RBMOnline - Vol 9. No 6. 2004 623-629 Reproductive BioMedicine Online; www.rbmonline.com/Article/1558 on web 27 October 2004
Article Morula-derived human embryonic stem cells Dr Strelchenko has over 20 years’ experience in cell culture, nuclear transfer technology, somatic cell hybridization and the establishment of embryonic stem cell (ESC) and primordial germ cell lines. He has been principal investigator on cloning projects and created the world’s first cloned calf and numerous high genetic merit animals. At the Reproductive Genetics Institute, he is director of the ESC research laboratory and participates in establishing and characterizing the human ESC lines repository, which currently includes over 100 human ESC lines.
Dr Nick Strelchenko Nick Strelchenko1, Oleg Verlinsky, Valeri Kukharenko, Yury Verlinsky Reproductive Genetics Institute, Chicago, IL, USA 1Correspondence: e-mail:
[email protected]
Abstract Human embryonic stem (ES) cells are known to derive from the inner cell mass of blastocyst. Although the embryos of other developmental stages have also been used as a source for ES cells in animal models, the feasibility of obtaining ES cell lines from human morula is not known, despite being an obvious source available through assisted reproduction and preimplantation genetic diagnosis programmes. This study describes an original technique for derivation of ES cells from human morula, which enabled the establishment of eight morula-derived ES cell lines. These ES cell lines were shown to have no morphological differences from the ES cells derived from blastocysts, and expressed the same ES cell specific markers, including Oct-4, tumour-resistance antigens TRA-2–39, stage-specific embryonic antigens SSEA-3 and SSEA-4, and high molecular weight glycoproteins TRA-1–60 and TRA-1–81, detected in the same colony of morula-derived ES cells showing specific alkaline phosphatase expression. No differences were observed in these marker expressions in the morula-derived ES cells cultured in the feeder layer free medium. Similar to ES cell originating from blastocyst, the morula-derived ES cells were shown to spontaneously differentiate in vitro into a variety of cell types, including the neuron-like and contracting primitive cardiocytelike cells. Keywords: blastocyst, embryonic stem (ES) cells, ES cell marker expression, human ES cell lines, morula
Introduction The first attempt at isolation of embryonic stem (ES) cells goes back to the 1960s, when Cole, Edwards and Paul (1965) obtained ES cells from rabbit embryos and compared the efficiency of the establishment of ES cells from morula and blastocyst (see Edwards, 2004). Even after this work, the major studies in this field involved for a long time only murine and human teratocarcinomas or EC cell lines (Stevens, 1970), before ES cells were established from the outgrowth of the inner cell mass (ICM) of murine blastocysts (Evans and Kaufman, 1981; Martin, 1981). These cells were shown to be positive for alkaline phosphatase (AP) and expressed stage-specific embryonic antigens SSEA-1, SSEA-3 and SSEA-4. The murine ES cell lines have also been established from morula-stage embryo and were shown to be similar to ES cells isolated from blastocyst (Eistetter, 1989). The morula-derived ES cell lines were also obtained from mink and cow embryos (Sukoyan et al., 1993; Stice et al., 1996). These developments have led to attempts to produce human ES cells from an entire blastocyst (Bongso et al., 1994), and, finally, from ICM (Thomson et al., 1998). However, as yet there are no reports on the establishment of ES cells from human morula. This
paper describes the original technique for the derivation of ES cell lines from human morula, which resulted in the establishment of eight morula-derived ES cell lines, described here in comparison with the ES cell lines derived from the ICM and whole blastocyst.
Materials and methods Human embryos for the study were obtained from IVF and preimplantation genetic diagnosis (PGD) programmes of the Reproductive Genetics Institute (RGI) in different countries. The study protocol, approved by the Institutional Review Board (IRB), allowed patients donating spare embryos for research by signing the consent form. Overall, 117 embryos were obtained, including 46 morula and 71 blastocyst-stage embryos (see Table 1).
Establishment of ES cell lines from human morula Forty-six attempts were made to establish ES cell lines from the morula-stage embryos, which were cultured in medium G1 and then in human tubal fluid (HTF) medium supplemented with plasmanate. The embryos were mostly normal diploids (see Table 2, right column below). These embryos were obtained on
623
Article - Morula-derived human embryonic stem cells - N Strelchenko et al.
day 4, when PGD had been established. Otherwise the embryos were frozen, especially when they were transported from different PGD centres. The technique involved the removal of zona pellucida by pronase (3 mg/ml; Sigma, St Louis, MO, USA), injection of the naked morula by use of micromanipulator under feeder layer, which was the mitotically inactivated murine primary embryonic fibroblasts or BRL cells, inactivated by mitomycin C (Sigma) at 10 μg/ml for 5–6 h. The cells were cultured in Alpha MEM or DMEM medium, supplemented with 10–20% of fetal bovine serum (FBS) or knockout serum replacement (SR-1) (all from Gibco, Grand Island, New York, USA). In addition, beta-mercaptoethanol (Gibco) at a final concentration of 1 mmol/l and human recombinant basic fibroblast growth factor (FGF; Sigma) at a final concentration of 5 ng/ml were added to culture medium, and after cell outgrowth and spreading into the layer, which was observed over approximately 8–14 days, the initial disaggregation was performed (passage 0) using 1 mmol/l EDTA (Sigma) in Hank’s or PBS Ca2+–Mg2+-free solutions. Using glass needles, only soft loose cell clumps were cut and transferred into a new dish with a feeder layer, while loose cells were carefully transferred onto the
feeder layer and proliferate. Fast proliferating colonies with ESlike morphology were isolated and propagated further. Within the next two to five passages, the uniform proliferating cells were selected, and colonies of established ES cell lines were passaged using collagenase V (Sigma) at 1.5 μg/ml in HTF–HEPES (Gibco) or 1 mmol/l EDTA, followed by harvesting with a cell lifter (Costar, Corning, New York, USA); the undifferentiated ES cell population was then isolated using EDTA solution (the patent for morula-derived ES cell lines is pending). On average, there were 4–6 population doublings per passage.
Establishment of ES cell lines from ICM of human blastocyst Of 71 attempts undertaken for establishment of ES cell lines from blastocyst-stage human embryos, blastocyst immunosurgery was performed (Thomson et al., 1995) in 32 of them to isolate the ICM cluster, using 1:50 diluted human antiserum Sigma (H3383) and 1:3 diluted guinea pig serum complement (Sigma, S1639) in HTF–HEPES. After mechanical removal of collapsed trophoblast, the isolated ICM (or the whole
Table 1. Efficiency of establishing ES cells from different stage embryos. Embryo stage
Number
Outgrowth (n)
Cell lines (n)
% establishment
Morula Blastocyst ICM
46 39 32
11 12 5
8 7 5
17 18 16
Table 2. Characterization of ES cell lines derived from different stage embryos.
624
Cell Line
Source
No. passages
AP
SS3
SS4
T60
T80
T39
Oct4
Karyotype
15 18 21 24 27 28 31 33 53 60 62 63 79 80 81 93 94 95 96 97
Morula Morula Morula Morula Morula Morula Morula Morula Blast Blast Blast Blast Blast Blast Blast ICM ICM ICM ICM ICM
17 16 14 10 15 16 10 8 6 5 7 6 7 24 6 5 5 4 21 3
100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100
87 91 + + 77 69 72 84 + 84 + 76 + + + 76 + + + 83
95 96 + + + 89 + + + 93 + 92 + + + 91 + + + 96
97 95 + + + 93 + + + 97 + 94 + + + 95 + + + 97
98 96 + + + 91 + + + 98 + 92 + + + 99 + + + 98
100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100
94 96 91 + + 97 + + + 94 + 94 + + + 96 + + + 95
46, XY 46, XX 46, XX 46, XX 46, XX 46, XY 46, XX 46, XY 46, XX 46, XX 46, XY 46, XY 46, XX 46, XX 46, XY 46, XY 46, XY 46, XX 46, XX 46, XY
Abbreviations: ICM = inner cell mass, blast = blastocyst, AP = alkaline phosphatase, SS3 = SSEA-3 (stage-specific embryonic antigen 3), SS4 = SSEA-4 (stage-specific embryonic antigen 4), T60 = TRA-1–60 (tumour resistance antigen-1-60), T80 = TRA-1–80 (tumour-resistance antigen-1-80), T39 = TRA-2–39 (tumour-resistance antigen-2-39), Oct4 = Oct4 gene (belongs to the POU family of transcription factors).
Article - Morula-derived human embryonic stem cells - N Strelchenko et al.
blastocyst) was placed on the top of feeder layer, with proliferating cells observed within 24–48 h. Passage 0 of the blastocyst outgrowth cells was performed using 1 mmol/l EDTA in PBS or in Hank’s Ca–Mg-free solution. The cell colonies were selected 7–10 min after exposure to 1 mmol/l EDTA in phosphate-buffered saline or in Hank’s Ca–Mg-free solution, with further passages performed by collagenase or 1 mmol/l EDTA in Hank’s Ca–Mg-free solution, followed by harvesting using the cell lifter. The cell suspension was put through the 100 mkm cell strainer before placing on the fresh feeder layer.
Freezing and storage
ES cell marker expression
Figure 1 shows the different steps in the derivation of ES cells from the human morula, described in Materials and methods above, in comparison with ES cell from ICM. After placing the naked morula under the confluent feeder layer, cell proliferation was observed, creating a plate of compacted cells (Figure 1a), which further proliferated in the culture dish as shown in Figure 1b. Following the initial passage of proliferating cell clusters, the disaggregated cells were placed on the top of the feeder layer, with cell outgrowth observed in eight of 11 morula cultures initiated. During the next two to four passages, only cell colonies with morphology of ES cells were selected for a further culture. It was at this stage when three of 11 morula-derived cell lines failed to further proliferate, with the remaining eight resulting in the stable and monomorphic ES cell lines, as shown in Figure 1c. Overall, only 11 (23.9%) of 46 morula-stage embryos resulted in the initial outgrowth, with eight (17%) yielding ES cell lines, similar to the outcome of ES cell line originating from blastocyst (Table 1).
Alkaline phosphatase was detected by SK-5300 kit (Vector Laboratories, Inc., Burlingame, CA, USA), and by primary antibodies TRA-2–39 isotype IgG1 (Santa Cruz Biotechnologies, Inc., Santa Cruz, CA, USA; cat. no. SC-21708), developed against epitope 2102 of L-alkaline phosphatase of human carcinoma, using goat anti-mouse isotype IgG1 labelled with fluorescein isothiocyanate (FITC; Nikon, filter B-1A). Monoclonal rat antibodies were used for detection of the stagespecific antigen SSEA-3 (Santa Cruz Biotechnologies, cat. no. SC-21703). In addition, monoclonal rat antibodies were used for the detection of isotype IgM (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA; cat. no. 112–095–075; Isotype IgM labelled with FITC). Detection of SSEA-4 was performed with primary mouse monoclonal antibodies (Isotype IgG3; Santa Cruz Biotechnologies, cat. no. SC-21704 combined with secondary FITC-labelled antibodies). High molecular weight glycoproteins or tumour rejection antigens, TRA-1–60, were detected with primary mouse monoclonal antibodies (Santa Cruz Biotechnologies, cat. no. SC21705) and secondary antibodies SC-2082 (isotype IgM labelled with FITC). Glycoprotein antigen detected by TRA-1–80 was detected with primary antibodies (isotype IgM labelled with FITC; Santa Cruz Biotechnologies, cat. no. SC-21706). Localization of Oct-4 expression in ES cells was performed with polyclonal antibodies (Santa Cruz Biotechnology) and secondary labelled with TRITC, and Oct-4 expression was assessed by Gene Choice One Tube reverse transcriptase-polymerase chain reaction (RT-PCR) kit (Vector Laboratories, Inc.), using primer sequences CACGAGATGCAAAGCAGAAACCCTCGG and TTGCCTCTCACTCGGTTCTCG, generating the RT-PCR product of 73 bp. The same markers were tested in ES cell cultures in the feeder layer free medium (Carpenter et al., 2004; Rosler et al., 2004).
Differentiation of ES cells in vitro Spontaneous differentiation of ES cells into a variety of differentiated cell types was studies following in-vitro initiation of embryonic bodies from ES cell lines obtained from embryos from different stages of development (Reubinoff et al., 2000).
Chromosomal analysis Chromosomal analysis of the established ES cell lines was done using standard karyotyping by G-banding before freezing.
The established ES cell lines were tested for mycoplasmal and bacterial contamination and frozen in Alpha MEM medium containing 5% DMSO, 5% glycerol and 10% FBS or 15% SR1, using the control rate freezer, lowered temperature for at a rate of 1°C per min to –30°C, followed by storage of cells in vapour of liquid nitrogen (–176°C).
Results
In contrast to morula-derived ES cell lines, derivation of ES cells from entire blastocysts required precise timing for initial disaggregation (passage 0). Although initial outgrowth was observed in 12 (30.7%) of 39 initiated cultures originating from the entire blastocysts, five of them were lost in the selection process during passages 2 and 3, resulting in the establishment of ES cell lines in only seven (18%) of 39 attempts. Similar results were obtained from ICM, although this involved a more time-consuming immunosurgery technique. The procedure of the derivation of ES cell line from ICM is shown in the right column of Figure 1, starting with the attachment of ICM to feeder layer (Figure 1d), initial outgrowth (Figure 1e) and the establishment of the proliferation of ES cells (Figure 1f), without selection required in ICM-derived ES cell lines. Although only five (15.6%) of 32 attempted ICM cultures produced initial outgrowth after introduction in vitro, all of them resulted in the establishment of ES cell lines. As shown in Table 2, all 20 established ES cell lines expressed specific ES stem cell markers, including AP, SSEA-3, SSEA-4, TRA-1–60, TRA-1–80, TRA-2–39 and Oct-4, irrespective of their origin (Figure 2c,d – SSEA-3; 2e,f – TRA-1-80). These markers were detected in the same colonies for morula, blastocyst and ICM-derived cell lines, expressing AP (see Figure 2), such as immunostaining with primary TRA-2–39 and secondary FITC-labelled antibodies in morula (Figure 2a) and ICM-derived cell lines (Figure 2b), as well as red fluorescence (TRITC) for Oct-4 (Figure 2a,b) for morula and ICM-derived ES cells respectively. There were no differences in the above expression patterns following culture of ES cells of different origin in the feeder layer free medium.
625
Article - Morula-derived human embryonic stem cells - N Strelchenko et al.
a
d
b
e
c
f
Figure 1. Initial steps in establishing of human ES cell lines from different embryo stages. (a) Placing a human embryo at morula stage under mouse embryonic fibroblasts for establishing ES cells (×10, Hoffman DIC). (b) Initial growth of morula cells under feeder layer (×10, Hoffman DIC). (c) Morphology of human morula-derived ES cells (×10, Ph1); (d,e) Initial growth of ES cells out of isolated ICM (×20, Ph1). (f) Primary colony of ES cells derived from ICM (×20, Ph1). Morphology of human ICM-derived ES cells (×10, Ph1).
626
Article - Morula-derived human embryonic stem cells - N Strelchenko et al.
a
b
c
d
e
f
Figure 2. Expression of markers TRA-2–39, Oct-4, SSEA-3, TRA-1–80 and their match on the same colonies with enzymatic activity of alkaline phosphatase (AP) in human embryo stem (ES) cell lines derived from morula (left) and inner cell mass (ICM, right). [TRA = tumour-resistance antigen; SSEA = stage-specific embryonic antigen; FITC = fluorescein isothiocyanate; TRITC = tetramethylrhodamine isothiocyanate.] (a) Immunofluorescence of TRA-2–39 (FITC) and Oct-4 (TRITC) of human ES-cells derived from morula and growing on the murine feeder layer stained by Hoechst 33342. (Objective 20×, filter Nikon D/F/T.) (b) Immunofluorescence of TRA-2–39 (FITC) and Oct-4 (TRITC) of human ES-cells derived from ICM and growing on the murine feeder layer stained by Hoechst 33342. (Objective 20×, filter Nikon D/F/T.) (c) Expression of enzymatic activity of AP and matched immunofluorescence cell surface staining of SSEA-3 detected by monoclonal antibodies labelled with FITC on the same colony of human ES cells derived from morula and growing on the murine feeder layer. (Objective 20×, filter Nikon B-1A.) (d) Expression of enzymatic activity of AP and matched immunofluorescence cell surface staining of SSEA-3 detected by monoclonal antibodies labelled with FITC on the same colony of human ES cells derived from ICM and growing on the murine feeder layer. (Objective 20×, filter Nikon B-1A.) (e) Expression of enzymatic activity of AP and matched immunofluorescence cell surface staining of TRA-1–80 detected by monoclonal antibodies labelled with FITC on the same colony of human ES cells derived from morula and growing on the murine feeder layer. (Objective 20×, filter Nikon B-1A.) (f) Expression of enzymatic activity of AP and matched immunofluorescence cell surface staining of TRA-1–80 detected by monoclonal antibodies labelled with FITC on the same colony of human ES cells derived from ICM and growing on the murine feeder layer. (Objective 20×, filter Nikon B-1A.)
627
Article - Morula-derived human embryonic stem cells - N Strelchenko et al.
Three morula-derived ES cell lines were with normal male (46,XY) and five normal female (46,XX) karyotypes. Similarly, three blastocyst-derived ES cell lines were with normal male, and four with female karyotypes, while three ICM-derived ES cell lines were with normal male and two with normal female karyotypes. After in-vitro initiation of embryonic bodies from ES cell lines originating from different stages of embryo development, a wide variety of differentiated cells were obtained, including neurons and primitive cardiocytes. All established ES cell lines were frozen with control thaw-out.
Discussion These data present the first evidence for the establishment of ES cell lines from the human morula. This is despite the fact that morula cells are significantly different from blastocyst cells, not only in size of adjacent cytoplast but also in gene pattern expression. This includes an unstable maternal methylation pattern that persists until the morula stage, disappearing at the blastocyst stage, where low concentrations of methylation are present independently from parental origin (Hanel and Wevrick, 2001). For example, bovine embryos display a high sensitivity to ouabain (potent inhibitor of the Na/K-ATPase), with enzymatic activity undergoing a nine-fold increase from the morula to the blastocyst stage (Watson and Barcroft, 2001). mRNA expression patterns have been shown to be different in mouse embryos at the morula, and blastocyst stages (Lee et al., 2001; Tanaka and Ko, 2004). The method of establishment of the morula-derived ES cell lines described is simple and results in 17% efficiency of the establishment of the human morula-derived ES cell lines, similar to the establishment of ES cell lines from the whole blastocyst (18%) and ICM (16%). Despite the above differences between morula and blastocyst, comparative studies of 20 ES cell lines obtained in this study from the embryos of different stages of embryonic development revealed no morphological differences between human ES cells originating from the entire blastocyst, from ICM and from morula. No differences were observed in the pattern of marker expression either, including alkaline phosphatase (AP), TRITC-immunofluorescence of expression of Oct-4, immunofluorescence of TRA-2–39 (L-AP), TRA-1–60, and TRA-1–80, detected by monoclonal antibodies labelled by FITC, antigens SSEA-3 and SSEA-4. These patterns of marker expression in morula-derived ES cells were also observed following the culture in feeder layer free medium, and the cells were characterized by the same ability to differentiate in different type of cells irrespective of their origin. However, further studies will be needed to investigate if moruladerived ES cells would display differential characteristics at later stages of differentiation, depending on a possible partitioning of inside and outside cells of morula at the time of harvesting, from which ES cells were derived. Because inside cells of morula were shown to express Oct-4 (Liu et al., 2004), the resulting morula-derived ES cells may have originated from these cells. The same cells may be involved in forming the epiblast of the blastocyst, from which ES cells have recently been derived (Buehr and Smith, 2003).
628
Thus the ES cell lines may be derived from human morula, representing typical morphology and marker expression of ES
cells, which may be used in future research in the developments and application of cell therapies.
Acknowledgement The authors would like to express their gratitude to Professor Anver Kuliev for editing the paper and critical review of the results of this work.
References Bongso A, Fong CY, Ng SC, Ratnam S 1994 Isolation and culture of inner cell mass cells from human blastocysts. Human Reproduction 9, 2110–2117. Buehr M, Smith A 2003 Genesis of embryonic stem cells. Philosophical Transactions of the Royal Society of London, Series B, Biological sciences 358, 1397–1402. Carpenter MK, Rosler ES, Fisk GJ et al. 2004 Properties of four human embryonic stem cell lines maintained in a feeder-free culture system. Developmental Dynamics 229, 243–258. Cole RJ, Edwards RG, Paul J 1965 Cytodifferentiation in cell colonies and cell strains derived from cleaving ova and blastocysts of the rabbit. Experimental Cell Research 37, 501–504. Edwards RG 2004 Stem cells today: A. Origin and potential of embryo stem cells. Reproductive BioMedicine Online 8, 275–306. Eistetter HR 1989 Pluripotent embryonal stem cells can be established from disaggregated mouse morulae. Development, Growth and Differentiation 31, 275–282. Evans MJ, Kaufman MN 1981 Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154–156. Hanel ML, Wevrick R 2001 Establishment and maintenance of DNA methilation patterns in mouse Ndn: implications for maintenance of imprinting in target genes of the imprinting center. Molecular Cell Biology 21, 2384–2392. Lee KF, Chow JF, Xu JS et al. 2001 A comparative study of gene expression in murine embryos developed in vivo, cutured in vitro, and cocultured with human oviductal cells using messenger ribonucleic acid differential display. Biology of Reproduction 64, 910–917. Liu L, Czerwiec E, Keefe D 2004 Effect of ploidy and parental genome composition on expression of Oct-4 protein in mouse embryos. Gene Expression Patterns 4, 433–441. Martin GR 1981 Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proceedings of the National Academy of Sciences of the USA 78, 7634–7638. Reubinoff B, Pera MF, Fong CY et al. 2000 Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nature Biotechnology 18, 399–404. Rosler ES, Fisk GJ, Ares X et al. 2004 Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics 229, 259–274. Stevens LC 1970 The development of transplantable teratocarcinomas from intratesticular grafts of pre- and postimplantation mouse embryos. Developmental Biology 21, 364–382. Stice SL, Strelchenko NS, Keefer CL, Matthews L 1996 Pluripotent bovine embryonic cell lines direct embryonic development following nuclear transfer. Biology of Reproduction 54, 100–110. Sukoyan MA, Vatolin SY, Golubitsa AN et al. 1993 Embryonic stem cells derived from morulae, inner cell mass, and blastocysts of mink: comparisons of their pluripotencies. Molecular Reproduction and Development 36, 148–158. Tanaka TS, Ko MSH 2004 A global view of gene expression in the preimplantation mouse embryo: morula versus blastocyst. European Journal of Obstetrics, Gynecogy and Reproductive Biology 115S, S85–S91. Thomson J, Kalishman J, Golos TG et al. 1995 Isolation of a primate
Article - Morula-derived human embryonic stem cells - N Strelchenko et al.
embryonic stem cell line. Proceedings of the National Academy of Sciences of the USA 92, 7844–7848. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. 1998 Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147.
Watson AJ, Barcroft LC 2001 Regulation of blastocyst formation. Frontiers in Bioscience 6, 708–730.
Received 23 September 2004; refereed 5 October 2004; accepted 15 October 2004.
629
