR applying 25 cycles was performed using amplimers specific for the human &-microglobulin gene for amplification of a 114bp cDNA fragment (arrowhead).

Mdr gene expression

analysis

by PCR.

Relative

CCRF-CEM CCRF VCR 100 HepG2 NK-2 (88% CD56+) NK-1 (78% CD56+) NK-UCB-2 (97% CD56+) B-lymphocytes T-lymphocytes

expression

mdrl

mdr3

19 100 78 35 107 141 35 96

13 100 508 (-) 26 36 95 27

The signals (means of 2 to 3 independent PCR experiments) (for instance see Fig. 3) were normalized to the signals obtained with the amplimers for the µglobulin gene. Then, the value seen in case of the MDR cell line CCRF VCR 100 was arbitrarily set 100; (-), no signal visible.

revealed a quite strong expression of the multidrug transporter gene in accordance to the result shown in Fig. 1C and the about 4-fold lowered drug sensitivities (Fig, 2E and H). A preparation (same samples as shown in Fig. 1G and H) of enriched B-lymphocytes and Tlymphocytes from the same individual revealed low, or quite high mdrl gene expression, respectively. Here, interestingly, the reverse observation was made, if the expression of the mdr3 gene was examined by PCR (Table I). It should be emphasized, however, that 37 PCR cycles were needed for evaluation of mdr3 gene expression in all cases excepting the samples from the human hepatoma cell line which shows strong mdr3 gene expression in agreement to the work of others [38]. Hence, mdr3 gene expression in the NK-cell samples examined so far, appeared to be very low or practically absent (sample NK-2). It appears worth mentioning, that the ratio of mdr3 gene expression levels seen in the parental cell line CCRFCEM and the MDR subline CCRF VCR 100 is similar to the ratio seen in case of the mdrl gene expression levels probably reflecting the 3-fold amplification of the mdr gene region in the MDR subline CCRF VCR 100 [ 121.

Discussion Several recent reports describe the expression of a multidrug transporter in haematopoietic subpopulations, i.e. in stromal macrophages of various tumours [32], in a T-cell subset [26], or in haematopoietic progenitor cells with highest levels in cells displaying characteristics of pluripotent stem cells [3]. While the in vivo function of the Pglycoprotein in these cell types is unknown, it could be an important factor during cancer chemotherapy by rendering these cells less sensitive towards the cytotoxic impact of anticancer drugs. This appears to be similarly true for the NK-cells which possibly assist in the elimination of tumour cells. NK-cells, though, represent a rather heterogeneous cell population whose origin and functions as yet are not completely understood [30]. The NK-cells in the umbilical cord blood, particularly, might comprise a peculiar, rather immature subset of these haematopoi-

etic cells. To our knowledge however, the expression of the multidrug transporter gene in NK-cells has not been investigated yet. In a first approach we used the monoclonal antibody C219 [ 191 suitable for the immunocytochemical examination of P-glycoproteln expression In human cell specimens of different origins [13,22,32,35,40]. Thereby, P-glycoprotein expression was observed in series of different NK-cells enriched from UCB, whereas in NK-cells enriched from PBMC it appeared to be mostly distinct, but more heterogeneous. The significance of our finding was substantiated by other methodical approaches. This appeared to be necessary, because it was shown recently that the monoclonal antibody C2 19 crossreacts with a human mdr3 encoded P-glycoprotein [31] which was reported to be distinctly expressed in leukemias of the B-cell lineage [ 171. In fact, by PCR we observed in a sample of enriched Blymphocytes a distinctly higher mdr3 gene expression compared to T-lymphocytes of the same healthy donor. Nonetheless, all NK-cell samples showed low or virtually absent mdr3 gene expression after applying 37 PCR cycles. Thus, the contribution of the mdr3 gene product to the immunostaining obtained with the monoclonal antibody C219 appears to be negligible. This statement is further supported by our observation of a stronger C219 immunostaining of purified Tlymphocytes (Fig. 1H) than of purified Blymphocytes (Fig. IG) corresponding to the higher mdrl gene expression seen in the T-lymphocyte sample by PCR (Table I). Though the different approaches for analysing mdrl gene expression, (i) C219 immunostaining, (ii) PCR and, rather indirect, (iii) the drug sensitivity testing, were performed only in a fraction of the samples in parallel, we, nonetheless, found a good correspondence of the data throughout. Thus, we have no reason to suspect an unspecific crossreactivity of the monoclonal antibody C219 lots used in this work as a major source of error. Moreover, no correlation between the C219 immunostaining and the blood group of the donors was observed [8]. The reasons for the variability of P-glycoprotein expression in NK-cells enriched from PBMC of adults remain unclear. At present

146

it is unknown whether an inter- or intra-individual variability of P-glycoprotein expression in subsets of lymphocytes exists. Several recent reports, however, point to the influence of endogeneous or exogeneous factors in the regulation of mdrl gene expression. Thus, the mdrl gene was shown to be inducible in rat liver by carcinogens and cocarcinogens [2,7], after gestation in the endometrium of mice [ 11, by differentiating agents in a colon carcinoma cell line [23] and by anticancer drugs in Tlymphoblastoid cell lines [10,28]. The possible induction of mdr genes in specialized cells in vivo as a direct consequence of dietary factors or the application of drugs awaits further investigations. Pglycoprotein functions in haematopoietic cells possessing cytotoxic qualities is unknown at present. It might be speculated that the P-glycoprotein is involved in the transport of cytotoxic factors released by these cells. The P-glycoprotein bears pronounced similarity to the Escherichiu coli transporting protein for haemolysin which has membrane-damaging qualities [ 181. Thus, Pglycoprotein expression might even protect cytotoxic cells from their own cytolytic factors. In fact, we reported recently on the inverse correlation between P-glycoprotein expression and the susceptibility of multidrug-resistant CCRF-CEM sublines to cell lysis induced by lymphokine-activated killer ceils [20], a phenomenon which eventually was seen by others as well [41]. The strong Pglycoprotein expression in NK-cells enriched from the UCB points to a peculiar function of this transmembrane protein in this type of possibly immature CD56+ cells. A more detailed characterization of P-glycoprotein expression in NK-cell subfractions and of the cytolytic factors released by them challenges further research. Acknowledgement This work was supported by the Deutsche Forschungsgemeinschaft (SFB 120). The authors gratefully acknowledge and thank Frank Baur. Klaus Grissinger, Sebastian Kriimpelmann, Mario Otto and Hans-Jorg Schafer for providing some of the enriched NK-cell populations. We thank our colleagues for providing the MDR CCRF-CEM sublines (Dr. Heyke Diddens), the cell line HepG2

(Dr. Rolf Gebhardt) and the cell line MOLT4B (Dr. Klaus HauDermann). We are indebted to Dr. Claudia Muller and Dr. Helmuth Schmidt for preparation of the PCR amplimers and to Dr. Michael Duszenko for his kind help in operating the fluorescence microscope. References 1

2

3

4

5

6

Arceci, R.J., Croop, J.M., Horwitz. S.B. and Housman. D. (1988) The gene encoding multidrug resistance is induced and expressed at high levels during pregnancy in the secretory epithelium of the uterus. Proc. Natl. Acad. Sci. U.S.A., 85, 4350-4354. Burt, R.K. and Thorgeirsson, S.S. (1988) Coinduction of MDR-1 multidrug-resistance and cytochrome p-450 genes in rat liver by xenobiotics. J. Natl. Cancer Inst.. 80. 1383-1386. Chaudhary. P.M. and Roninson, LB. (1991) Expression and activity of P-glycoprotein, a multidrug ef?lux pump, in human hematopoietic stem cells. Cell, 66, 85-94. Chen, C.. Chin, J.E., Ueda, K., Clark, D.P., Pastan, I., Gottesman. M. M. and Roninson, I.B. (1986) Internal duplication and homology with bacterial transport proteins in the m&l (P-glycoprotein) gene from multidrugresistant human cells. Cell, 47, 381-389. Chen, C.-J.. Clark, D.P., Ueda, K., Pastan, I., Gottesman, M.M. and Roninson, LB. (1990) Genomic organization of the human multidrug resistance (m&l) gene and origin of P-glycoprotelns. J. Biol. Chem., 265. 506-514. Chin, J.E., Soffir. R., Noonan, K.E., Choi, K. and Roninson, I.B. (1989) Structure and expression of the human MDR (P-glycoprotein) gene family. Mol. Cell. Biol., 9. 3808-3820. Fairchild, CR., Ivy, S.P., Rushmore, T.. Lee, G.. Koo, P., Goldsmith, M.E., Myers, C.E., Farber. E. and Cowan K.H. (1987) Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas. Proc. Nat]. Acad. Sci. U.S.A., 84, 7701-7705. Finstad, C.L., Yin, B.W.T., Gordon. C.M., Federici, M.G., Welt, S. and Lloyd, K.O. (1991) Some monoclonal antibody reagents (C219 and JSB-I) to P-glycoprotein contain antibodies to blood group A carbohydrate determinants: a problem of quality control for immunohistochemical analysis. J. Histochem. Cytochem.. 59, 1605-1610. Fojo. A.T.. Ueda, K., Slamon, D.J.. Poplack, D.G., Gottesman, M.M. and Pastan. I. (1987) Expression of a multidrug-resistant gene in human tumours and tissues, Proc. Natl. Acad. Sci. U.S.A., 84, 265-269. Gekeler, V., Frese, G.. Diddens, H. and Probst. H. (1988) Expression of a P-glycoprotein gene is inducible in a multidrug-resistant human leukemia cell line. Biochem. Biophys. Res. Commun.. 155. 754-760. Gekeler, V.. Weger, S. and Probst. H. (1990) mdrllP-

147

12

13

14

15

16

17

18

19

20

21

22

glycoprotein gene segments analysed from various human leukemic cell lines exhibiting different multidrug resistance profiles. B&hem. Biophys. Res. Commun., 169, 796-802. Gekeler, V., Frese, G., Neumann, M., Weger, S., Wilisch, A., Noller, A., Diddens, H., Daumiller, E. and Probst, H. (1991) Human MDR T-lymphoblastoid cell lines exhibiting different cross-resistance profiles, mdrllPglycoprotein and topoisomerase II gene expression. J. Cancer Res. Clin. Oncol., 1l’I(Suppl), S96. Gekeler, V., Frese, G., Noller, A., Handgretinger, R., Wilisch, A., Schmidt, H., Muller, C.P., Dopfer, R., Klingebiel, T., Probst, H. and Niethammer, D. (1992) MdrllP-glycoprotein, topisomerase and glutathione-,Stransferase II gene expression in primary and relapsed state adult and childhood leukemias. Br. J. Cancer, 66, 507-517. Goldstein, L.J., Galski, H., Fojo, A., Willingham, M., Lai, S.-L., Gazdar, A., Pirker, R., Green, A., Crist, W., Brodeur, G.M., Lieber, M., Cossman, J., Gottesman, M.M. and Pastan, I. (1989) Expression of a multidrug resistance gene in human cancers. J. Natl. Cancer Inst., 29, 116-124. Handgretinger, R., Kimmig, A., Lang, P., Daurer, B., Kuci, S, Bruchelt, G., Treuner, J. and Niethammer, D. (1989) Interferon-gamma upregulates the susceptibility of human neuroblastoma cells to interleukin-2 activated natural killer cells. Nat. Immun. Cell Growth Regul., 8, 189-196. Herberman, R.B. and Ortaldo, J.R. (1981) Natural killer cells: their role in defenses against disease. Science, 214, 24-30. Herweijer, H., Sonneveld, P., Bass, F. and Nooter, K. (1990) Expression of mdrl and mdr3 multidrug-resistance genes in human acute and chronic leukemias and association with stimulation of drug accumulation by cyclosporine. J. Natl. Cancer Inst., 82, 1133-l 140. Juranka, P.F., Zastawny, R.L. and Ling, V. (1989) Pglycoprotein: multidrug-resistance and a superfamily of membrane-associated transport proteins. FASEB J., 3, 2583-2592. Kartner, N., Everden-Porelle, D., Bradley, G. and Ling, V. (1985) Detection of P-glycoprotein in multidrug resistant cell lines by monoclonal antibodies. Nature, 316, 820-823. Kimmig, A., Gekeler, V., Neumann, M., Frese, G., Handgretinger, R., Kardos, G., Diddens, H. and Niethammer, D. (1990) Susceptibility of multidrug-resistant human leukemia cell lines to human interleukin 2-activated killer cells. Cancer Res., 50, 6793-6799. Lincke, C.R., Smit, J.J.M., van der Velde-Koerts, T. and Borst, P. (199 1) Structure of the human MDR3 gene and physical mapping of the human MDR locus. J. Biol. Chem., 266, 5303-5310. Ma, D.D.F., Davey, R.A., Harman, D.H., Isbister, J.P., Scurr, R.D., Mackertich, S.M., Dowden, G. and Bell, D.R. (1987) Detection of a multidrug resistant phenotype in acute non-lymphoblastic leukaemia. Lancet, 17, 135-137.

23

24

25

26

27

28

29

30

31

32

33

34

35

Mickley, L.A., Bates, S.E., Richert, N.D., Currier, S., Tanaka, S., Foss, F., Rosen, N. and Fojo, A.T. (1989) Modulation of the expression of a multidrug resistance gene (mdr-I/P-glycoprotein) by differentiating agents. J. Biol. Chem., 264, 18031-18040. Nasr, S., McKolanis, J., Pals, R., Findley, H., Hnath, R., Waldrep, K. and Ragab, A.H. (1989) A phase I study of interleukin-2 in children with cancer and evaluation of clinical and immunological status during therapy. Cancer, 62, 783-788. Nasrallah, A.G. and Miale, T.D. (1983) Decreased natural killer cell activity in children with untreated acute leukemias. Cancer Res., 43, 5580-5585. Neyfakh, A.A., Serpinskaya, A.S., Chervonsky, A.V., Apasov, S.G. and Kazarov, A.R. (1989) Multidrugof Tresistance phenotype of a subpopulation lymphocytes without drug selection. Exp. Cell Res., 185, 496-505. Niethammer, D., Diddens, H., Gekeler, V., Frese, G., Handgretinger, R., Henze, G., Schmidt H. and Probst, H. (1989) Resistence to methotrexate and multidrug resistance in childhood malignancies. In: Advances in Enzyme Regulation, pp. 231-245. Editor: G. Weber. Pergamon Press, Oxford, New York. Noller, A., Frese, G., Neumann, M., Wilisch, A., Probst, H. and Gekeler, V (1991) Drug mediated increases of resistance and mdrl/P-glycoprotein expression in human multidrug-resistant T-lymphoblastoid cell lines. J. Cancer Res. Clin. Oncol., 117(Suppl.), 595. Noonan, K.E., Beck, C., Holzmayer, T.A., Chin, J.E., Wunder, J.S., Andrulis, I.L., Gazdar, A.F., Willman, CL., Grifftth, B., Von Hoff, D.D. and Roninson, I.B. (1990). Quantitative analysis of mdrl (multidrug resistance) gene expression in human tumours by polymerase chain reaction. Proc. Nat]. Acad. Sci. U.S.A., 97, 7160-7164. Robertson, M.J. and Ritz, J. (1990) Biology and clinical relevance of human natural killer cells. Blood, 76, 2421-2438. Schinkel, A.H., Roelofs, M.E.M. and Borst, P. (1991) Characterization of the human mdr3 P-glycoprotein and its recognition by P-glycoprotein-specific monoclonal antibodies. Cancer Res., 51, 2628-2635. Schlaifer, D., Laurent, G., Chittal, S., Tsuruo, T.. Soues, S., Muller, C., Charcosset, J.Y., Alard. C., Brousset, P., Mazarrolles, C. and Delsol, G. (1990) Immunohistochemical detection of multidrug resistance associated P-glycoprotein in tumour and stromal cells of human cancers. Br. J. Cancer, 62, 177-182. Slater, L.M., Sweet, P.. Stupecky, M. and Gupta, S. (1986) Cyclosporin A corrects daunorubicin resistance in Ehrhch ascites carcinoma. Br. J. Cancer, 54, 235-238. Tamai, I. and A.R. (1990) Competitive interaction of cyclosporins with the Vinca alkaloid-binding site of Pglycoprotein in multidrug-resistant cells. J. Biol. Chem., 265, 16509-16513. Thiebaut, F., Tsuruo, T., Hamada, H., Gottesman, M.M., Pastan, I. and Willingham, M.C. (1987) Cellular localization of the multidrug-resistance gene product P-

148

36

37

38

glycoprotein in normal human tissues. Proc. Natl. Acad. Sci. U.S.A., 84, 1135-7138. Timonen, T., Reynolds, C.W., Ortaldo, J.R. and Herberman, R.B. (1982) Isolation of human and rat natural killer cells. J. Immunol. Methods, 51, 269-277. Twentyman, P.R., Fox, N.E. and White, D.J.G. (1987) Cyclosporin A and its analogues as modifiers of adriamycin and vincristine resistance in a multi-drug resistant human lung cancer cell line. Br. J. Cancer, 56, 55-57. Van der Bliek, A.M., Bass, F., Ten Houte de Lange, T.. Kooiman, P.M., Van der Velde-Koerts, T. and Borst, P. (1987) The human mdr3 gene encodes a novel Pglycoprotein homologue and gives rise to alternatively spliced mRNAs in liver. EMBO J., 6, 3325-3331.

39

40

41

Van der Bliek, A.M., Kooiman, P.M., Schneider, C. and Borst. P. (1988) Sequence of the mdr3 cDNA encoding a human P-glycoprotein. Gene, 7 1, 401-411. Volm, M., Efferth, T., Bak, M.. Ho, A.D. and Mattern, J. (1989) Detection of the multidrug resistant phenotype in human tumours by monoclonal antibodies and the streptavidin-biotinylated phycoerythrin complex method. Eur. J. Cancer Clin. Oncol., 25, 743-749. Woods, G., Lund, L.A., Naik, M., Ling, V. and Ochi, A. (1988) Resistance of multidrug-resistant lines to natural killer-like cell-mediated cytotoxicity. FASEB J.. 2, 279 l-2796.