Mitochondrial DNA metabolism in early development of zebrafish (Danio rerio)

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/222944270

Mitochondrial DNA metabolism in early development of zebrafish (Danio rerio). Article in Biochimica et Biophysica Acta (BBA) - Bioenergetics · May 2012

CITATIONS

READS

11

77

7 authors, including: Lucia Artuso

Tiziano Verri

Università degli Studi di Modena e Reggio Em…

Università del Salento

16 PUBLICATIONS 138 CITATIONS

107 PUBLICATIONS 1,100 CITATIONS

SEE PROFILE

SEE PROFILE

Francesco Argenton

Vittoria Petruzzella

University of Padova

Università degli Studi di Bari Aldo Moro

127 PUBLICATIONS 2,357 CITATIONS

82 PUBLICATIONS 2,555 CITATIONS

SEE PROFILE

SEE PROFILE

Some of the authors of this publication are also working on these related projects: Identifying the functional network driving the physiological roles of histidine-based dipeptides in excitable cells of vertebrates View project

All content following this page was uploaded by Lucia Artuso on 22 January 2017. The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the original document and are linked to publications on ResearchGate, letting you access and read them immediately.

Biochimica et Biophysica Acta 1817 (2012) 1002–1011

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbabio

Mitochondrial DNA metabolism in early development of zebrafish (Danio rerio) Lucia Artuso a, Alessandro Romano b, Tiziano Verri b, Alice Domenichini c, Francesco Argenton c, Filippo Maria Santorelli d, Vittoria Petruzzella a,⁎ a

Department of Basic Medical Sciences, University of Bari, Bari, Italy Department of Biological and Environmental Sciences & Technologies, University of Salento, Lecce, Italy Department of Biology, University of Padua, Padua, Italy d Molecular Medicine & Neurogenetics, IRCCS Stella Maris, Pisa, Italy b c

a r t i c l e

i n f o

Article history: Received 15 November 2011 Received in revised form 12 March 2012 Accepted 14 March 2012 Available online 23 March 2012 Keywords: Danio rerio Mitochondrial DNA Respiratory chain complex Embryo development Mitochondrial transcription Mitochondrial replication

a b s t r a c t Changes in the mitochondrial DNA (mtDNA) population, together with the expression of a set of genes involved in mtDNA replication and transcription and genes encoding for components of OxPhos complexes, were studied during zebrafish development from early embryo to larval stages. The mtDNA copy number, measured from 1 h post-fertilization to the adult stage, significantly decreased over time, suggesting that mtDNA replication is not active in early zebrafish embryos and that, as in mammals, there occurs partition of the maternal mtDNA copies. Zebrafish genes involved in mtDNA replication (i.e. catalytic subunit of the mtDNA polymerase γ, mitochondrial deoxyribonucleoside kinase) are expressed late in embryo development, further supporting the notion that there is no replication of mtDNA in the early stages of zebrafish development. Notably, as from 4 days post-fertilization, marked expression of “replication genes” was observed in the exocrine pancreas. Interestingly, the mtDNA helicase, also involved in mtDNA replication, was detected early in development, suggesting diverse regulation of this gene. On the other hand, zebrafish mtDNA transcription genes (i.e. mtDNA-directed RNA polymerase, mitochondrial transcription factor A) were ubiquitously expressed in the early stages of development, suggesting that mitochondrial transcription is already active before mtDNA replication. This hypothesis of early activation of mtDNA transcription fits in with the high early expression of structural OxPhos genes, suggesting that an active OxPhos system is necessary during early embryogenesis. As well as providing the first description of mtDNA distribution during zebrafish development, the present study also represents a step toward the use of Danio rerio as a model for investigation of mitochondrial metabolism and disease. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The mitochondrial genome, given its essential role in the oxidative phosphorylation (OxPhos) system [1], is vital in the metabolism, physiology and development of all animals. Considering that mitochondrial DNA (mtDNA) is highly conserved in number and gene order in all vertebrates [2,3], it is conceivable that the molecular machineries required for mtDNA maintenance and expression are almost completely conserved during evolution. The zebrafish mtDNA is a typical animal mitochondrial genome, both in size and gene content. It is a circular, double-stranded, 16596-nucleotide genome [4] and it encodes seven subunits of NADH dehydrogenase (Complex I), one subunit of cytochrome c reductase (Complex III), three subunits of cytochrome c oxidase (Complex IV) and two subunits of ATP synthase (Complex V). Moreover, transcription of this genome produces components of the genome's own translational ⁎ Corresponding author at: Department of Basic Medical Sciences, University of Bari, Piazza Giulio Cesare, 70124 Bari, Italy. Tel.: + 39 080 5448529; fax: + 39 080 5448538. E-mail address: [email protected] (V. Petruzzella). 0005-2728/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.bbabio.2012.03.019

apparatus, i.e. 22 tRNAs and 2 rRNAs, emphasizing its semiautonomous nature as these processes are also dependent on the nuclear genome. mtDNA replication and expression are mediated by several nuclear-encoded transcription and replication factors, some of which, along with mtDNA, are packed to form the mitochondrial “nucleoids” [5,6]. Nucleoid has been shown to have a mean size of ~100 nm in a variety of mammals and frequently contains a single copy of mtDNA [7]. Mitochondrial transcription factor A (TFAM; [8,9]) belongs to the high mobility group box family, and is thought to wrap, bend and unwind mtDNA [10–12], to initiate mtDNA transcription [11,13–15] and replication, and to determine mtDNA copy number [12,16,17]. DNA polymerase gamma (POLγ) is essential in mtDNA maintenance [18] because of its key role in replication, recombination and repair of mtDNA [19]. In animal cells, POLγ consists of two subunits: the catalytic subunit (POLG A), whose 3′→5′ exonuclease activity accounts for the high fidelity of this enzyme, and the accessory subunit (POLG B), which in humans forms a 2:1 heterotrimer – heterodimer in other mammalian species – with POLG A [20,21]. Several pieces of evidence in the literature have highlighted the importance of POLG A in mtDNA replication in numerous animal

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

models [16,22,23]. Mutations in the catalytic subunit of the yeast POLγ (mitochondrial polymerase 1; MIP1) result in mtDNA depletion and the formation of petite rho0 cells [24]. Flies deficient in POLγ activity are weak and uncoordinated, their growth is significantly slower than that of wild-type flies, and they present noticeable defects in the development of the adult visual system [22]. In mice, homozygous disruption of the Polg gene coincides with a dramatic decrease in mtDNA levels and leads to embryonic lethality at late gastrulation before early organogenesis [16]. In addition, Polg null mouse embryos at E8.5 display severe respiratory chain deficiency and are much smaller than wild-type embryos [16]. On the other hand, homozygous Polg1 Caenorhabditis elegans mutants develop normally and reach adulthood without morphological defects, even though they present impaired gonadal function leading to sterility and reduced lifespan as a result of marked mitochondrial depletion [23]. Other factors essential in mtDNA replication include TWINKLE, POLRMT, and TK2. TWINKLE [25] is structurally similar to the bacteriophage T7 gene 4 protein, which shows both helicase and primase activities [25,26]. TWINKLE unwinds mtDNA interacting with the mtSSB and TFAM proteins [27], which not only act as structural components but also stabilize mtDNA during replication [28,29]. Mitochondrial DNA replication is coupled to transcription, which, in vertebrates, is initiated bidirectionally within the D-loop regulatory region [30,31] to produce polycistronic precursor RNAs encompassing all the genes encoded by each strand. These primary transcripts are processed to produce the individual mRNA, rRNA, and tRNA molecules [32–34]. The mitochondrial DNA-directed RNA polymerase (POLRMT) is responsible for the transcription of mtDNA. POLRMT cannot interact directly with promoters: it requires the assistance of mitochondrial transcription factor A (TFAM) as well as of one of the two mitochondrial transcription factor B paralogs (TFB2M, also called mtTFB2) [35–37], which constitute the basal machinery necessary and sufficient for promoter-specific initiation of transcription. Thymidine kinase (TK2) is an intramitochondrial pyrimidine nucleoside kinase that phosphorylates deoxythymidine, deoxycytidine and deoxyuridine to generate the corresponding deoxynucleotide 5′-monophosphates, thereby participating in the salvage pathway of deoxynucleotide synthesis in the mitochondria. Mitochondrial dNTP pools arise either through active transport of cytosolic dNTPs or through salvage pathways by the action of two mitochondrial deoxyribonucleoside kinases, TK2 and deoxyguanosine kinase, responsible for the salvage pathways of pyrimidine and purine nucleotides, respectively. Both pathways are essential for the replication of mtDNA since the mitochondria are unable to synthesize deoxynucleotides de novo. In addition, since mtDNA is replicated throughout the cell cycle, there is a constant need for nucleotides for mtDNA replication. In nonreplicating tissues, TK2 is one of the indispensable enzymes for mtDNA maintenance [38–40]. There is increasing recognition of the role played by the mitochondrial genome in animal life and during embryo development, as its genetic alterations severely affect cell function, offspring survival and, in humans, quality of life. To date, studies on systems of mitochondrial replication and transcription during development have focused on mammals [16,41–43], Xenopus [44,45], Drosophila [22], and C. elegans [23], whereas no studies have specifically addressed the “metabolism” of the mitochondrial genome in zebrafish (Danio rerio), a valuable model in developmental genetics [46]. In actual fact, little is known about the chronology of mtDNA replication and transcriptional events in vertebrate zygotes and embryos, and in this context the zebrafish could provide an excellent model system for investigating the mechanisms of mitochondrial biogenesis and genetics during embryonic development. In the present work, zebrafish mtDNA metabolism was studied during the development of the zygote through to the adult age. We analyzed the mtDNA population from early embryo development up to late larval stages along with the expression of a set of genes involved in mtDNA replication and transcription and genes involved

1003

in the OxPhos system. We identified the orthologous zebrafish nuclear genes involved in mtDNA maintenance, focusing particularly on those that in humans are candidate disease genes for mitochondrial pathologies. To this end, we investigated the expression of a catalytic subunit of the mtDNA polymerase γ (polg1), mtDNA helicase (twinkle) and deoxyribonucleoside kinase (tk2), in addition to mtDNA-directed RNA polymerase (polrmt) and mitochondrial transcription factor A (tfam). To assess the biogenesis of mitochondrial complexes, we also evaluated the NADH–ubiquinone oxidoreductase iron–sulfur protein 4 subunit (ndufs4), succinate dehydrogenase complex subunit A (sdha), ubiquinol–cytochrome c reductase core protein II (uqcrc2), cytochrome c oxidase subunit Va (cox5ab), and ATP synthase mitochondrial F1 complex alpha subunit (atp5α1) genes. Moreover, NADH–ubiquinone oxidoreductase subunit 1 (mt-nd1) was investigated as representative of polycistronic mitochondrial transcripts. The mitochondrial functions of the zebrafish have been relatively well conserved during evolution, and accumulating data in this species are strengthening the importance of this animal model in the investigation of mitochondrial metabolism and diseases.

2. Results 2.1. Absolute quantification of mitochondrial DNA copy number in zebrafish embryos, larvae and adults When mtDNA copy number was quantified by real-time polymerase chain reaction (RT-PCR) during zebrafish development, a considerable decrease in mtDNA abundance was observed in embryos from 1 h post-fertilization (hpf) (4-cell stage; ~1.4× 107 copies per cell) to 6 hpf (shield stage; ~8000 copies per cell). Thereafter, mtDNA was found to decrease to ~4000, ~1700 and ~1750 copies per cell at 24 hpf, 48 hpf and 3 days post-fertilization (dpf), respectively; after that an increase at 4 and 5 dpf, which reached values of ~2300 and 3100 copies per cell, was followed by a further drop at 8 dpf (~1250 copies per cell). In adults, the mtDNA copy number was ~5500 (Fig. 1). Interestingly, the absolute quantification of mtDNA per single embryo or larva showed that the amount of mtDNA remained stable for the first 24 hpf; then, there was a slight increase in the amount of mtDNA from 48 hpf through to 8 dpf (Suppl. Fig. 1), suggesting that no mtDNA replication occurs at least in the early stages of development (1–24 hpf).

Fig. 1. Mitochondrial DNA copy number during zebrafish development.Mitochondrial DNA copy number calculated at embryo stages (1 hpf, 6 hpf, 24 hpf, 48 hpf), larval stages (3 dpf, 4 dpf, 5 dpf, 8 dpf) and in adult DNA samples. The copy number was estimated by ratio of the mitochondrial gene for mt-nd1 and the single copy nuclear gene for polg1. The significance of the assay was evaluated by the ANOVA method followed by Bonferroni's multiple comparison post-hoc test. Three asterisks above the 1 hpf value indicate statistical significance (P b 0.0001) with respect to all the other values.

1004

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

2.2. Identification and characterization of zebrafish mitochondrial biogenesis genes

from nuclear genes, especially at 5 dpf (Fig. 2D and Suppl. Fig. 3), a feature already observed in mice [48].

To assess type and timing of activation of enzymatic functions involved in mtDNA synthesis and expression during embryo development, we characterized genes encoding representative proteins fundamental for replication and transcription of mtDNA, namely: polg1, tk2, twinkle, polrmt and tfam. We also considered the expression of a few nuclear-encoded subunits of the mitochondrial respiratory complexes, such as ndufs4, shda, uqcrc2, cox5ab and atp5α1 and, as a representative of polycistronic mitochondrial transcripts, mt-nd1. The information relative to each single ortholog gene is set out in Table 1. We amplified by RT-PCR all zebrafish genes and observed, for three of them (namely, twinkle, polrmt and tfam), the existence of alternative spliced isoforms (see Suppl. Fig. 2), as seen in humans. All RT-PCR products underwent direct resequencing to confirm the identity of transcripts. A zebrafish genome database search excluded duplication for all the genes studied, in spite of evidence of an ancient whole-genome duplication event in the teleost lineage [47] that implies the existence of up to 20% of duplicated genes in the D. rerio genome.

2.4. Whole-mount in situ hybridization in zebrafish embryos and larvae

2.3. Relative quantification of mRNA amounts by RT-PCR The 2− ΔΔCt method was used to evaluate the differential expression of genes in embryo stages with respect to the adult stage (Fig. 2). The polg1 and tk2 transcripts showed a similar pattern during the embryonic stages (Fig. 2A) with relatively low and unvarying mRNA expression during the developmental stages analyzed and a slight increment at 12 hpf and 24 hpf for polg1 and tk2, respectively. Twinkle mRNA was detectable throughout development from 2 hpf (64 cells) to 5 dpf. In particular, twinkle showed a very high level of expression at 2 hpf, almost comparable to the adult level; this was followed by a dramatic decrease at 6 hpf, after which the level remained relatively stable up to 5 dpf. A similar pattern was seen for polrmt mRNA with the highest level seen at 2 hpf. tfam showed a high level of expression at all stages, despite exhibiting a decrease between 2 and 6 hpf; this was followed by a rise to 2-fold until completion of somitogenesis (24 hpf). The expression of tfam at 48 hpf showed a drop but the level was restored in larvae at 5 dpf (Fig. 2B). Structural components of the OxPhos system (ndufs4, sdha, uqcrc2, cox5ab and atp5α1) showed, in adults, a higher level of expression than that shown by genes encoding proteins involved in mtDNA replication and transcription. In particular, the ndufs4 transcript showed an mRNA level that increased gradually from 2 hpf to the adult stage, whereas the sdha, uqcrc2, cox5ab and atp5α1 genes each showed a different expression profile during development as summarized in Fig. 2C. Unlike other transcripts, the expression of the mitochondrial gene mt-nd1 was 10–20-fold more abundant than mRNAs derived

Table 1 Zebrafish genes: characterization and ID numbers. Abbreviation GenBank

polg1 tk2 twinkle polrmt tfam ndufs4 sdha uqcrc2 cox5ab atp5α1 mt-nd1

XR_029715 NM_001002743 XR_044988 XM_680046 NM_001077389 NM_001020676 NM_200910 NM_001001589 XM_695484 NM_001077355 AC024175

chr Exons cDNA length (bp) 25 7 12 22 12 5 19 12 18 21 MT

22 10 6 20 7 5 15 14 5 11 –

Amino % amino Score (Blastp) acids acid identity

4157 1206 1400 307 2796 660 4426 1281 1401 277 618 168 2576 661 1685 454 658 151 1876 551 16,596 324

69% 72% 59% 46% 45% 80% 83% 63% 75% 91% 68%

1659 322 827 1110 176 245 1130 554 216 1026 402

Whole-mount in situ hybridization (WMISH) showed that the transcripts of polg1 and tk2 were either absent or weakly and ubiquitously expressed in embryos/larvae. Notably, in 4 and 5 dpf a strong expression signal was detectable in the exocrine pancreas (Fig. 3, A6–9 and B6–9). twinkle transcripts were detected ubiquitously at 6 hpf and particularly concentrated at the level of the tail bud (Fig. 4, C1), whereas at later stages expression was observed in brain structures (Fig. 4, C2–4). tfam expression was detected ubiquitously throughout the embryo with strong signals from the early stages of development (2 and 6 hpf; Fig. 4, D). By 24 hpf, tfam expression specifically highlighted brain, myotomes and heart. polrmt transcripts were detected ubiquitously throughout the embryo at early stages of development (Fig. 5, E1). By 24 hpf, polrmt expression had started to shift toward anterior regions of the embryo and at 5 dpf there was specific expression in brain, eyes and gut structures (Fig. 5, E8–9). ndufs4 and atp5α1 were highly and ubiquitously expressed throughout zebrafish embryos through to larvae (5 dpf), highlighting brain and myotomes (Fig. 6, F–G). 3. Discussion In the present work, we described in detail the profile of mtDNA population changes from early embryo development through to the larval stages. Moreover, we investigated the expression of a set of genes involved in mtDNA replication and transcription along with genes representative of OxPhos complexes. We evaluated the developmental changes in mtDNA copy number in zebrafish embryos/larvae. In particular, we observed a drastic decrease in mtDNA copy number from 1 to 24 hpf embryos. These results suggest that in zebrafish, as in mammals, the total content of mtDNA remains constant during embryonic development [49] and that the maternal organelles are distributed among the blastomeres according to a mechanism of partition of the oocyte organelles. This hypothesis is well supported by the observation that mtDNA replication does not take place during the early stages of zebrafish development; in fact, the total amount of mtDNA measured per embryo remains stable through to at least 24 hpf. Mitochondrial DNA copy number quantification in mammals, including mice [49,50], rats [43], cattle [41], pigs [42] and humans [51–53], has established a count of approximately 200,000 molecules per oocyte. In our study, we showed that zebrafish have about 1.4 × 10 7 copies/cell at the 4-cell stage. This higher mtDNA content is in line with that determined in ovarian follicles of zebrafish [54,55] and in oocytes of another teleost, the chinook salmon (Oncorhynchus tshawytscha) [56]. Differences with respect to mammalian oocytes are likely due to differences in the size and metabolic demands of externally developing embryos, as suggested by others [56]. We also demonstrated that genes involved in mtDNA replication, such as polg1 and tk2, had a lower level of expression during embryo development compared with the adult state. It is intriguing that both these genes showed marked spatially-restricted organ expression, limited to the exocrine pancreas, from 4 dpf, thereby mimicking the higher expression in the gut seen in Drosophila [57]. Anatomically, the exocrine/duct compartment of the zebrafish pancreas originates from the anteroventral pancreatic bud, which emerges from the ventral portion of the gut tube at 40 hpf [58]. Differentiation and morphogenesis of the exocrine pancreas occur at 48 hpf, and acini and small ducts start to be evident in 72 hpf larvae [59]. Markers for the differentiated pancreatic exocrine cells, such as trypsin [60] and elastase B [61], are progressively detected at the 3–4 dpf stages. In this respect, the strong expression of polg1 and tk2 at 4 dpf might depend both on a strong proliferation of the organ at this stage and

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

1005

Fig. 2. Expression of genes involved in mitochondrial biogenesis during zebrafish development.Differential expression of polg1, twinkle, tk2 (A), polrmt, tfam (B), ndufs4, sdha, uqcrc2, cox5ab, atp5α1 (C) and mt-nd1 (D) genes by quantitative RT-PCR during zebrafish development. The value of 2− ΔΔCt represents the expression of mitochondrial genes in each developmental stage normalized to 18S and relative to the normalized expression of genes in the adult individual.

on the timing of the intense production of the digestive enzymes that are required to hydrolyze the external food reaching the proximal intestine [62]. These observations, albeit requiring a speculative leap forward, partly explain the frequent [63,64] or isolated [65,66] organ failure in human disorders of oxidative metabolism. Taken together, they could indicate a need to consider genes involved in mitochondrial replication (such as polg1 and tk2) in the pathological manifestations of clinical conditions such as Pearson's syndrome, possibly through disease modeling in zebrafish. On the other hand, the process of mtDNA transcription, as shown by the expression of the mtRNA polymerase and tfam genes, already seems to be active

at 2 hpf. Transcripts for these genes were detectable throughout the developmental stages analyzed, with highest expression levels being observed at 2 hpf. The higher levels seen for tfam during all the embryo stages are likely a result of its multiple roles, of which transcription, mtDNA packaging and initiation of replication are but a few [67]. The early activation of the RNA transcription process fits in with the high expression levels observed for the OxPhos genes. NADH–ubiquinone oxidoreductase subunit 1 (mt-nd1), a marker of the polycistronic mitochondrial transcript, has a global expression, which is higher than that of the nuclear genes, as already reported in mammals [48]. Since the zygotic genome is thought to become

1006

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

POLG1

A1

A4

A2

6 hpf

A8

A6

5 dpf

4 dpf

10 hpf

48 hpf

A3

A5

A7

A9

EP

EP

HB

24 hpf

3 dpf

B6

B4

B2

B1

4 dpf

5 dpf

B8

PF

10 hpf

TK2

6 hpf

5 dpf

4 dpf

B3 48 hpf

B7

B9

EP

EP

B5 3 dpf

24 hpf

4 dpf

5 dpf

Fig. 3. polg1 and tk2 localization by whole-mount in situ hybridization in zebrafish embryos and larvae.polg1 (A) and tk2 (B) transcripts are detectable as faint and ubiquitous in embryos/larvae. From 3 to 5 dpf (A5–9, B5–9) there is strong expression localized mainly in the exocrine pancreas. EP: exocrine pancreas; HB: hindbrain; PF: pectoral fin.

C1

C4

C6

C8

6 hpf

TWINKLE

C2 48 hpf 24 hpf

C5

5 dpf

4 dpf

C7

C9

C3

3 dpf

24 hpf

D1

D5B

D2

5 dpf

4 dpf

D10

D8

B

TFAM

6 hpf

M 48 hpf

10 hpf

B

BA M

D6

D3

5 dpf

B 24 hpf

4 dpf BA

D4

3 dpf

D7

M 24 hpf

D9

B

M M

3 dpf

D11

4 dpf

BA

5 dpf

Fig. 4. twinkle and tfam localization by whole-mount in situ hybridization in zebrafish embryos and larvae.twinkle (C) is ubiquitously expressed at 6 hpf (C1), whereas at later stages expression is localized mainly within brain structures. tfam (D) expression is ubiquitous and intense throughout the embryo from the early stages of development. A very intense signal is detected for the tfam transcript throughout the embryo stages. B: brain; BA: branchial arches; M: myotomes.

1007

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

E1

E6

E4

B

G

48 hpf

6 hpf

POLRMT

E8

4 dpf

E5

E2

5 dpf

E7

E9

24 hpf B

E3

B

24 hpf

3 dpf

4 dpf

5 dpf

Fig. 5. polrmt localization by whole-mount in situ hybridization in zebrafish embryos and larvae.polrmt (E) transcripts are ubiquitous throughout the early embryo stages. By 24 hpf the expression starts to shift toward the anterior regions and at 5 dpf there is specific expression in brain, eyes and gut structures. B: brain; G: gut.

preferential distribution to brain and muscular structures, indicates that mitochondrial proliferation (represented by number of mitochondrial genomes) and tissue differentiation (indicated by expression of OxPhos complexes) are not spatio-temporally coupled during development. Finally, in spite of the ancient genome duplication event that occurred in teleosts [47], we invariably found that a single ortholog for each of the nuclear-encoded mitochondrial genes studied fits. This fits in with what was previously postulated about housekeeping genes by the duplication–degeneration–complementation model [70], since the probability of duplicated gene preservation decreases for genes, like metabolic genes, that have a simple regulatory region. In conclusion, our results suggest that in zebrafish there is a temporal separation between mtDNA replication and transcription processes. Mitochondrial DNA replication appears to be unnecessary

active at the mid-blastula transition, which coincides with the degradation of a subset of maternal mRNAs [68], it is possible to argue that a strong contribution might be made by maternal mitochondrial transcription genes, including RNA polymerase and tfam, which are ready to actively transcribe mitochondrial genomes that, on the other hand, are not replicated but passively distributed among the proliferating cells. Unexpectedly, at 2 hpf, twinkle showed an expression independent from that of polg1 but more similar to polrmt. These data are in agreement with the findings of an independent regulation of expression between twinkle and polg1: twinkle is regulated by NRF-2 similarly to polrmt, mterf, mtssb, and polg2; whereas polg1 is not [69]. Thus, it is possible that twinkle may play additional unknown and non-canonical roles in the embryo cells. Conversely, the high expression of some nuclear-encoded OxPhos genes at very early embryo stages, with

F1

F3

F5

F7

NDUFS4

M

BA

M 48 hpf

10 hpf

F2

F4

4 dpf

F6

B

G1

G2

BA

BA

B

BA

24 hpf

5 dpf

4 dpf

3 dpf

G5

5 dpf

F8

G8

G6

G12

MHB 3 dpf

ATP5α α1

M 6 hpf

48 hpf

10 hpf

G3

48 hpf

G7

4 dpf

M

3 dpf MHB

BA

PF

M 24 hpf

BA

G9

48 hpf

G10

G11 M

4 dpf

BA 4 dpf

Fig. 6. ndufs4 and atp5α1 localization by whole-mount in situ hybridization in zebrafish embryos and larvae.ndufs4 (F) and atp5α1 (G) are highly and ubiquitously expressed throughout zebrafish embryo stages and through to 5 dpf larvae, highlighting brain and myotomes. B: brain; BA: branchial arches; M: myotomes; MHB: midbrain hindbrain boundary; PF: pectoral fin.

1008

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

4.2. Bioinformatics comparison of zebrafish and human genes

Table 2 Primer for mitochondrial DNA quantification. Reference/target

GenBank

Gene

Primer sequence (5′→3′)

Nuclear gene reference Mitochondrial gene target

XR_029715

Polg1

AC024175

Mt-nd1

(F) GAGAGCGTCTATAAGGAGTAC (R) GAGCTCATCAGAAACAGGACT (F) AGCCTACGCCGTACCAGTATT (R) GTTTCACGCCATCAGCTACTG

for early development, given that the replisome apparatus is expressed later, whereas there is an immediate need for an efficient OxPhos system (Table 2). 4. Materials and methods 4.1. Fish breeding and embryo collection Zebrafish embryos and adults were maintained and mated according to standard procedures and all experiments were carried out with the approval of the University of Lecce animal experimentation ethics committee [71]. Adult zebrafish were bred by natural crosses in a male-to-female ratio of 2:1 [71]. Immediately after spawning, the bottoms of the aquariums were siphoned. The fertilized eggs were harvested, washed, and placed in 9-cm-diameter Petri dishes in 0.6 mg/l Instant Ocean sea salts (Aquarium Systems, Sarrebourg, France). The developing embryos were incubated at 28.5 °C until use. Developmental stages of zebrafish embryos were expressed as hours post-fertilization (hpf) or days post-fertilization (dpf) [72].

In accordance with guidelines proposed for different species, mouse and human proteins are reported as XXX while genes are reported as XXX in humans and Xxx in mice. In fish, proteins are reported as Xxx, and genes as xxx (http://zfin.org/zf_info/nomen.html). Human sequences of POLG1, TK2, TWINKLE, POLRMT, TFAM, NDUFS4, SDHA, UQCRC2, COX5ab, ATP5α1 and mt-ND1 proteins were blasted to the zebrafish genome using the tblastn tool at NCBI (http://blast.ncbi.nlm.nih.gov/), allowing identification of the zebrafish transcripts. The corresponding zebrafish amino acid sequences were analyzed with the ClustalW tool at EBI (http://www.ebi.ac.uk/) and with the PROSITE tool at Expasy (http://www.expasy.ch/) to identify putative functional domains conserved during evolution. GenBank accession numbers for the selected sequences are reported in Table 1. To design primers on zebrafish sequences, both for mtDNA analysis (Table 1) and quantitative RT-PCR and WMISH experiments (Table 3), the Primer Blast tool at NCBI was used. 4.3. Isolation of DNA from zebrafish embryos, larvae and adults DNA was extracted from single prefixed whole embryos and larvae at different stages of development. Each embryo was transferred to a sterile microfuge tube containing 50 μl of lysis buffer (50 mM Tris– HCl pH 8.5, 1 mM EDTA, 0.5% Tween-20, 200 μg/ml proteinase K) and incubated at 55 °C for 2 h, and then at 95 °C for 10 min to denature proteinase K [73]. For complete lysis of the larvae 80 μl of lysis buffer was used. Standard methods were used to perform DNA extraction from a male adult fish (12 months old).

Table 3 Zebrafish genes and primers used for quantitative RT-PCR and WMISH experiments. WMISH Amplified primer sequence region for WMISH (nt) (5′→3′)

Gene name

Function

Q RT-PCR primer Abbreviation Amplified region for Q sequence (5′→3′) RT-PCR (nt)

Beta actin

Cytoskeletal structural protein 18S small subunit ribosomal RNA Mitochondrial DNA polymerase catalytic subunit Enzyme of mitochondrial dNTP salvage pathway

β-Actin

1023–1122

18s rrna

140–257

polg1

3330–3462

tk2

552–666

Mitochondrial DNA ATP-dependent helicase Mitochondrial DNA-directed Enzyme responsible RNA polymerase for mitochondrial DNA transcription Mitochondrial transcription Mitochondrial factor A transcription factor A Mitochondrially-encoded Subunit 1 of respiratory NADH dehydrogenase 1 chain complex I NADH dehydrogenase Mitochondrial Fe–S protein 4, 18 kDa NADH–ubiquinone oxidoreductase 18 kDa subunit Subunit A of respiratory Succinate dehydrogenase chain complex II complex subunit A, flavoprotein Ubiquinol–cytochrome c Subunit 2 of cytochrome reductase core protein II b-c1 complex III Mitochondrial cytochrome Cytochrome c oxidase c oxidase 5ab subunit subunit Va

twinkle

1634–1807

polrmt

2501–2654

tfam

396–558

mt-nd1

3841–3983

ndufs4

111–535

sdha

500–1046

(F) TGGTATGCCGTTCAGCCGTA (R) GGCCAAGTCTTTGGCATTGG

–

– –

uqcrc2

517–988

–

cox5ab

85–582

– – – –

atp5α1

224–406

(F) GACCTCACGGGAAGGGTGAA (R) TCAGTGTGCTGGTGCTGCTG (F) GGTCACCGGAGCTTCAGGAT (R) TCGAGCCGAGAGGTAGAAAAACC (F) TTCTTGGAGCCGACACTGGA (R) CGAACACCACAACACCAACG

18S rRNA DNA polymerase subunit gamma-1 Thymidine kinase 2

Twinkle

ATP synthase, H+-transporting, mitochondrial F1 complex, alpha subunit 1

Subunit alpha of respiratory chain complex V

(F) TGACAGGATGCAGAAGGAGA (R) GCCTCCGATCCAGACAGAGT (F) AGCGTGCGGGAAACCACGAG (R) AAGCCGCAGGCTCCACTCCT (F) GGTGACCAGTGAAGACCGATA (R) GTCCACTGCGCTAAAGAAGG

–

(F) CCTGTATGAGGACTGGCTGA

205–1229

(R) TCTGTTCTCCTCAAACTGATGC (F) TGTGGGCTGACAAGTTTGAGG (R) TGTCCACAGACAGATTTTCTTG (F) ACCCGCTGCCGCCTTATTTT (R) TCCAGCGAGCTCTGCTTCTTC (F) GCGAAAGATTGCCCAGCAGT (R) TTGTCGTTTTTCCTCCGCAAA (F) AGCCTACGCCGTACCAGTATT (R) GTTTCACGCCATCAGCTACTG (F) TGTAGGCTGGCAGAGGGACA (R) GACAGGCCGAAACAGGATGG

– 1491–2636

1634–1807 2018–2969

160–1122 – 111–535

–

224–796

– – – – (F) TCCAGGTCCTCCGTTGGAAG (R) CCGTGCATTCCTGCAAAGTG (F) GCAAGACCAGTGACATTGAGGTG (R) CCTTCAAGTGGCAACAGAAAAA (F) TGTGGGCTGACAAGTTTGAGG (R) TGTCCACAGACAGATTTTCTTG (F) CAATGCTCTGTCCCCCAGTC (R) ACCTGCTTAGCCACACCACT (F) ACGATGGCTCCATTCAGCTT (R) GAAGGCATCTTCACAGTTTTCAA – – (F) TGTAGGCTGGCAGAGGGACA (R) GACAGGCCGAAACAGGATGG

(F) TTCTTGGAGCCGACACTGGA (R) CGATGGCCACGTAGATGCAG

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

4.4. Absolute quantification of mtDNA copy number in zebrafish embryos, larvae and adults Mitochondrial DNA copy number was determined by the RT-PCR standard curve method using mt-nd1 as the mitochondrial gene target (AC024175) and the polg1 gene as a reference for nuclear DNA (nDNA) content (XR_029715). Quantitative PCR (Q PCR) assays were performed using iQ Sybr Green on the BioRad ICycler (BioRad, Hercules, CA, USA). Standard curves were generated using serial dilutions of gel-extracted PCR products of the mitochondrial mt-nd1 and nuclear polg1 genes. These curves made it possible to determine the starting copy number of mtDNA in each sample. The number of mtDNA copies per cell was determined as follows: mtDNA copies=cell ¼ no:of copies of mtDNA=ðno:of alleles of nDNA=2Þ: Samples were analyzed in triplicate for both assays, enabling calculation of the average mtDNA-to-nDNA ratio. In all real-time experiments, melting curve analysis showed no primer dimer formation. 4.5. RNA extraction from zebrafish embryos, larvae and adults and cDNA synthesis Total RNA samples were extracted from a pool of 20–30 embryos or larvae at different stages of development and from total homogenate of an adult fish (male, 12 months old) using the TRIZOL reagent (Roche) according to standard procedures. One microgram of RNA was reversely transcribed using the Quantitect Reverse Transcription Kit (QIAGEN, UK). Contaminating DNA was eliminated from total RNA by DNase RNase-free treatment at 42 °C for 2 min. Reactions were incubated at 42 °C for 30 min followed by incubation at 95 °C for 3 min to inactivate the Quantitect reverse transcriptase. The quantification of mtDNA transcripts required a more extended DNase RNasefree treatment, at 42 °C for 10 min, to eliminate contaminating mtDNA in RNA samples. 4.6. Relative quantification of zebrafish mRNA amounts by RT-PCR Steady-state amounts of mRNA were estimated during development versus the adult state, using 18S rRNA on the Light Cycler 480 (Roche) as reference. PCR conditions for the different amplicons were optimized to achieve similar amplification efficiencies. The product specificity was monitored by melting curve analysis, and product size was visualized on agarose gel by electrophoresis (data not shown). The reaction mix (total volume V = 10 μl) consisted of 1× SYBR Green Master mix, 300 nM of each forward and reverse primer, and 25 ng of template cDNA. The cycling conditions included a 10-min pre-incubation phase at 95 °C followed by 40 cycles of 10 s at 95 °C, 10 s at 55 °C, and 4 s at 72 °C. Each sample was assayed in triplicate, fluorescence was continuously monitored versus cycle numbers and crossing point values were calculated by the LightCycler® 480 Software, Release 1.5.0 (Roche). In all real-time experiments, melting curve analysis showed that there was no formation of primer dimers. Samples were analyzed in triplicate for each assay. Differential expression in all embryo stages with respect to the adult sample was estimated using the 2 − ΔΔCt method. 4.7. Statistical analysis Statistical analysis was carried out using one-way analysis of variance (ANOVA) followed by Bonferroni post hoc test. GraphPad Prism version 5.0 was used for statistical analysis. P value less than 0.05 was considered to be statistically significant.

1009

4.8. Cloning of riboprobe templates Regions containing portions of about 1 kb from the open reading frames coding for active sites from the previously identified polg1, tk2, twinkle, polrmt, tfam and for ndufs4, sdha, uqcrc2, atp5α1 and mt-nd1 genes, were PCR amplified from adult cDNAs, purified from agarose gel, sequenced and cloned into the pGEM-T easy vector system (Promega, USA) for riboprobe synthesis. Details on the regions cloned and used as probes are given in Table 3. Antisense riboprobes were synthesized from linearized plasmid templates and transcribed with SP6 or T7 RNA polymerase. 4.9. Whole-mount in situ hybridization Whole-mount in situ hybridization was performed essentially as described in [74]. Briefly, dechorionated embryos were fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (PBS), then transferred to 100% methanol for storage at −20 °C for at least 24 h before hybridization. Gene expression pattern on the whole embryos was determined using in vitro synthesized antisense RNA probe tagged with dioxygenin-UTP. After hybridization, the presence of the probe was visualized immunohistochemically using an antiDIG antibody conjugated to alkaline phosphatase and a chromogenic substrate. Control hybridizations were conducted with a sense probe. After the hybridization procedure, embryos were washed thoroughly in 0.1% Tween 20 in PBS and re-fixed in 4% paraformaldehyde in PBS. Microscopic observations were made using a Nikon AZ100 Multizoom Microscope equipped with DIC optics, after mounting embryos and larvae in 85% glycerol/PBS. In some cases, embryos and larvae were treated with a 2:1 mixture of benzylbenzoate:benzylalcohol, a medium with a refractive index similar to that of yolk. Supplementary materials related to this article can be found online at doi:10.1016/j.bbabio.2012.03.019. Competing interests The authors have declared that no competing interests exist. Acknowledgements The authors thank Dr. Maria Marchese for her technical contribution and Dr. Catherine Wrenn for expert editorial assistance. LA and VP were supported by funds from the University of Bari (Fondi ex-60%, 2009–2011). AR and TV were supported by the grants from the University of Salento (Fondi ex-60%, 2009–2011) and from the Apulian Region (cod. Cip PS 070). FA and AD were supported by the EU grant ZF-HEALTH CT-2010-242048. FMS was supported by the Italian Ministry of Health. References [1] S. Anderson, A.T. Bankier, B.G. Barrell, M.H. de Bruijn, A.R. Coulson, J. Drouin, I.C. Eperon, D.P. Nierlich, B.A. Roe, F. Sanger, P.H. Schreier, A.J. Smith, R. Staden, I.G. Young, Sequence and organization of the human mitochondrial genome, Nature 290 (1981) 457–465. [2] T.A. Brown, R.B. Waring, C. Scazzocchio, R.W. Davies, The Aspergillus nidulans mitochondrial genome, Curr. Genet. 9 (1985) 113–117. [3] J.L. Boore, Animal mitochondrial genomes, Nucleic Acids Res. 27 (1999) 1767–1780. [4] R.E. Broughton, J.E. Milam, B.A. Roe, The complete sequence of the zebrafish (Danio rerio) mitochondrial genome and evolutionary patterns in vertebrate mitochondrial DNA, Genome Res. 11 (2001) 1958–1967. [5] X.J. Chen, R.A. Butow, The organization and inheritance of the mitochondrial genome, Nat. Rev. Genet. 6 (2005) 815–825. [6] M. Kucej, R.A. Butow, Evolutionary tinkering with mitochondrial nucleoids, Trends Cell Biol. 17 (2007) 586–592. [7] C. Kukat, C.A. Wurm, H. Spåhr, M. Falkenberg, N.G. Larsson, S. Jakobs, Super-resolution microscopy reveals that mammalian mitochondrial nucleoids have a uniform size and frequently contain a single copy of mtDNA, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 13534–13539.

1010

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

[8] M.A. Parisi, B. Xu, D.A. Clayton, A human mitochondrial transcriptional activator can functionally replace a yeast mitochondrial HMG-box protein both in vivo and in vitro, Mol. Cell. Biol. 13 (1993) 1951–1961. [9] M.A. Parisi, D.A. Clayton, Similarity of human mitochondrial transcription factor 1 to high mobility group proteins, Science 252 (1991) 965–969. [10] T.I. Alam, T. Kanki, T. Muta, K. Ukaji, Y. Abe, H. Nakayama, K. Takio, N. Hamasaki, D. Kang, Human mitochondrial DNA is packaged with TFAM, Nucleic Acids Res. 31 (2003) 1640–1645. [11] B.A. Kaufman, N. Durisic, J.M. Mativetsky, S. Costantino, M.A. Hancock, P. Grutter, E.A. Shoubridge, The mitochondrial transcription factor TFAM coordinates the assembly of multiple DNA molecules into nucleoid-like structures, Mol. Biol. Cell 18 (2007) 3225–3236. [12] M.I. Ekstrand, M. Falkenberg, A. Rantanen, C.B. Park, M. Gaspari, K. Hultenby, P. Rustin, C.M. Gustafsson, N.G. Larsson, Mitochondrial transcription factor A regulates mtDNA copy number in mammals, Hum. Mol. Genet. 13 (2004) 935–944. [13] R.P. Fisher, T. Lisowsky, M.A. Parisi, D.A. Clayton, DNA wrapping and bending by a mitochondrial high mobility group-like transcriptional activator protein, J. Biol. Chem. 267 (1992) 3358–3367. [14] C. Takamatsu, S. Umeda, T. Ohsato, T. Ohno, Y. Abe, A. Fukuoh, H. Shinagawa, N. Hamasaki, D. Kang, Regulation of mitochondrial D-loops by transcription factor A and single-stranded DNA-binding protein, EMBO Rep. 3 (2002) 451–456. [15] M.E. Bianchi, A. Agresti, HMG proteins: dynamic players in gene regulation and differentiation, Curr. Opin. Genet. Dev. 15 (2005) 496–506. [16] N. Hance, M.I. Ekstrand, A. Trifunovic, Mitochondrial DNA polymerase gamma is essential for mammalian embryogenesis, Hum. Mol. Genet. 14 (2005) 1775–1783. [17] J.L. Pohjoismäki, S. Wanrooij, A.K. Hyvärinen, S., I.J. Holt, J.N. Spelbrink, H.T. Jacobs, Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells, Nucleic Acids Res. 34 (2006) 5815–5828. [18] J.N. Spelbrink, J.M. Toivonen, G.A. Hakkaart, J.M. Kurkela, H.M. Cooper, S.K. Lehtinen, N. Lecrenier, J.W. Back, D. Speijer, F. Foury, H.T. Jacobs, In vivo functional analysis of the human mitochondrial DNA polymerase POLG expressed in cultured human cells, J. Biol. Chem. 275 (2000) 24818–24828. [19] M.A. Graziewicz, M.J. Longley, W.C. Copeland, DNA polymerase gamma in mitochondrial DNA replication and repair, Chem. Rev. 106 (2006) 383–405. [20] J.A. Carrodeguas, R. Kobayashi, S.E. Lim, W.C. Copeland, D.F. Bogenhagen, The accessory subunit of Xenopus laevis mitochondrial DNA polymerase gamma increases processivity of the catalytic subunit of human DNA polymerase gamma and is related to class II aminoacyl-tRNA synthetases, Mol. Cell. Biol. 19 (1999) 4039–4046. [21] J.A. Carrodeguas, K. Theis, D.F. Bogenhagen, C. Kisker, Crystal structure and deletion analysis show that the accessory subunit of mammalian DNA polymerase gamma, Pol gamma B, functions as a homodimer, Mol. Cell 7 (2001) 43–54. [22] B. Iyengar, J. Roote, A.R. Campos, The tamas gene, identified as a mutation that disrupts larval behavior in Drosophila melanogaster, codes for the mitochondrial DNA polymerase catalytic subunit (DNApol-gamma125), Genetics 153 (1999) 1809–1824. [23] I. Bratic, J. Hench, J. Henriksson, A. Antebi, T.R. Bürglin, A. Trifunovic, Mitochondrial DNA level, but not active replicase, is essential for Caenorhabditis elegans development, Nucleic Acids Res. 37 (2009) 1817–1828. [24] A. Genga, L. Bianchi, F. Foury, A nuclear mutant of Saccharomyces cerevisiae deficient in mitochondrial DNA replication and polymerase activity, J. Biol. Chem. 261 (1986) 9328–9332. [25] J.N. Spelbrink, F.Y. Li, V. Tiranti, K. Nikali, Q.P. Yuan, Tarig, S. Wanrooij, N. Garrido, G. Comi, L. Morandi, L. Santoro, A. Toscano, G.M. Fabrizi, H. Somer, R. Croxen, D. Beeson, J. Poulton, A. Suomalainen, H.T. Jacobs, M. Zeviani, C. Larsson, Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria, Nat. Genet. 28 (2001) 223–231. [26] J.A. Bernstein, C.C. Richardson, Characterization of the helicase and primase activities of the 63-kDa component of the bacteriophage T7 gene 4 protein, J. Biol. Chem. 264 (1989) 13066–13073. [27] J.A. Korhonen, M. Gaspari, M. Falkenberg, TWINKLE has 5′→3′ DNA helicase activity and is specifically stimulated by mitochondrial single-stranded DNA-binding protein, J. Biol. Chem. 278 (2003) 48627–48632. [28] N. Garrido, L. Griparic, E. Jokitalo, J. Wartiovaara, A.M. van der Bliek, J.N. Spelbrink, Composition and dynamics of human mitochondrial nucleoids, Mol. Biol. Cell 14 (2003) 1583–1596. [29] Y. Matsushima, K. Matsumura, S. Ishii, H. Inagaki, T. Suzuki, Y. Matsuda, K. Beck, Y. Kitagawa, Functional domains of chicken mitochondrial transcription factor A for the maintenance of mitochondrial DNA copy number in lymphoma cell line DT40, J. Biol. Chem. 278 (2003) 31149–31158. [30] G.S. Shadel, D.A. Clayton, Mitochondrial DNA maintenance in vertebrates, Annu. Rev. Biochem. 66 (1997) 409–435. [31] D.A. Clayton, Transcription and replication of mitochondrial DNA, Hum. Reprod. 15 (Suppl. 2) (2000) 11–17. [32] D.A. Clayton, Replication and transcription of vertebrate mitochondrial DNA, Annu. Rev. Cell Biol. 7 (1991) 453–478. [33] D. Ojala, J. Montoya, G. Attardi, tRNA punctuation model of RNA processing in human mitochondria, Nature 290 (1981) 470–474. [34] J. Montoya, D. Ojala, G. Attardi, Distinctive features of the 5′-terminal sequences of the human mitochondrial mRNAs, Nature 290 (1981) 465–470. [35] M. Sologub, D. Litonin, M. Anikin, A. Mustaev, D. Temiakov, TFB2 is a transient component of the catalytic site of the human mitochondrial RNA polymerase, Cell 139 (2009) 934–944.

[36] D. Litonin, M. Sologub, Y. Shi, M. Savkina, M. Anikin, M. Falkenberg, C.M. Gustafsson, D. Temiakov, Human mitochondrial transcription revisited: only TFAM and TFB2M are required for transcription of the mitochondrial genes in vitro, J. Biol. Chem. 285 (2010) 18129–18133. [37] M. Falkenberg, M. Gaspari, A. Rantanen, A. Trifunovic, N.G. Larsson, C.M. Gustafsson, Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA, Nat. Genet. 31 (2002) 289–294. [38] M. Johansson, A. Karlsson, Cloning of the cDNA and chromosome localization of the gene for human thymidine kinase 2, J. Biol. Chem. 272 (1997) 8454–8458. [39] C. Rampazzo, S. Fabris, E. Franzolin, K. Crovatto, M. Frangini, V. Bianchi, Mitochondrial thymidine kinase and the enzymatic network regulating thymidine triphosphate pools in cultured human cells, J. Biol. Chem. 282 (2007) 34758–34769. [40] A.R. Van Rompay, M. Johansson, A. Karlsson, Substrate specificity and phosphorylation of antiviral and anticancer nucleoside analogues by human deoxyribonucleoside kinases and ribonucleoside kinases, Pharmacol. Ther. 100 (2003) 119–139. [41] L.C. Smith, J. Thundathil, F. Filion, Role of the mitochondrial genome in preimplantation development and assisted reproductive technologies, Reprod. Fertil. Dev. 17 (2005) 15–22. [42] S.H. El Shourbagy, E.C. Spikings, M. Freitas, J.C. St John, Mitochondria directly influence fertilisation outcome in the pig, Reproduction 131 (2006) 233–245. [43] Y. Kameyama, F. Filion, J.G. Yoo, L.C. Smith, Characterization of mitochondrial replication and transcription control during rat early development in vivo and in vitro, Reproduction 133 (2007) 423–432. [44] I.B. Dawid, S.R. Haynes, M. Jamrich, E. Jonas, S. Miyatani, T.D. Sargent, J.A. Winkles, Gene expression in Xenopus embryogenesis, J. Embryol. Exp. Morphol. (89 Suppl.) (1985) 113–124. [45] A. El Meziane, J.-C. Callen, J.-C. Mounolou, Mitochondrial gene expression during Xenopus laevis development: a molecular study, EMBO J. 8 (6) (1989) 1649–1655. [46] P.W. Ingham, The power of the zebrafish for disease analysis, Hum. Mol. Genet. 18 (2009) R107–R112. [47] J. Postlethwait, V. Ruotti, M.J. Carvan, P.J. Tonellato, Automated analysis of conserved syntenies for the zebrafish genome, Methods Cell Biol. 77 (2004) 255–271. [48] K.D. Taylor, L. Pikó, Mitochondrial biogenesis in early mouse embryos: expression of the mRNAs for subunits IV, Vb, and VIIc of cytochrome c oxidase and subunit 9 (P1) of H(+)-ATP synthase, Mol. Reprod. Dev. 40 (1995) 29–35. [49] L. Pikó, K.D. Taylor, Amounts of mitochondrial DNA and abundance of some mitochondrial gene transcripts in early mouse embryos, Dev. Biol. 123 (1987) 364–374. [50] J. Thundathil, F. Filion, L.C. Smith, Molecular control of mitochondrial function in preimplantation mouse embryos, Mol. Reprod. Dev. 71 (2005) 405–413. [51] N. Steuerwald, J.A. Barritt, R. Adler, H. Malter, T. Schimmel, J. Cohen, C.A. Brenner, Quantification of mtDNA in single oocytes, polar bodies and subcellular components by real-time rapid cycle fluorescence monitored PCR, Zygote 8 (2000) 209–215. [52] P. Reynier, P. May-Panloup, M.F. Chrétien, C.J. Morgan, M. Jean, F. Savagner, P. Barrière, Y. Malthièry, Mitochondrial DNA content affects the fertilizability of human oocytes, Mol. Hum. Reprod. 7 (2001) 425–429. [53] P. May-Panloup, M.F. Chrétien, C. Jacques, C. Vasseur, Y. Malthièry, P. Reynier, Low oocyte mitochondrial DNA content in ovarian insufficiency, Hum. Reprod. 20 (2005) 593–597. [54] T. Zampolla, E. Spikings, T. Zhang, D.M. Rawson, Effect of methanol and Me2SO exposure on mitochondrial activity and distribution in stage III ovarian follicles of zebrafish (Danio rerio), Cryobiology 59 (2009) 188–194. [55] T. Zampolla, E. Spikings, D. Rawson, T. Zhang, Cytoskeleton proteins F-actin and tubulin distribution and interaction with mitochondria in the granulosa cells surrounding stage III zebrafish (Danio rerio) oocytes, Theriogenology 76 (2011) 1110–1119. [56] J.N. Wolff, N.J. Gemmell, Lost in the zygote: the dilution of paternal mtDNA upon fertilization, Heredity 101 (2008) 429–434. [57] M.A. Fernández-Moreno, C.L. Farr, L.S. Kaguni, R. Garesse, Drosophila melanogaster as a model system to study mitochondrial biology, Methods Mol. Biol. 372 (2007) 33–49. [58] N. Tiso, E. Moro, F. Argenton, Zebrafish pancreas development, Mol. Cell. Endocrinol. 312 (2009) 24–30. [59] N.S. Yee, K. Lorent, M. Pack, Exocrine pancreas development in zebrafish, Dev. Biol. 284 (2005) 84–101. [60] F. Biemar, F. Argenton, R. Schmidtke, S. Epperlein, B. Peers, W. Driever, Pancreas development in zebrafish: early dispersed appearance of endocrine hormone expressing cells and their convergence to form the definitive islet, Dev. Biol. 230 (2001) 189–203. [61] S.P. Mudumana, H. Wan, M. Singh, V. Korzh, Z. Gong, Expression analyses of zebrafish transferrin, ifabp, and elastaseB mRNAs as differentiation markers for the three major endodermal organs: liver, intestine, and exocrine pancreas, Dev. Dyn. 230 (2004) 165–173. [62] H. Bauduin, M. Colin, J.E. Dumont, Energy sources for protein synthesis and enzymatic secretion in rat pancreas in vitro, Biochim. Biophys. Acta 174 (1969) 722–733. [63] G. Ferrari, E. Lamantea, A. Donati, M. Filosto, E. Briem, F. Carrara, R. Parini, A. Simonati, R. Santer, M. Zeviani, Infantile hepatocerebral syndromes associated with mutations in the mitochondrial DNA polymerase-gammaA, Brain 128 (2005) 723–731. [64] A. Jeyakumar, M.E. Williamson, T.M. Brickman, P. Krakovitz, S. Parikh, Otolaryngologic manifestations of mitochondrial cytopathies, Am. J. Otolaryngol. 30 (2009) 162–165. [65] H.A. Pearson, J.S. Lobel, S.A. Kocoshis, J.L. Naiman, J. Windmiller, A.T. Lammi, R. Hoffman, J.C. Marsh, A new syndrome of refractory sideroblastic anemia with

L. Artuso et al. / Biochimica et Biophysica Acta 1817 (2012) 1002–1011

[66]

[67] [68] [69]

vacuolization of marrow precursors and exocrine pancreatic dysfunction, J. Pediatr. 95 (1979) 976–984. F. Favareto, D. Caprino, C. Micalizzi, C. Rosanda, E. Boeri, P.G. Mori, New clinical aspects of Pearson's syndrome. Report of three cases, Haematologica 74 (1989) 591–594. M. Falkenberg, N.G. Larsson, C.M. Gustafsson, DNA replication and transcription in mammalian mitochondria, Annu. Rev. Biochem. 76 (2007) 679–699. D.A. Kane, C.B. Kimmel, The zebrafish midblastula transition, Development 119 (1993) 447–456. F. Bruni, P.L. Polosa, M.N. Gadaleta, P. Cantatore, M. Roberti, Nuclear respiratory factor 2 (NRF2) induces the expression of many but not all human proteins acting in mitochondrial DNA transcription and replication, J. Biol. Chem. 285 (2010) 3939–3948.

View publication stats

1011

[70] A. Force, M. Lynch, F.B. Pickett, A. Amores, Y.L. Yan, J. Postlethwait, Preservation of duplicate genes by complementary, degenerative mutations, Genetics 151 (1999) 1531–1545. [71] M. Westerfield, The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), University of Oregon Press, Eugene, OR, 1995. [72] C.B. Kimmel, W.W. Ballard, S.R. Kimmel, B. Ullmann, T.F. Schilling, Stages of embryonic development of the zebrafish, Dev. Dyn. 203 (1995) 253–310. [73] L. Zhou, A. Chomyn, G. Attardi, C.A. Miller, Myoclonic epilepsy and ragged red fibers (MERRF) syndrome: selective vulnerability of CNS neurons does not correlate with the level of mitochondrial tRNAlys mutation in individual neuronal isolates, J. Neurosci. 17 (1997) 7746–7753. [74] C. Thisse, B. Thisse, High-resolution in situ hybridization to whole-mount zebrafish embryos, Nat. Protoc. 3 (2008) 59–69.