Biochem Genet DOI 10.1007/s10528-012-9553-x
MicroRNAs as Markers for Neurally Committed CD133+/CD34+ Stem Cells Derived from Human Umbilical Cord Blood Maryam Hafizi • Amir Atashi • Behnaz Bakhshandeh • Mahboubeh Kabiri • Samad Nadri • Reza Haji Hosseini Masoud Soleimani
•
Received: 16 December 2011 / Accepted: 20 July 2012 Ó Springer Science+Business Media New York 2012
Abstract Neural differentiation of the CD133?/CD34? subpopulation of human umbilical cord blood stem cells was investigated, and neuro-miR (mir-9 and mir124) expression was examined. An efficient induction protocol for neural differentiation of hematopoietic stem cells together with the exclusion of retinoic acid in this process was also studied. Transcription of some neural markers such as microtubule-associated protein-2, beta-tubulin III, and neuron-specific enolase was evaluated by real-time PCR, immunocytochemistry, and western blotting. Increased expression of neural indicators in the treated cells confirmed the appropriate neural differentiation, which supported the high efficiency of our defined neuronal induction protocol. Verified high expression of neuro-miRNAs along with neuronal specific proteins not only strengthens the regulatory role of miRNAs in determining stem cell fate but also introduces these miRNAs as novel indicators of neural differentiation. These data highlight the prominent therapeutic potential of hematopoietic stem cells for use in cell therapy of neurodegenerative diseases.
M. Hafizi M. Kabiri S. Nadri Stem Cell Biology Department, Stem Cell Technology Research Center, Tehran, Iran M. Hafizi R. H. Hosseini Biology Department, Payame Noor University, Tehran, Iran A. Atashi M. Soleimani (&) Hematology Department, Faculty of Medical Sciences, Tarbiat Modares University, P.O. Box 14115-111, Tehran, Iran e-mail:
[email protected] B. Bakhshandeh M. Kabiri Department of Biotechnology, University College of Science, University of Tehran, Tehran, Iran S. Nadri Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
123
Biochem Genet
Keywords Hematopoietic stem cells MicroRNAs Neural differentiation CD133?/CD34?
Introduction Over the past 20 years, stem cell therapy has become an increasingly attractive option to investigate and heal neurodegenerative diseases (Lunn et al. 2011). Neural stem cells maintain lineage specificity and have the ability to differentiate into many types of neural cells (Gage 2000; Horner et al. 2000; Titomanlio et al. 2011). Although they show therapeutic value for disorders of the central nervous system, isolation of such cells from adult tissue entails an invasive neurosurgical procedure, which limits their clinical application. Such problems have led many researchers to find alternative sources of stem cells with a high neural differentiation potential for healing neurodegenerative disorders (Nadri et al. 2008). As a byproduct of birth, human umbilical cord blood is an acceptable and readily accessible source of stem cells (Reddi et al. 2010). Cord blood banks are growing globally, and there is an ongoing interest in cord blood stem cell therapies. Furthermore, cord blood human leukocyte antigen (HLA) typing for storage has raised hope for all patients to access an HLA matching cell source. Recently, it was observed that cord blood contains various stem progenitor cells with the ability to differentiate into both hematopoietic and nonhematopoietic cells (Lee et al. 2004; Moise 2005). In addition, promising evidence suggests a high potential of these multipotent stem cells for neural lineage commitment (Fan et al. 2005; Jang et al. 2004; Zangiacomi et al. 2008). Thus, transplantation of cord blood cells would offer an attractive route for stem cell therapy; however, lack of knowledge about the source of subpopulations with neural differentiation potential and the conditions permitting their differentiation has limited their use in practical applications for neurodegenerative diseases. In this regard, the 1–2 HLA mismatch tolerance of CD133?/CD34? hematopoietic stem cells (as a fraction of cord blood) has made this subpopulation appealing for cell therapy applications (Koh 2004). MicroRNAs (miRNAs) are small noncoding gene products that play an important regulatory role in determining cell fate post-transcriptionally. They bind to messenger RNAs through base pairing for fine-tuning or functioning as master switches that turn genes on and off during development. Bioinformatics analyses predicted that miRNAs, comprising about 5 % of the transcriptome, regulate the translation of more than one-third of human mRNAs (Bakhshandeh et al. 2012c; Bartel 2004; Pasquinelli 2012). The epigenetic effects of miRNAs during multiple biological functions such as differentiation and development have long been studied (Bakhshandeh et al. 2012a; Calin et al. 2004; Nilsen 2007). Recently many studies have researched the role of miRNAs in neurogenesis, such as the miRNA modulation during neuronal differentiation of unrestricted somatic stem cells (Trompeter et al. 2011), miRNA-mediated conversion of human fibroblasts to neurons (Yoo et al. 2011), the role of mir-9 in neurogenesis in the mouse telencephalon (Shibata et al. 2011), regulation of neural stem/progenitor cell proliferation and neuronal differentiation by miR-106b (Brett et al. 2011), activation
123
Biochem Genet
of miR-29b during neuronal maturation (Kole et al. 2011), the pro-differentiating role of miR-124 in the neuron (Maiorano and Mallamaci 2010), early neurogenesis in the optic vesicle and forebrain by mir-124 (Liu et al. 2011), and the role of miRNAs in development of the mammalian central nervous system (Smirnova et al. 2005). To our knowledge, neural differentiation and related miRNA expression patterns of human cord blood-derived CD133?/CD34? stem cells have not been studied. Herein we investigated the neurogenic differentiation of the aforementioned hematopoietic subset, along with the expression patterns of two neuronal specific miRNAs (mir-9 and mir-124) (Kapsimali et al. 2007) suggesting that they may be novel neurogenic differentiation indicators.
Materials and Methods Isolation of CD133?/CD34? Cells With informed consent of the mothers, mononuclear cells were isolated from umbilical cord blood using a Ficoll density gradient protocol (Innotrain). This fraction was incubated with magnetic CD133 antibody conjugated microbeads, then the adherent cells were washed and incubated again with CD34 antibody conjugated magnetic microbeads (Milteny Biotec). CD133?/CD34? cells were then diluted in 1 mL Hank’s buffered salt solution (HBSS), counted, and the viability assessed using flow cytometry. Neuronal Differentiation Two different protocols were applied to induce neurogenesis in enriched CD133?/ CD34? hematopoietic stem cells, which were cultured in 24-well plates. General Protocol In the general protocol, after precoating wells with fibronectin (Chemicon), cells were cultured in the basal medium (Gibco), supplemented with 0.5 lM all-trans retinoic acid (Sigma) and 1 % fetal calf serum (FBS), 1 % N2 supplement, and 1 % penicillin/streptomycin (all from Gibco), and 10 ng/mL-1 rh-brain-derived neurotrophic factor (Promega). Cells were cultured in differentiated medium for 12 days (Hermann et al. 2006). Our Protocol According to the second protocol, 24-well plates were precoated with fibronectin (Chemicon) for 72 h at 4 °C. Medium containing DMEM/F12, supplemented with 20 % FBS (Padovan et al. 2003), Glutamax (Gibco), and nonessential amino acids (Gibco), was used for efficient adherence of cultured cells to the precoated wells. After 3 days, the medium was exchanged with neurobasal medium (Gibco)
123
Biochem Genet
supplemented by 10 % FBS, 10 ng/mL brain-derived neurotrophic factor (Promega), 20 ng/mL basic fibroblast growth factor (Invitrogen), 10 ng/mL nerve growth factor (Invitrogen), 1 ng/mL neurotrophin 3 (Sigma), and 1 % insulintransferrin-selenium supplement (Gibco) for 3 weeks of continued culture. Flow Cytometry Analysis Aliquots of 2 9 105 cells were divided into amber-tinted 5 mL centrifuge tubes and 3 % human serum was added. The cells were incubated for 30 min, resuspended in 5 mL PBS, and pelleted by centrifugation for 10 min at 3009g. Next, the cells were resuspended in 100 lL PBS and stained with PE-conjugated anti-human CD133 (Milteny Biotec) and FITC-conjugated anti-human CD34 (Dako) at 4 °C for 30 min. The cells stained with multimix mouse IgG1 FITC/IgG1 RPE (Dako) were used as negative controls. The cells were then pelleted, washed twice with PBS, and fixed with 1 % paraformaldehyde in PBS. After fixation, flow cytometry analysis was performed on a FACS Calibur cytometer (Becton–Dickinson) using CellQuest software. Win MDI 2.8 software was used to create the histograms. Cell Viability Assessment Propidium iodide (PI) intercalates into double-stranded nucleic acids. It is excluded by viable cells but can penetrate cell membranes of dying or dead cells (Bakhshandeh et al. 2012b). Herein PI as a reverse indicator of cell viability was assayed by flow cytometry to quantify the exact percentage of viable cells compared to initial cultured cells as control. In order to adjust flow cytometer settings for PI, we added 5–10 lL of PI staining solution to tubes, each containing 1 9 106 cells/ 100 lL. After gentle mixing and incubation for 1 min in the dark, PI fluorescence was determined with a FACScan instrument. Immunocytochemistry Cultured cells were fixed by incubation in 1 % paraformaldehyde/PBS for 3–5 min, permeabilized with 0.5 % Triton X-100 in PBS for 15 min, and post-fixed for an additional 10 min in 4 % paraformaldehyde/PBS. The intracellular staining patterns and distribution of neuron-specific enolase (NSE) protein were analyzed by immunostaining with a mouse monoclonal antibody against human NSE (Abcam). The PE-conjugated anti-mouse IgG was used as the secondary antibody (EBiosciences) and the nuclei were stained with DAPI. Western Blot Assay The differentiated cells were lysed by RIPA buffer at 4 °C for 30 min. After centrifugation (7009g), the supernatant was transferred to a new tube. The protein concentrations of various samples were quantified using the BCA protein assay kit (Pierce) and were eluted in loading buffer [glycerol 10 % v/v; Tris 0.05 M, pH 6.8; sodium dodecyl sulfate (SDS) 2 %, bromophenol blue 0.01 % w/v, and
123
Biochem Genet
mercaptoethanol 2.5 % v/v] by heating at 100 °C for 3 min. Equal quantities of protein were loaded in each lane in a 12 % SDS polyacrylamide gel and electrophoresed. Then the proteins were transferred to a nitrocellulose membrane (Macherey–Nagel) using a Trans-Blot transfer tank. The membranes were saturated with 5 % BSA for 2 h at 37 °C, then incubated at 4 °C overnight with a monoclonal antibody against NSE (mouse IgG, 0.1 lg/mL) or beta-actin (Abcam, mouse IgG 1:5,000) as a control for protein loading, and then washed 3 times, each for 5 min, with PBS-Tween 0.1 %. Afterward, membranes were incubated with the appropriate horseradish peroxidase-conjugated secondary antibody (1/2,000) (Ray Biotech) for 2 h at room temperature followed by 3 washes, each for 10 min. Membranes were developed with chemiluminescence western blot detection reagents (Roche). Band densities were analyzed using UV Bland software. The cells expanded for 3 weeks in conventional hematopoietic stem cell expansion medium, consisting of Stem Line medium (Sigma) plus 100 ng/mL each of Flt3, TPO, and Stem Cell Factor (all from Peprotech), served as negative controls for western blot and real-time PCR analysis. Real-Time PCR Analysis Total RNA was extracted and random hexamer primed cDNA synthesis was carried out using a RevertAid first-strand cDNA synthesis kit (Fermentas). The cDNA was used for 40 cycles of PCR in a Corbett 6,000 Rotor-gene Q Real-Time analyzer (Corbett). According to the manufacturer’s instructions, real-time PCR was performed using Maxima SYBR Green/ROX (Fermentas), followed by a melting curve analysis to confirm PCR specificity. For quantification of miRNAs, a Stratagene High-Specificity miRNA qRT-PCR detection kit (Agilent) was used according to the manufacturer’s instructions. For each miRNA, a specific primer was designed according to Stratagene cDNA synthesis kit instructions (Table 1). Rotor-gene Q software (Corbett) was used for data analysis of the threshold cycle average, and data were normalized to endogenous controls (GAPDH for genes and U6 for miRNAs) and calibrated to untreated cultured cells as control. The relative mRNA expression levels were calculated based on the delta CT method. Table 1 Primers for qPCR of genes and miRNAs
Gene
Primer sequence
GAPDH
F: CTCTCTGCTCCTCCTGTTCG
MAP-2
F: AGTTCCAGCAGCGTGATG
NSE
F: GGAGAACAGTGAAGCCTTGG
Beta-tubulin
F: GATCGGAGCCAAGTTCTG
hsa-mir-9
TCTTTGGTTATCTAGCTGTATGA
hsa-mir-124
TAAGGCACGCGGTGAATG
R: ACGACCAAATCCGTTGACTC R: CATTCTCTCTTCAGCCTTCTC R: GGTCAAATGGGTCCTCAATG R: GTCCATCGTCCCAGGTTC
123
Biochem Genet
miRNA Putative Target Prediction The online database TargetScan (http://genes.mit.edu/targetscan) was used to find putative targets for mir-9 and mir-124. Statistical Analysis Student’s t-test was used to determine whether there was a significant difference between the groups. In order to compare multiple groups, the ANOVA test was applied; the difference was considered significant if the P value was lower than 0.05. Samples were run in triplicate for the biochemical assays and for molecular analysis (unless stated otherwise). All data are shown as mean ± standard deviation (SD).
Results Stem Cell Characterization Hematopoietic stem cells isolated from human umbilical cord blood were characterized based on their surface markers: CD133 and CD34. Flow cytometry analysis (Fig. 1) revealed that 96 % ± 2.2 of the cells coexpressed CD34 and CD133 on their surfaces. The viability of the purified CD133?/CD34? population was 98 % ± 1. These cells do not adhere to cell culture plates and are propagated in suspension form. As a prerequisite for neural differentiation, cells should adhere to the matrix, but the hematopoietic stem cells are not adherent. As a solution, a high concentration of FBS (20 %) was applied and resulted in adherent CD133?/CD34? cells (Fig. 2). Neurogenic Behavior of Hematopoietic Stem Cells To elucidate the neurogenic potential of the CD133?/CD34? fraction, these cells were cultured in neuroinductive media. Applying the general protocol led to apoptosis in hematopoietic stem cells, which was a consequence of retinoic acid supplementation (Fig. 3). Our protocol resulted in distinct elongated neuronal-like morphology (Fig. 3). Applying a high concentration of FBS resulted in 80 ± 5 % adherence. The change in the medium washed out the nonadherent cells. The neurogenic commitment of differentiated hematopoietic stem cells was investigated further. Protein Expression Evaluation To evaluate the neural-specific markers at the translational level, we employed immunocytochemistry and western blot analyses. By comparing DAPI-stained figures with ICCs, we can assume that almost none of the untreated cells and all of the induced cells expressed NSE (Fig. 4). Western blot analysis was performed specifically to examine the NSE. The results of the immunoblotting assay further
123
Biochem Genet
Fig. 1 Characterization of stem cell surface markers using flow cytometry. Purified cells were expanded and analyzed by fluorescence-activated cell sorting and Cell Quest software for the coexpression of CD133 and CD34. Dot plots of a isotype control stained with both PE- and FITC-conjugated anti-mouse IgG1 and b double-stained CD34-FITC and CD133-PE population of cells derived from human cord blood. The population in the upper right is positive for both markers. Histograms of characterized c CD133-PE cells and d CD34-FITC subpopulations; isotype control areas are shaded, test areas are white. Vertical axis cell number; horizontal axis fluorescent emission. Dot plots e before PI staining, of total cells and, f after PI staining, of live cells (left) and PI-stained dead cells (right)
123
Biochem Genet
Fig. 2 Phase-contrast microscopy of a human cord blood-derived CD133?/CD34? suspension culture (1009 magnification) and b adherent hematopoietic stem cells after addition of FBS (4009 magnification)
Fig. 3 a Apoptotic hematopoietic stem cells after induction in neural induction medium containing retinoic acid (1009 magnification). b Neurally differentiated hematopoietic stem cells after 3 weeks in neurogenic medium; most of the cells revealed differentiation (4009 magnification). c Western blot analysis: Lane 1 NSE protein expressed in differentiated cells. Lane 2 This marker was not expressed in control culture. Beta-actin was tested as internal control
Fig. 4 Immunocytochemistry of differentiated CD133?/CD34? cells (a–c) and untreated control (d–f). Columns 1 DAPI for blue nucleus; 2 immune-stained for red NSE; 3 merged pictures (2009 magnification) (Color figure online)
123
Biochem Genet
confirmed the expression of NSE in the neurally committed CD133/CD34 population derived from human umbilical cord blood (Fig. 3). Gene Expression Evaluation Transcriptions of neural-specific marker genes, including MAP-2, beta-tubulin, and NSE, were examined using qPCR, both in hematopoietic stem cells and in neurogenic differentiated cells. These results indicated upregulation in all the mentioned neurogenic markers. Transcript expression for MAP-2 was 133.15 ± 13.2 times that of untreated cells, beta-tubulin was 1.35 ± 0.2, and NSE was 19 ± 2.5 (Fig. 5). In Silico Analyses Many of the obtained putative targets of candidate neuro-miRs are neural indicators or structural components of nervous system cells (Table 2). Tracking miRNAs During Neurogenesis Investigation of neuronal specific miRNAs (mir-9 and mir-124) by qPCR in hematopoietic stem cells and neurogenic induced cells showed miR-9 transcription at 26.5 ± 3.65 and miR-124 at 86 ± 10 that of controls (Fig. 5).
Discussion Recently human umbilical cord blood stem/progenitor cells have been widely studied and clinically applied as a promising source for cell therapy. Among whole mononuclear cells, hematopoietic stem cells have been selected for isolation and storage in cell banks because of their vast uses in blood-related diseases, which has resulted in some FDA-approved applications and the capacity for trans-differentiation (Cohen and Nagler 2004; Jang et al. 2004; Zhou et al. 2012).
Fig. 5 a Relative transcription of neural marker genes in neurogenic differentiated hematopoietic stem cells (3 weeks) compared with untreated hematopoietic stem cells (control). b Relative expression of mir9 and mir-124 in mentioned cells. * Statistically significant difference at p \ 0.05
123
Biochem Genet Table 2 Neuronal-related putative targets of mir-9 and mir-124 MicroRNA hsa-mir-9
hsa-mir-124
Putative target
Description
LRRTM4
Leucine rich repeat transmembrane neuronal 4
ACCN2
Amiloride-sensitive cation channel 2, neuronal
NPTX1
Neuronal pentraxin I
NEDD4
Neural precursor cell expressed, developmentally down-regulated 4
NPTX1
Neuronal pentraxin I
ANK2
Ankyrin 2, neuronal
SGMS2
Sphingomyelin synthase 2
SYT4
Synaptotagmin IV
MICAL2
Microtubule-associated monoxygenase, calponin and LIM domain
MTMR2
Myotubularin related protein 2
MAP7
Microtubule-associated protein 7
MAP1B
Microtubule-associated protein 1B
TBCEL
Tubulin folding cofactor E-like
MTM1
Myotubularin 1
TTL
Tubulin tyrosine ligase
NEGR1
Neuronal growth regulator 1
MAP1B
Microtubule-associated protein 1B
SYT14
Synaptotagmin XIV
SGMS1
Sphingomyelin synthase 1
SYPL1
Synaptophysin-like 1
MTMR10
Myotubularin related protein 10
TUBG1
Tubulin, gamma 1
JAKMIP3
Janus kinase and microtubule interacting protein 3
MACF1
Microtubule-actin crosslinking factor 1
MAP7
Microtubule-associated protein 7
Although the neurogenic potential of human cord blood-derived hematopoietic stem cells has been well documented (El-Badri et al. 2006; Habich et al. 2006; Zangiacomi et al. 2008), the cellular origin of cord blood-derived neurons has not been studied appropriately. CD133 (Prominin-1) is a cell surface marker that in addition to hematopoietic stem cells is expressed on neural stem/progenitor cells. This shared characteristic can be a reason for ectodermal differentiation potential of a population of mesodermal embryonic origin. Furthermore, it is well known that CD133 is highly specific to the stem cell phenotype and that committed cells do not express it (Florek et al. 2005; Shmelkov et al. 2005). Therefore, we isolated and characterized CD133?/CD34? stem cells from human cord blood (Fig. 1) in order to induce them to become neural cells in vitro. Development of a defined culture system to induce neural commitment optimally has been addressed by many studies (Erceg et al. 2010); however, achieving an efficient differentiation protocol remains a challenge. Adherence of stem cells is a prerequisite for neural differentiation. Therefore, prior to differentiation, our
123
Biochem Genet
protocol added a high percentage of FBS (20 %) to the growth medium, and the CD133?/CD34? hematopoietic stem cells adhered to the plate (Fig. 2). In response to some negative side effects attributed to retinoic acid, such as apoptosis (Culbreth et al. 2012; Specht et al. 1998; Voigt and Zintl 2003), we investigated the presence and the absence of this chemical factor through two different neural induction protocols on hematopoietic stem cells. In accordance with the previous reports (Mareschia et al. 2006), we found that supplementing retinoic acid, even in concentrations much lower than commonly used (i.e., 0.1 lM), not only gave rise to a reduction in expression of neural-specific markers but also revealed cytotoxicity and proliferation of inhibitory effects (Fig. 3). Our applied protocol, which was based on slow induction without supplementing retinoic acid, led to neurogenic differentiation of the majority of the cells with neural morphology (Fig. 3) and also augmentation in transcription of main neural markers such as MAP-2, beta-tubulin, and NSE (a mature neuronal marker) (Fig. 5). The strength of our protocol could be attributed to its acceptable time for the regulators and triggers to induce proper differentiation. Expression of MAP-2 and beta-tubulin further confirmed the high efficiency of applied induction medium in driving hematopoietic stem cells toward neural fate. In addition, investigation of NSE using western blotting and immunocytochemistry confirmed its expression in neurons derived from hematopoietic stem cells (Figs. 3, 4). Contrary to multipotential neural stem cells from the central nervous system, unipotential cord blood CD133 ? cells are unable to generate mature glial fibrillary acidic protein positive astrocytes (Zangiacomi et al. 2008); therefore, we did not focus on glial marker expression profile. Altogether, in contrast to a previous study about the conditional neurogenic differentiation of CD133?/CD34 cord blood stem cells (Zangiacomi et al. 2008), we showed that the enriched CD133?/CD34? hematopoietic stem cells can effectively differentiate into neuronal lineages only by applying appropriate induction medium. The extensive regulatory effects of miRNAs are comparable to those of transcription factors (Hobert 2004), and it is well validated that miRNAs control a broad spectrum of biological processes, including lineage determination and nervous development. It has been shown that miR-9 and miR-124, along with some other miRNAs, help prevent the expression of stemness factors and enable rapid neural differentiation (Liu et al. 2011; Maiorano and Mallamaci 2010; Shi et al. 2008; Shibata et al. 2011). For the first time, we inspected the neuronal-related putative targets of these two miRNAs through TargetScan as an online database (Table 2). It is interesting that many of their putative targets have definitive roles in the nervous system. Further empirical validations are suggested for confirmation of the neuro-miRs and their putative target relationships. Since specific neurogenic differentiation indicators, such as transcription of some genes, are not consistent in most neurally differentiated cells, we examined the expression profile of these two neurally committed miRNAs during in vitro neurogenic differentiation of hematopoietic stem cells in order to develop a new neurogenic differentiation indicator. In agreement with other neuronal indicators (MAP-2, beta-tubulin, and NSE), high level expressions of these two brain-specific miRNAs further confirmed their role in neural differentiation. On the other hand, the
123
Biochem Genet
direct correlation between upregulation of miR-9 and miR-124 with neuron-specific markers suggests that these miRNAs could be used as novel differentiated markers for neurally committed hematopoietic stem cells. In conclusion, we showed that a CD133?/CD34? population derived from cord blood can be induced toward a neuronal fate, without any necessity of cell-to-cell contact with other cell types. We also defined the high efficiency of the neuronal induction medium without the use of retinoic acid. In addition, the verified high expression of neural-specific miRNAs with other neuronal specific proteins not only strengthens the regulatory role of miRNAs in determining the fate of hematopoietic stem cells but also introduces these miRNAs as novel indicators of neural differentiation. Overall, these data and other previously published findings highlight the prominent therapeutic benefits of hematopoietic stem cells for use in cell therapy of neurodegenerative diseases. Acknowledgments This article was financially supported by the Stem Cell Technology Research Center.
References Bakhshandeh B, Hafizi M, Ghaemi N, Soleimani M (2012a) Down-regulation of miRNA-221 triggers osteogenic differentiation in human stem cells. Biotechnol Lett 34(8):1579–1587 Bakhshandeh B, Soleimani M, Hafizi M, Ghaemi N (2012b) A comparative study on nonviral genetic modifications in cord blood and bone marrow mesenchymal stem cells. Cytotechnology 64(5):523–540 Bakhshandeh B, Soleimani M, Hafizi M, Paylakhi SH, Ghaemi N (2012c) MicroRNA signature associated with osteogenic lineage commitment. Mol Biol Rep 39:7569–7581 Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:281–297 Brett JO, Renault VM, Rafalski VA, Webb AE, Brunet A (2011) The microRNA cluster miR-106b*25 regulates adult neural stem/progenitor cell proliferation and neuronal differentiation. Aging (Albany NY) 3:108–124 Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, Dono M, Dell’Aquila ML, Alder H, Rassenti L, Kipps TJ, Bullrich F, Negrini M, Croce CM (2004) MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci USA 101:11755–11760 Cohen Y, Nagler A (2004) Umbilical cord blood transplantation: How, when and for whom? Blood Rev 18:167–179 Culbreth ME, Harrill JA, Freudenrich TM, Mundy WR, Shafer TJ (2012) Comparison of chemicalinduced changes in proliferation and apoptosis in human and mouse neuroprogenitor cells. Neurotoxicology. doi:10.1016/j.neuro.2012.05.012 El-Badri NS, Hakki A, Saporta S, Liang X, Madhusodanan S, Willing AE, Sanberg CD, Sanberg PR (2006) Cord blood mesenchymal stem cells: Potential use in neurological disorders. Stem Cells Dev 15:497–506 Erceg S, Ronaghi M, Zipancic I, Lainez S, Rosello MG, Xiong C, Moreno-Manzano V, RodriguezJimenez FJ, Planells R, Alvarez-Dolado M, Bhattacharya SS, Stojkovic M (2010) Efficient differentiation of human embryonic stem cells into functional cerebellar-like cells. Stem Cells Dev 19:1745–1756 Fan C, Zhang Q, Tang F, Han Z, Wang G, Han Z (2005) Human umbilical cord blood cells express neurotrophic factors. Neurosci Lett 380:322–325 Florek M, Haase M, Marzesco AM, Freund D, Ehninger G, Huttner WB, Corbeil D (2005) Prominin-1/ CD133, a neural and hematopoietic stem cell marker, is expressed in adult human differentiated cells and certain types of kidney cancer. Cell Tissue Res 319:15–26 Gage F (2000) Mammalian neural stem cells. Science 287:1433–1438
123
Biochem Genet Habich A, Jurga M, Markiewicz I, Lukomska B, Bany-Laszewicz U, Domanska-Janik K (2006) Early appearance of stem/progenitor cells with neural-like characteristics in human cord blood mononuclear fraction cultured in vitro. Exp Hematol 34:914–925 Hermann A, Liebau S, Gastl R, Fickert S, Habisch HJ, Fiedler J, Schwarz J, Brenner R, Storch A (2006) Comparative analysis of neuroectodermal differentiation capacity of human bone marrow stromal cells using various conversion protocols. J Neurosci Res 83:1502–1514 Hobert O (2004) Common logic of transcription factor and microRNA action. Trends Biochem Sci 29:462–468 Horner P, Power A, Kempermann G, Kuhn H, Palmer T, Winkler J, Thal L, Gage F (2000) Proliferation and differentiation of progenitor cells throughout the intact adult rat spinal cord. J Neurosci 20:2218–2228 Jang Y, Park J, Lee M, Yoon B, Yang Y, Yang S, Kim S (2004) Retinoic acid-mediated induction of neurons and glial cells from human umbilical cord-derived hematopoietic stem cells. J Neurosci Res 75:573–584 Kapsimali M, Kloosterman WP, de Bruijn E, Rosa F, Plasterk RH, Wilson SW (2007) MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system. Genome Biol 8:R173 Koh LP (2004) Unrelated umbilical cord blood transplantation in children and adults. Ann Acad Med Singap 33:559–569 Kole AJ, Swahari V, Hammond SM, Deshmukh M (2011) miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. Genes Dev 25:125–130 Lee OK, Kuo TK, Chen WM, Lee KD, Hsieh SL, Chen TH (2004) Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103:1669–1675 Liu K, Liu Y, Mo W, Qiu R, Wang X, Wu JY, He R (2011) MiR-124 regulates early neurogenesis in the optic vesicle and forebrain, targeting NeuroD1. Nucleic Acids Res 39:2869–2879 Lunn JS, Sakowski SA, Hur J, Feldman EL (2011) Stem cell technology for neurodegenerative diseases. Ann Neurol 70:353–361 Maiorano NA, Mallamaci A (2010) The pro-differentiating role of miR-124: indicating the road to become a neuron. RNA Biol 7:528–533 Mareschia K, Novarab M, Rustichellia D, Ferreroa I, Guidob D, Carboneb E, Medicoc E, Madona E, Vercellid A, Fagioli F (2006) Neural differentiation of human mesenchymal stem cells: evidence for expression of neural markers and eag K? channel types. Exp Hematol 34:1563–1572 Moise KJ Jr (2005) Umbilical cord stem cells. Obstet Gynecol 106:1393–1407 Nadri S, Soleimani M, Mobarra Z, Amini S (2008) Expression of dopamine-associated genes on conjunctiva stromal-derived human mesenchymal stem cells. Biochem Biophys Res Commun 377:423–428 Nilsen TW (2007) Mechanisms of microRNA-mediated gene regulation in animal cells. Trends Genet 23:243–249 Padovan C, Jahn K, Birnbaum T, Reich P, Sostak P, Strupp M, Straube A (2003) Expression of neuronal markers in differentiated marrow stromal cells and CD133? stem-like cells. Cell Transplant 12:839–848 Pasquinelli AE (2012) MicroRNAs and their targets: recognition, regulation and an emerging reciprocal relationship. Nat Rev Genet 13:271–282 Reddi AS, Kuppasani K, Ende N (2010) Human umbilical cord blood as an emerging stem cell therapy for diabetes mellitus. Curr Stem Cell Res Ther 5:356–361 Shi Y, Sun G, Zhao C, Stewart R (2008) Neural stem cell self-renewal. Crit Rev Oncol Hematol 65:43–53 Shibata M, Nakao H, Kiyonari H, Abe T, Aizawa S (2011) MicroRNA-9 regulates neurogenesis in mouse telencephalon by targeting multiple transcription factors. J Neurosci 31:3407–3422 Shmelkov SV, St Clair R, Lyden D, Rafii S (2005) AC133/CD133/Prominin-1. Int J Biochem Cell Biol 37:715–719 Smirnova L, Gra¨fe A, Seiler A, Schumacher S, Nitsch R, Wulczyn F (2005) Regulation of miRNA expression during neural cell specification. Eur J Neurosci 21:1469–1477 Specht H, Esdar C, Oehrlein S, Maelicke A (1998) Retinoic acid induces apoptosis-associated neural differentiation of a murine teratocarcinoma cell line. J Neurochem 70:47–58 Titomanlio L, Kavelaars A, Dalous J, Mani S, El Ghouzzi V, Heijnen C, Baud O, Gressens P (2011) Stem cell therapy for neonatal brain injury: perspectives and challenges. Ann Neurol 70:698–712
123
Biochem Genet Trompeter HI, Abbad H, Iwaniuk KM, Hafner M, Renwick N, Tuschl T, Schira J, Muller HW, Wernet P (2011) MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS ONE 6:e16138 Voigt A, Zintl F (2003) Effects of retinoic acid on proliferation, apoptosis, cytotoxicity, migration, and invasion of neuroblastoma cells. Med Pediatric Oncol 40:205–213 Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR (2011) MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476:228–231 Zangiacomi V, Balon N, Maddens S, Lapierre V, Tiberghien P, Schlichter R, Versaux-Botteri C, Deschaseaux F (2008) Cord blood-derived neurons are originated from CD133?/CD34 stem/ progenitor cells in a cell-to-cell contact dependent manner. Stem Cells Dev 17:1005–1016 Zhou H, Chang S, Rao M (2012) Human cord blood applications in cell therapy: looking back and look ahead. Expert Opin Biol Ther 12:1059–1066
123
All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and rea
