Molecular Phylogenetics and Evolution 55 (2010) 123–135
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev
Molecular systematics of the bubblegum coral genera (Paragorgiidae, Octocorallia) and description of a new deep-sea species Santiago Herrera a,b,1, Amy Baco c, Juan A. Sánchez a,* a
Departamento de Ciencias Biológicas-Facultad de Ciencias, Laboratorio de Biología Molecular Marina (BIOMMAR), Universidad de los Andes, Carrera 1E No 18A – 10, (J 409, J309 Lab), Bogotá, Colombia b Department of Invertebrate Zoology, National Museum of Natural History, MRC-163, Smithsonian Institution, P.O. Box 37012, Washington, DC 20013-7012, USA c Department of Oceanography, Florida State University, 117 N. Woodward Avenue, Tallahassee, FL 32306-4320, USA
a r t i c l e
i n f o
Article history: Received 25 June 2009 Revised 30 November 2009 Accepted 4 December 2009 Available online 16 December 2009 Keywords: Bubblegum octocoral Paragorgia Sibogagorgia Deep-sea coral Seamount Phylogeny
a b s t r a c t Bubblegum octocorals (Paragorgia and Sibogagorgia) play an important ecological role in many deep-sea ecosystems. However, these organisms are currently threatened by destructive fishing methods such as bottom trawling. Taxonomic knowledge of conservation targets is necessary for the creation and implementation of efficient conservation strategies. However, for most deep-sea coral groups this knowledge remains incomplete. For instance, despite its similarities with Paragorgia, Sibogagorgia is particular in lacking polyp sclerites, which are present in groups like Paragorgia and the Coralliidae. Although two kinds of sclerites are very similar between Paragorgia and Sibogagorgia, other characters challenge the monophyly of these genera. Here we help to clarify the taxonomy and evolutionary relationships of the bubblegum octocorals and related taxa by examining molecular data. We employed nucleotide sequences of mitochondrial (ND6, ND6-ND3 intergenic spacer, ND3, ND2, COI, msh1 and 16S) and nuclear (28S and ITS2) genomic regions from several taxa to infer molecular phylogenetics and to examine the correspondence of morphological features with the underlying genetic information. Our data strongly supported the monophyly of the genus Paragorgia, the family Coralliidae (precious corals), and a group of undescribed specimens resembling Sibogagorgia. Further morphological observations were congruent regarding the uniqueness of the undescribed specimens, here defined as a new species, Sibogagorgia cauliflora sp. nov., which occurs in both sides of the North American landmass at depths below 1700 m. This new species resembles S. dennisgordoni with branching in one plane but has fairly different radiate sclerites and significantly divergent DNA sequences. The existence of several diagnostic characters of Sibogagorgia in S. cauliflora indicates that they indeed belong to this genus. It is however remarkable that a small number of medullar canals are also found in this species; medullar canals have been considered as the main diagnostic character of Paragorgia. Thus, the evidence generated here indicates that the presence or absence of these canals per se is not a conclusively diagnostic character for either genus. The lack of internal-node resolution in the inferred phylogenetic hypotheses of these genera does not allow us to propose a clear scenario regarding the evolution of these traits. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction The bubblegum octocorals (Paragorgiidae, Octocorallia) are among the most abundant and widely distributed sessile benthic invertebrates in deep-water ecosystems, including seamounts, lithoherms, canyons and continental shelves (DeVogelaere et al., 2005; Leverette and Metaxas, 2005; Messing et al., 1990; Mortensen and Buhl-Mortensen, 2005). Paragorgiids play an important
* Corresponding author. E-mail address:
[email protected] (J.A. Sánchez). 1 Present address: Massachusetts Institute of Technology and Woods Hole Oceanographic Institution Joint Program, 2–40 Redfield Laboratory MS#33, Woods Hole, MA 02543, USA.
[email protected] 1055-7903/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2009.12.007
ecological role in many deep-sea ecosystems, equivalent to the role of large trees in a rain forest, by generating three-dimensional habitats for a great number of micro and macro organisms (Auster et al., 2005; Buhl-Mortensen and Mortensen, 2004, 2005; DeVogelaere et al., 2005; Metaxas and Davis, 2005; Nedashkovskaya et al., 2005). In a study that examined the diversity and abundance of invertebrates associated with bubblegum octocorals, 1264 animals, representing 47 recognized species, were found in just 13 colonies (Buhl-Mortensen and Mortensen, 2005). This observation indicates that the fauna associated with bubblegum octocorals is considerably richer than the fauna associated with shallow-water tropical gorgonians. Unfortunately, bubblegum octocorals and deep-sea fauna in general are rapidly becoming threatened by human activities. Due to the depletion of mid-water fisheries around
124
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
the world, alternative destructive fishing techniques (e.g. bottom trawling) are being implemented in deeper waters (Crowder et al., 2008). These practices not only have a direct negative impact on commercial fish populations, but also on all the slow-growing benthic fauna (e.g. habitat-building octocorals) and therefore on the ecosystems as a whole (Koslow et al., 2001; Roberts, 2002; Waller et al., 2007; Watling and Norse, 1998). Biodiversity conservation efforts in the deep-sea (e.g., Marine Protected Areas) are crucial to ensuring that the exploitation of food resources becomes a sustainable practice (Danovaro et al., 2008; Davies et al., 2007; Morgan et al., 2005). Knowledge of conservation targets is necessary for the creation and implementation of efficient conservation strategies. Such knowledge must include well-founded taxonomic inventories that allow us to identify the number of species and their distribution patterns (Dubois, 2003). Although bubblegum octocorals have been studied since the 18th century, their phylogenetic relationships and taxonomic status remain controversial. Unlike many octocorals, bubblegum corals lack a calcified or corneous skeleton, and thus have been included within the apparently polyphyletic group scleraxonia, i.e., branching alcyonaceans with a soft skeleton composed of densely packed unfused sclerites (Bayer et al., 1983; McFadden et al., 2006; Sánchez et al., 2003). The presence or absence of the boundary canals network, a system of reticulated canals separating the cortex of the branches from the medulla (Bayer et al., 1983), has been utilized as one of the main criteria to split the bubblegum octocorals in two genera, Paragorgia Milne Edwards and Haime, 1857 and Sibogagorgia Stiasny, 1937 (Sánchez, 2005; Verseveldt, 1940, 1942). Unlike Sibogagorgia, Paragorgia does not have boundary canals, but rather a few larger canals perforating the sclerital medulla. Other characters, such as the surface and medulla sclerites in Sibogagorgia, are very similar to those seen in Paragorgia. Both genera have a thin outer surface layer composed of radiate sclerites, whose radial ornaments can be remarkably similar in both genera (Sánchez, 2005). Likewise, the medulla in both groups contains spindle sclerites with various degrees of ornamentation, reaching an extreme in the nearly bare Sibogagorgia spindles (Sánchez, 2005). These two kinds of sclerites are homologous to those of other polymorphic octocorals (i.e., two kinds of polyps: autozooids and siphonozooids) such as Corallium and Anthomastus, which according to molecular phylogenetics studies are closely related to Paragorgia (Berntson et al., 2001; France et al., 1996; McFadden et al., 2006; Sánchez et al., 2003; Strychar et al., 2005). Despite its similarities with Paragorgia, Sibogagorgia is particular in lacking polyp sclerites, which are present in groups like Paragorgia and Corallium as homologous ornate stubby rods. Thus, although two kinds of sclerites are very similar between Paragorgia and Sibogagorgia, the internal canals and polyp sclerites are indicative of their evolutionary divergence. A number of taxonomic studies examining these morphological features have placed these genera in either a unique family, Paragorgiidae (Bayer, 1956; Sánchez, 2005), or in two separate families, Paragorgiidae and Sibogagorgiidae (Verseveldt, 1942). This discrepancy is attributable to the low number of identifiable anatomical apomorphic characters. Consequently, the aim of this study is to help clarify the taxonomy and evolutionary relationships of the bubblegum octocorals and related taxa by examining molecular data. We employ nucleotide sequences of mitochondrial and nuclear genomic regions from several taxa to: (1) infer historical patterns of cladogenesis, and (2) examine the correspondence of morphological features with the underlying genetic information. Another major goal of this study is to (3) define a new species of bubblegum octocoral from a set of undescribed specimens. These specimens share particular characteristics not found in any of the currently described bubblegum octocoral species.
2. Materials and methods Octocoral specimens (dry and ethanol-preserved) were obtained from the collections of the National Museum of Natural History of the Smithsonian Institution (Washington DC, USA) and the National Institute of Water and Atmospheric Research (Wellington, New Zealand). Molecular analyses were performed on 17 coral specimens that were previously identified by expert taxonomists (Bayer, unpublished data; Sánchez, 2005). These included 10 ingroup (Paragorgia and Sibogagorgia) and seven outgroup individuals, the latter representing two different families (Coralliidae and Plexauridae), which reflect different degrees of relatedness to the ingroup (Table 1) (Bayer, 1992; France and Hoover, 2002; France et al., 1996; McFadden et al., 2006; Sánchez et al., 2003). Only one specimen of a described species of Sibogagorgia, S. dennisgordoni, had been preserved suitably for genetic analyses, but morphological comparisons with the other described species were available from a previous study by Sánchez (2005). New nucleotide sequences of seven mitochondrial and two nuclear regions were generated for each individual. Mitochondrial genomic regions include: the 30 end of the NADH dehydrogenase-6 (ND6) gene, the ND6–ND3 intergenic spacer, the 50 end of the NADH dehydrogenase-3 (ND3) gene, the 30 end of the cytochrome oxidase-I (COI) gene, the 50 end of the DNA mismatch repair protein- mutS – homolog (msh1) gene, two different regions of the ribosomal large sub-unit (16S), and the 50 end of the NADH dehydrogenase-2 (ND2) gene. Nuclear genomic regions are the complete internal transcribed spacer-2 (ITS2) and a short region of the 50 end of the ribosomal large sub-unit (28S). Additional contributed outgroup sequences from Anthomastus, Eleutherobia (16S, msh1, ND2: C. McFadden, unpub. data; McFadden et al., 2006) and Corallium (ITS2: N. Ardila, unpub. data) were included in the analyses. The latter were needed because we were not able to obtain sequences from the same coralliid individuals from which we obtained the mitochondrial data. Among the 10 ingroup specimens included in the molecular analyses, there were four individuals (Table 1) that did not have prior species-level identification. These specimens were intentionally incorporated in the analyses because our preliminary morphological and molecular observations were not congruent with the features found in any of the currently described species. Additional detailed sclerite observations of these specimens were conducted using Scanning Electron Microscopy (SEM), following the preparations and procedures described by Sánchez and Cairns (2004) and Sánchez (2005).
2.1. Molecular laboratory methods Total genomic DNA was extracted from tissue samples (1–2 polyps) using a phenol/chloroform extraction (Mouse Tail Protocol) performed in an automated DNA isolation system (AutoGenprep 965, AutoGen Inc.). The standard protocol was modified by adding an extra DNA washing step, increasing the centrifugation time in the debris-removal step to 15 min., and diluting the purified DNA to final volume of 0.1 ml. Polymerase chain reactions were conducted employing five mitochondrial and two nuclear pairs of conventional octocoral primers (Table 2). The only exception was the MSH1 forward primer, which needed to be designed de novo to obtain successful amplifications in Paragorgia, Sibogagorgia, Corallium, and Paracorallium. Such abnormality is likely to be caused by a special case of mitochondrial gene rearrangement in these taxa (Brugler and France, 2008). The PCR reaction mixes were prepared to a final volume of 10 l (1 ll of template) resulting in the following concentrations of reagents and enzymes: 1 NH4 Buffer, 2.5 BSA, 0.5 mM dNTPs (0.125 mM each), 2.0 mM MgCl2, 0.5 u
Table 1 Sequences and specimen information of the outgroup and ingroup specimens used in this study. Acronyms as follows: National Museum of Natural History of the Smithsonian Institution, USA (USNM); The National Institute of Water and Atmospheric Research, New Zealand (NIWA); Museum and Art Gallery of the Northern Territory, Australia (NTM; Collection of C.S. McFadden (CSM). Taxonomic classification following McFadden et al. (2006) and Sanchez (2005). Sequences not generated in this study are marked with an asterisk (*). Type specimens are indicated with a cross ( ). Specimens marked with (§) are the four undescribed specimens here described as a new species; their names in the table correspond to their former identifications in the USNM collection. Taxa
Collection
Locality
GenBank Accession Numbers 16S
ND2–16S
COI
MSH1
ND6-intND3
ITS2
28S
Family Plexauridae Alaskagorgia sp. Muricea purpurea Family Alcyoniidae Anthomasttus ritteri Eleutherobia aureum Eleutherobia sp.
USNM 1115602 USNM 1016584
(51.52, 177.95): Off Aleutian Islands: Bering Sea: USA, 485 m Off Taboguilla Island: Panama Bay: Panama, 6 m, 1976
GQ293240 GQ293318 GQ293270 GQ293299 GQ293337 GQ293246 GQ293323 GQ293275 GQ293304 GQ293342
N/A N/A
N/A N/A
CSM-ANRI
GQ377455 DQ302893 N/A GQ377454 N/A N/A N/A DQ302883 N/A
N/A N/A N/A
N/A GQ377456 N/A
NTM C014902
(36.58, 122.1): Off Pebble Beach: Californa: USA, 300 m, 1998 (30.33, 30.19): Park Rynie: Kwazulu-Natal: South Africa, 22–28 m, 2008 West Channel: Palau, 2005
Family Paragorgiidae Paragorgia aotearoa Paragorgia arborea Paragorgia arborea Paragorgia kaupeka Paragorgia regalis Paragorgia wahine Paragorgia yutlinux Paragorgia sp. Paragorgia sp. Sibogagorgia dennisgordoni Sibogagorgia sp. Sibogagorgia sp.
NIWA 3325 NIWA 3310 USNM 80937 NIWA 3320 USNM 1014743 NIWA 3326 USNM 1073480 USNM 54831§ USNM 1081143§ NIWA 3329 USNM 1122229§ USNM 1122230§
(42.83, 176.92): Off east coast: New Zealand, 700 m, 1996 GQ293247 GQ293324 GQ293276 GQ293305 GQ293343 (44.75, 174.82): Off east coast: New Zealand, 687 m, 1999 GQ293252 GQ293330 GQ293281 GQ293311 GQ293349 (40.38, 67.66): Lydonia Canyon: USA, 613–430 m, 1979 GQ293253 GQ293331 GQ293282 GQ293312 GQ293350 (36.16, 176.81): Off east coast: New Zealand, 820 m, 1989 GQ293254 GQ293332 GQ293283 GQ293313 GQ293351 (19.74, 158.3): Cross Seamount: Hawaii: USA, 452 m, 2003 GQ293248 GQ293326 GQ293278 GQ293307 GQ293345 (42.79, 179.99): Off east coast: New Zealand, 900 m, 2001 GQ293255 GQ293333 GQ293284 GQ293314 GQ293352 (50.23, 128.58): Off Vancouver Isl.: British Columbia: Canada, 846–861 m, 2003 GQ293256 GQ293334 GQ293285 GQ293315 GQ293353 (23.55, 82.78): Straits of Florida: Havana: Cuba, 1638–1757 m, 1968 GQ293250 GQ293328 N/A GQ293309 GQ293347 (52.98, 161.25): Derickson Seamount: Alaska: USA, 2766 m, 2004 GQ293249 GQ293327 GQ293279 GQ293308 GQ293346 (36.69, 176.46): Off east coast: New Zealand, 820 m, 1998 GQ293257 GQ293335 GQ293286 GQ293316 GQ293354 (35.83, 122.61): Davidson Seamount: California: USA, 2502 m, 2006 GQ293258 GQ293336 GQ293287 GQ293317 GQ293355 (35.63, 122.83): Davidson Seamount: California: USA, 3042 m, 2006 GQ293251 GQ293329 GQ293280 GQ293310 GQ293348
GQ293295 GQ293294 GQ293293 GQ293292 GQ293298 GQ293296 GQ293297 N/A GQ293289 GQ293291 GQ293290 GQ293288
GQ293261 GQ293264 GQ293260 N/A N/A GQ293263 GQ293262 N/A N/A GQ293259 GQ293266 GQ293267
Family Coralliidae Corallium kishinouyei Corallium laauense Corallium secundum Corallium sp. Corallium sp. CL8 Corallium sp. CL54 Corallium sp. CL59 Paracorallium sp Paracorallium thrinax CL30
USNM 1072441 USNM 1071433 USNM 1010758 USNM 1075800 NIWA 28233 NIWA 15662 NIWA 41840 USNM 1089600 NIWA 28215
(25.7, 171.45):: Off Laysan Island: Hawaii: USA, 1490 m, 2003 (19.8, 156.13):: Off Keahole Point: Hawaii Island: Hawaii: USA, 867 m, 2004 (20.88, 156.73): Off Maui: Hawaii: USA, 240 m, 2001 (56.32, 142.44): Pratt Seamount: Alaska: USA, 1627 m, 2004 (37.03, 177.34): New Zealand, 910–1048 m, 1997 (36.95, 177.34): New Zealand, 1105–1113 m, 2004 New Zealand, 910 m, 2007 (23.71, 168.257) New Caledonia, 470–621 m, 2003 (30.56, 178.51), New Zealand, 165 m, 1974
N/A N/A N/A N/A GQ358527 GQ358526 GQ358528 N/A GQ358529
GQ293268 GQ293265 N/A N/A N/A N/A N/A GQ293269 N/A
GQ293242 GQ293243 GQ293245 GQ293244 N/A N/A N/A GQ293241 N/A
GQ293319 GQ293320 GQ293322 GQ293321 N/A N/A N/A GQ293325 N/A
GQ293271 GQ293272 GQ293274 GQ293273 N/A N/A N/A GQ293277 N/A
DQ302816 N/A N/A N/A DQ302809 N/A
GQ293300 GQ293301 GQ293303 GQ293302 N/A N/A N/A GQ293306 N/A
GQ293338 GQ293339 GQ293341 GQ293340 N/A N/A N/A GQ293344 N/A
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
O. Alcyonacea
125
126
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
Table 2 Primers list and PCR thermal profiles. Region
Primer
Source
Sequence (50 -30 )
PCR profile
16S
Octo1-L Octo2-H COIOCTf COI-BB6 16S544F ND21418R ND61487F ND32126R AnthoCorMSH Mut-3458R 5.8S-436 28S-663 F635sq R1411sq
France et al. (1996) France et al. (1996) France and Hoover (2002) France and Hoover (2002) McFadden et al. (2006) McFadden et al. (2004) McFadden et al. (2004) McFadden et al. (2004) This study Sánchez et al. (2003) Aguilar and Sanchez (2007) Aguilar and Sanchez (2007) Medina et al. (2001) Medina et al. (2001)
AGACCCTATCGAGCTTTACTGG CGATAAGAACTCTCCGACAATA GGTATGGTCTATGCTATGAT GGTCACCCTGAGGTCTAYAT CGACCTCGATGTTGAGTTGCGG ACATCGGGAGCCCACATA TTTGGTTAGTTATTGCCTTT CACATTCATAGACCGACACTT AGGAGAATTATTCTAAGTATGG TSGAGCAAAAGCCACTCC AGCATGTCTGTCTGAGTGTTGG GGGTAATCTTGCCTGATCTGAG CCGTCTTGAAACACGGACC GTTGTTACACACTCCTTAGCGG
(94 °C:30 s; 45 °C:60 s; 72 °C:180 s) 30
COI ND2 ND6 MSH1 ITS2 28S
Taq polymerase (Biolase™, Bioline), and 1 lM–1.33 lM primers. Negative controls were run in every experiment to test for contamination. The reactions were carried out in MJ Research Thermocyclers PTC-225 (GMI, Inc.), with an initial denaturation step of 5 min at 94 °C and a final elongation of 10 min at 72 °C. PCR products were cleaned using the Exonuclease-I/Shrimp Alkaline Phosphatase (ExoSAP-IT™, USB Corp.) method. Cycle sequencing reactions were performed using aABI BigDye Terminator v3.1 kit (Applied Biosystems Inc.), following manufacturer’s protocols. Subsequent purification was done through gel filtration with Sephadex G-50 (Sigma–Aldrich Corp.). Automated sequencing was completed using a 3730xl DNA analyzer (Applied Biosystems Inc.). Complementary chromatograms were assembled and edited using the Sequencher™ 4.8 software (Gene Codes Corp.). 2.2. Alignments and secondary structure inference Each set of sequences was aligned independently using MAFFT (Katoh et al., 2002), employing the G-INS-iand Q-INS-i algorithms (gap opening penalty = 1.53, offset value = 0.07) for the protein coding and ribosomal regions, respectively. To correct possible mistakes, all alignments of protein coding sequences were visually inspected and translated to amino acids in MacClade 4.08 (Maddison and Maddison, 2005), based on the genetic code of Hydra attenuata (Pont-Kindon et al., 2000). No unusual stop codons, misplaced reading frames or suspicious substitutions were identified, indicating that no nuclear pseudogenes were amplified (Bensasson et al., 2001; Lopez et al., 1994). The program 4SALE (Seibel et al., 2006; Seibel et al., 2008), which allows the incorporation of molecular secondary structure information, was used to improve the alignment of the ITS2 rRNA sequences. The secondary structures were inferred in the MFOLD server (http://frontend.bioinfo. rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi) based on structural homology with the typical eukaryotic 4-ring model (Coleman, 2003), and minimization of the folding’s Gibbs free energy (Zuker, 2003). 2.3. Phylogenetic Inferences Each data set of each individual region (excluding the ND3–ND6 intergenic spacer) was analyzed independently to infer its evolutionary history using maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) methods. Branch-andbound semi-exhaustive searches under the MP optimality criterion were conducted in PAUP* 4.0b10 (Swofford, 2002). The number of trees saved during the searches was not restricted. Gaps were treated as missing data. Statistical confidence on nodes was estimated via 1000 non-parametric bootstrap pseudo-replicates (50 replicates for each heuristic search with random addition sequence).
(94 °C:30 s; 55 °C:30 s; 72 °C:60 s) 35 (94 °C:60 s; 56 °C:60 s; 72 °C:90 s) 32 (94 °C:45 s; 49 °C:45 s; 72 °C:45s) 35 (94 °C:45 s; 50 °C:45 s; 72 °C:60 s) 32 (94 °C:30 s; 59 °C:30 s; 72 °C:45 s) 32 (94 °C:30 s; 55 °C:60 s; 72 °C:60 s) 31
Nucleotide substitution models and their correspondent parameter values were selected for every region based on the Akaike Information Criteria (AIC) as implemented in Modeltest 3.7 (Posada, 1998; Posada and Buckley, 2004) (Table 3). Gene trees were estimated under the ML optimality criterion using the program GARLI 0.951 (Zwickl, 2006). The analyses were run applying the selected substitution models, base frequencies, substitution rates and parameters of variation among sites. All other general and genetic algorithm settings were left by default. Non-parametric bootstrap (1000 pseudo-replicates) was performed in RAxML 7.0.4 (Stamatakis et al., 2008) at the CIPRES portal (http://www.phylo.org). Bayesian Inference (BI) of gene phylogenies was carried out in MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003) using the same substitution models. Default prior distribution settings were assumed for all parameters. Three independent analyses of 1 107 Monte Carlo Markov Chain (MCMC) generations (4 chains) were run for every independent region, with a sampling frequency of 100 generations (burnin = 2500). MCMC runs were analyzed in the program Tracer 1.4.1 (Rambaut and Drummond, 2007). Convergence was indicated by the ‘‘straight hairy caterpillar” (Drummond et al., 2007) shape of the stationary posterior-distribution trace (generations vs. LnL) of each parameter. Other examined convergence and mixing diagnostics included the standard deviation of partition frequencies (200), and the similitude of posterior probabilities of specific nodes between different runs in the program AWTY (http:// ceb.csit.fsu.edu/awty) (Nylander et al., 2008). The obtained trees were summarized into majority-rule (50%) consensus tree. Several combined analyses were conducted for different types of concatenated datasets: (1) all mitochondrial (mt) regions, (2) all mt protein-coding regions, and (3) a set of three mt regions (16S, msh1 and ND2) created to examine the effect of the inclusion of different outgroups in the analyses (see Table 3). The later set included only these three regions in order to minimize the possible effects of missing data in the inferences. Maximum parsimony and maximum likelihood phylogenetic inferences were carried out as mentioned above. For the ML analyses the general timereversible model, with a proportion of invariant sites and a gamma distributed rate variation across sites (GTR + I + G), was assumed. Combined Bayesian Inference analyses were performed with explicit character partitions for each concatenated region, along with their independently-selected models of evolution. Monte Carlo Markov chains were run for 1 107 generations. To account for the rate variation among partitions (Marshall et al., 2006) we allowed the rates to vary under a flat Dirichlet prior distribution (ratepr = variable). The parameters of nucleotide frequencies, substitution rates, gamma shape, and invariant-sites proportion were unlinked across partitions.
Table 3 Summary of the sister relationships found for the group of undescribed specimens under all employed data sets and inference methods. The relationships are expressed in Newick notation (Felsenstein et al., 1986). Only node support values above 50% are shown. Nodes with support values lower than 50% are indicated with a cross (+). The ‘‘(x of n)” format represents the number of most parsimonious trees (out of the total) that contained a given node. The asterisk (*) symbolizes extremely short branch lengths for the supporting branch. The information in the last column ‘‘Characters and Model” indicates (in this order): total number of characters in the aligned matrix, number of variable sites, number of parsimony informative sites, percentage of variable sites, and assumed model of nucleotide evolution. The dash (–) indicates absence of support. Datasets
(Coralliidae, undescribed specimens)
(Paragorgia, undescribed specimens)
(S. dennisgordoni/outgroup, undescribed specimens)
Unresolved
Characters and model
– – – (3 of 3), 59 92 83 – – – – – – (1 of 12) – – – – – (1 of 3) – – – – –
– – – – – – (1 of 2) +* 52 – +* – (8 of 12) – – – – – (1 of 3) +* – – – –
(3 of 6) – + – – – – – – + – + – – + – – – – – + – – –
597, 16, 5, 2.7%, TIM + I
All mtDNA coding regions Paragorgia, Sibogagorgia, Corallium and Paracorallium ND6-intND63-ND3-COI- MSH1–16SMP (2 of 2), 90 ND2 ML 100 BI 90
– – –
– – –
– – –
All mtDNA protein-coding regions Paragorgia, Sibogagorgia, Corallium and Paracorallium ND6-ND3-COI- MSH1–16S-ND2 MP (2 of 2), 91 ML 100 BI 0.91
– – –
– – –
– – –
Additional outgroups Eleutherobia + Paragorgia, Sibogagorgia, Corallium and Paracorallium 28S MP (3 of 3) ML BI 16S, MSH1, ND2 MP (1 of 2) ML 98 BI 90
– – – – – –
– + – (1 of 2) – –
– – + – – –
6)
2)
12)
3), 55
3)
2), 89
367, 89, 53, 24.2%, HKY+G
468, 75, 42, 16.0%, GTR+G
126, 19, 11, 15.1%, HKY+I
459, 48, 25, 10.5%, GTR+G
729, 152, 82, 20.8%, HKY+G 547, 63, 33, 11.5%, TVM+I
564, 95, 50, 16.8%, HKY+G
2958, 460, 248
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
Individual regions Paragorgia, Sibogagorgia, Corallium and Paracorallium 28S MP (3 of ML 52 BI ITS2 MP ML BI ND6 MP (1 of ML BI ND3 MP ML BI COI MP (3 of ML + BI MSH1 MP (3 of ML + BI 78 16S MP (1 of ML BI ND2 MP (2 of ML 92 BI 83
2346, 389, 210
597, 16, 5
1470, 312, 156 (continued on next page)
127
1492, 423, 259
1463, 323, 161
– – +
– – –
– – – (1 of 2) +* 52
(1 of 2) +* 98
– – –
– – – and Paracorallium – – –
Genetic divergence, measured as genetic distances among species and genera, was estimated using the mitochondrial protein-coding dataset. This data set was chosen because it was more complete than any of the nuclear data sets and also excluded the insertion–deletion (INDELS) uncertainty present in non-coding regions; therefore it minimized the noise that can arise from missing data. Maximum likelihood distances were calculated in PAUP* employing a Neighbor-Joining tree and the GTR + I + G model.
(S. dennisgordoni/outgroup, undescribed specimens)
Unresolved
A ‘‘total evidence” combined analysis was not performed because of two main reasons: (1) the specimens, and likely the species, of the selected outgroup Coralliidae from which we obtained the nuclear ITS2 and the mitochondrial sequences were not the same (please refer to Section 1 and Table 1); (2) it has been shown that the combined analysis of genes or gen-complexes (i.e., linked genes such as the mitochondrial ones) with incongruent evolutionary histories can produce positively misleading results by increasing the support of wrong phylogenetic tree (Edwards et al., 2007; Hedtke et al., 2006; Kubatko and Degnan, 2007) 2.4. Divergence estimates
(Paragorgia, undescribed specimens)
– +* –
3. Results
Anthomastus + Paragorgia, Sibogagorgia, Corallium and Paracorallium 16S, MSH1, ND2 MP (1 of 2) ML BI Eleutherobia and Anthomastus + Paragorgia, Sibogagorgia, Corallium and Paracorallium 16S, MSH1, ND2 MP (1 of 2) ML BI Eleutherobia, Anthomastus, Muricea and Alaskagorgia + Paragorgia, Sibogagorgia, Corallium 16S, MSH1, ND2 MP (3 of 3) ML BI -
(Coralliidae, undescribed specimens) Datasets
Table 3 (continued)
1463, 285, 145
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
Characters and model
128
Mostly complete sequence sets were obtained, except in the few cases where nucleotide sequences from direct PCR products had low quality (see Table 1). Sequence length variations, for the individual regions of Paragorgia, Sibogagorgia, Corallium, Paracorallium and the undescribed specimens, were observed in the 28S (587–592 bp), ITS2 (280–301 bp), ND6 (462–465 bp), ND6–ND3 intergenic spacer (22–45 bp), msh1 (720–723) and 16S (338–353, 163–192 bp). The number of nucleotide residues in the ND3 (127 bp) ND2, (564 bp) and COI (461 bp) was constant among all examined taxa. The percentages of nucleotide variation within each aligned region ranged between 2.7% (28S) and 24.2% (ITS2) for the nuclear and 10.5% (COI) and 20.8% (msh1) for the mitochondrial (Table 3). 3.1. Molecular phylogenetic inferences Phylogenetic hypotheses obtained for all combined and individual datasets, under all inference methods (MP, ML and BI), shared two overall patterns: (1) The well-supported monophyly of the clades Paragorgia, Coralliidae (Corallium + Paracorallium) and the group of undescribed specimens, (2) the failure of the undescribed specimens to group with any described species. The analyses of each independent genomic region yielded, as mentioned above, gene trees with highly supported deep nodes, but very poorly resolved relationships among major clades (Fig. 1A). This was true for all regions, with the exception of the ITS2, msh1 and ND2. These three regions produced fully resolved, although dissimilar, tree topologies; mitochondrial and nuclear trees differed appreciatively in arrangement of the internal nodes. The ND2 and msh1 data grouped the undescribed specimens with the Coralliidae, and Paragorgia with S. dennisgordoni (not shown). In contrast, the nuclear ITS2 recovered the undescribed specimens grouping together with Paragorgia, and the Coralliidae with S. dennisgordoni (Fig. 1B). It is noteworthy that these datasets showed the highest percentage of nucleotide variation (P16.8%) of all individual genomic regions, and trees based on them were the only ones with relatively high support values for the internal nodes (see Table 3 for an example of the positioning of the Sibogagorgia sp. group). Combined phylogenetic analyses of the all-mt-regions and protein-coding datasets (Table 3) produced fully resolved trees. The
129
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
A
Coralliidae undescribed specimens
S. dennisgordoni
Paragorgia
C .3 pec d. S Un Un Un d. Spec.4 d. Sp ec .2
d.
d.
Sp
Un
Un
Sp
ec
.1
B
ec
. Und. Spec.42 ec.3 . Sp Und
Fig. 1. Unrooted evolutionary-tree hypotheses of the relationships among genera and species of the families Coralliidae (Corallium and Paracorallium), Paragorgiidae (Paragorgia and Sibogagorgia) and the unidentified specimens, generated through BI analyses. The unidentified specimens where enumerated; number 1 corresponds to the specimen with catalog number USNM 54831, number 2 to USNM 1081143, number 3 to USNM 1122229 and number 4 to USNM 1122230 (see Table 1). (A) Dendrogram summarizing the gene-tree hypotheses; this dendrogram was obtained through the loose consensus method as implemented in the program Dendrogram 2.4 (Huson, 2007). (B) Phylogram obtained with the ITS2 sequences. (C) Phylogram obtained with the all-mt-regions concatenated dataset. Support values P 90% are shown as circular pies. Each color represents support found with each one of the inference methods: magenta for MP, cyan for ML and green for BI. The scale bar represents the number of substitutions per site. (For interpretation of references to color in this figure legend, the reader is referred to the web version of this article.).
topologies were identical and all nodes (except for the one linking P. regalis and P. yutlinux) were well supported by high MP and ML bootstrap values, and BI posterior probabilities (>90%). These hypotheses reflected the same relationships recovered by msh1 and ND2 data sets (Fig. 1C). In general, the establishment of a rooting point in the trees was problematic due to the discordance in the positioning of the selected outgroup (Coralliidae) with respect to the ingroup (Paragorgiidae). The addition of more distantly related outgroups in the analyses of the 16S-msh1-ND2 dataset indicated that S. dennisgordoni is the extant member of the earliest divergent lineage in the Coralliidae + Paragorgiidae group (Fig. 2), although this interpretation may be inaccurate due a possible effect of long branch attraction (LBA). The inclusion of Eleutherobia derived into the same well-supported and resolved tree topology found with the allmt-regions and protein-coding datasets (Fig. 2C). However, this result was not consistent when the sequences of Muricea, Alaskagorgia or Anthomastus were incorporated in the analyses. Such incorporation reduced the deep-nodes resolution. Incongruent relationships were obtained among different out group-subsets and phylogeny estimation methods. Trees were characterized by very low values of node support, and either unresolved topologies (Table 3), or extremely short inner branches (Fig. 2).
when compared to the divergence between them (including S. dennisgordoni) (Fig. 3). The clades with larger and smaller ranges of genetic variation were the Paragorgia (0.43–4.87%) and the undescribed specimens group (0–0.75%), respectively. Distances were the greatest when measured between S. dennisgordoni and each one of the clades. On the other hand, the genetic divergences within Coralliidae and the undescribed specimens were the smallest of all the inter-clade comparisons. 3.3. Posterior morphological examination of unidentified specimens The examined undescribed specimens, which were previously identified as Paragorgia sp. (2) and Sibogagorgia sp. (2), showed very similar morphological features, both macroscopic and microscopic. Surface radiate sclerites were almost identical among all the four specimens (Figs. 4 and 5), but did not resemble the ones found in any of the currently accepted species in either genus (Sánchez, 2005). These specimens also presented both boundary and medullar canals (Fig. 7). Branch coloring was either beige or red. Pink polyps were observed in a couple of beige specimens. 4. Discussion
3.2. Genetic divergence
4.1. Correspondence of morphologically-base taxonomy and molecular data
Genetic divergence within clades (Paragorgia, Coralliidae and the group of undescribed specimens) was, on average, lower than
The molecular data generated in this study indicated heterogeneous levels of correspondence with the currently accepted
130
S. Herrera et al. / Molecular Phylogenetics and Evolution 55 (2010) 123–135
A
B
Un
d.
Sp ec .1 Und. Spec.2 3 . c pe d. S Un
Un
d. S
Un
d.
U
Sp
nd .S
ec .1
pe c.
4
pec .3 Und. Spec.2 4 c. e Sp d. Un
D
C
Un
d. S
ec
.1
pec .3 Und. Spec.2 4 c. e Sp d. Un
Un
Un
d.
Sp
ec
.4
pec .1 Und. Spec.2 .3 ec Sp d. n U
Sp
d. S
d.
Un
Fig. 2. Unrooted phylogenetic hypotheses of the genera and species of the families Coralliidae, Paragorgiidae and the unidentified specimens, including additional outgroups. All trees were obtained through ML analyses of the concatenated 16S-msh1-ND2 datasets. The unidentified specimens where enumerated; number 1 corresponds to the specimen with catalog number USNM 54831, number 2 to USNM 1081143, number 3 to USNM 1122229 and number 4 to USNM 1122230 (see Table 1) (A) Outgroups: Anthomastus, Eleutherobia, Muricea and Alaskagorgia (B) Outgroups: Anthomastus and Eleutherobia. (C) Outgroup: Eleutherobia. (D) Outgroup: Anthomastus. Support values P 90% are shown as circular pies. Each color represents support found with each one of the inference methods: magenta for MP, cyan for ML and green for BI. The scale bar represents the number of substitutions per site. (For interpretation of references to color in this figure legend, the reader is referred to the web version of this article.).
morphologically-based taxonomy. Our results strongly support monophyly of the genus Paragorgia, the family Coralliidae (precious corals), and the group of undescribed specimens. Each of these clades exhibited low intra-clade and high inter-clade genetic distances (Fig. 3). Paragorgia presents a special case of very low genetic divergence, similar to the one found within P. arborea (
