Molecular Phylogenetics and Evolution 53 (2009) 212–219
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev
Multi-locus phylogeny clarifies the systematics of the Australo-Papuan robins (Family Petroicidae, Passeriformes) Kate Loynes a, Leo Joseph b,*, J. Scott Keogh a a b
School of Botany and Zoology, The Australian National University, Canberra, ACT 0200, Australia Australian National Wildlife Collection, CSIRO Sustainable Ecosystems, GPO Box 284, Canberra, ACT 2601, Australia
a r t i c l e
i n f o
Article history: Received 27 January 2009 Revised 13 May 2009 Accepted 15 May 2009 Available online 20 May 2009 Keywords: Petroicidae Australo-Papuan robins Eopsaltria Microeca Peneoenanthe Microecinae
a b s t r a c t The Australo-Papuan family Petroicidae (Aves: Passeriformes) has been the focus of much systematic debate about its relationships with other passerine families, as well as relationships within the family. Mostly conservative morphology within the group limits the effectiveness of traditional taxonomic analyses and has contributed to ongoing systematic debate. To assess relationships within the family, we sampled 47 individuals from 26 species, representing the majority of genera and species, for four loci: 528 base pairs (bp) of C-myc, 501 bp of BA20454 and 336 bp of BA23989 from nuclear DNA and 1005 bp of the mitochondrial ND2 gene. There was consensus between individual loci and overall support for major lineages was strong. Partitioned Bayesian analyses of all four loci produced a fully resolved and very well-supported phylogeny that addresses many of the previous systematic debates in this group. The Eopsaltriinae as construed is monophyletic with the exception of Eopsaltria flaviventris, which is nested within Microeca as an unremarkable member of that genus. This relationship is corroborated by morphology and egg color and pattern. Petroicinae as currently construed was not monophyletic and comprised two lineages that are paraphyletic with respect to each other. The third subfamily, Drymodinae, remains incertae sedis. The mangrove robin, Peneonanthe pulverulenta, of tropical Australia and New Guinea is nested within a clade that also contained the sampled species of Peneothello and Melanodryas, a novel relationship. Preliminary biogeographic and divergence time estimates from these results are discussed and a new subfamily arrangement proposed. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction The Petroicidae (Aves: Passeriformes) is a morphologically conservative but ecologically diverse family of some 45 species and 13 genera of oscine passerine birds. It is found from the cloud forests of New Guinea to arid Australian scrublands. First diagnosed by DNA–DNA hybridization analysis and named the Eopsaltriidae, it was placed within the superfamily Corvoidea (Sibley and Ahlquist, 1985). The Corvoidea is now considered a paraphyletic grade of passerine birds and Petroicidae is questionably within it (Barker et al., 2004). Sequence analyses suggest that Petroicidae and the African rockjumpers Picathartidae are the two candidate sister families to the species-rich radiation known as the Passerida (Ericson et al., 2002; Barker et al., 2004). The Passerida is diagnosed by a three base pair insertion in the nuclear gene C-myc (Ericson et al., 2000). The only petroicid sampled for this trait to date, Eopsaltria australis, lacks this insertion (Ericson et al., 2002). A range of other sequence analyses supports the family’s candidate status as a sister to the Passerida (Barker et al., 2004). In previous analyses of the * Corresponding author. Fax: +1 61 2 6242 1688. E-mail address:
[email protected] (L. Joseph). 1055-7903/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2009.05.012
systematic affinities of the Passerida, however, taxon sampling within Petroicidae has been poor (Ericson et al., 2000; Barker et al., 2004; Beresford et al., 2005), if they have been represented at all (Treplin et al., 2008). Because morphology within the Petroicidae is mostly conservative, circumscription of subfamilies and genera has been challenging (Boles, 1979). Nonetheless, Schodde and Mason (1999’s) review of Petroicidae has been widely accepted (Higgins and Peter, 2002; Boles, 2007; Christidis and Boles, 2008). They introduced three subfamilies based on characters of osteology, plumage, and egg coloration and patterning. Eopsaltriinae comprises nine closely related Australo-Papuan robin genera (Schodde and Mason, 1999) in two groups (Poecilodryas–Peneothello–Peneoenanthe and Eopsaltria–Melanodryas); a further genus, Tregellasia, is of uncertain placement with respect to these groups. Petroicinae comprises the genera Monachella, Microeca, Eugerygone and Petroica; Pachycephalopsis was provisionally included by Schodde and Mason (1999) and Boles (2007). Drymodinae comprises Amalocichla and Drymodes. Their terrestrial, ground-nesting habits, unique in the family, have led to many morphological adaptations that still obscure their correct systematic placement. Indeed, Drymodes was only placed within the family after DNA–DNA hybridisation studies
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219
(Sibley and Ahlquist, 1982). The taxonomic position of Amalocichla is even more poorly understood (Boles, 2007). At the species-level, systematic placements of two species, the mangrove robin (Peneoenanthe pulverulenta) and the yellow-bellied robin (Eopsaltria flaviventris) have been particularly debated. P. pulverulenta is currently in a monospecific genus, but has previously been placed in a number of other genera (Eopsaltria, Poecilodryas, Quoyornis, Pachycephala) and even families (Pachycephalidae, Laniidae) (Gould, 1869; Hartert, 1905; Mathews, 1912, 1914). Its affinities are still uncertain and Peneoenanthe has been retained for convenience. E. flaviventris is endemic to New Caledonia and it is currently the only Eopsaltria species outside Australia. Its current placement in Eopsaltria is primarily due to its similarities in plumage to E. griseogularis, the western yellow robin of southern Australia (Ford, 1979). Its distinctive plumage, egg morphology and behavior, however, suggest an affinity to Petroicinae (Boles, 2007). We had two primary aims. Based on the most thorough taxonomic and molecular sampling of the family to date, we sought to provide the first detailed molecular phylogeny for the members of the Petroicidae. This builds on the few earlier molecular studies, which were either partial studies of one genus, Petroica (Miller and Lambert, 2006) or broad DNA–DNA hybridization and allozyme studies with limited taxon sampling (Sibley and Ahlquist, 1985; Christidis and Schodde, 1991). With this phylogeny we sought to clarify the subfamilial structure and relationships of the problematic species mentioned above. Based on our results we propose new taxonomic arrangements at both the species and subfamily levels and comment on the biogeography of this controversial group.
2. Materials and methods 2.1. Taxonomic sampling Tissue samples were obtained from 46 petroicid specimens that represented 10 genera and 25 species in the three nominal subfamilies. No tissues were located from Amalocichla, Monachella or Eugerygone, all of which are endemic to New Guinea (but we are now separately examining singletons of Amalocichla and Eugerygone that have been since located). Sampling of four of the Australian genera (Eopsaltria, Tregellasia, Melanodryas, Peneoenanthe) includes all currently recognized species, with excellent coverage for a further six genera. The rufous fieldwren Calamanthus campestris (Passeriformes: Acanthizidae) of Australia was used as an outgroup. Full details of collection localities and voucher information for each individual are given in Table 1. Sequences have been lodged in GenBank (Accession Nos. FJ976470–FJ976515; GQ120568–GQ120612; GQ148564–GQ1486493). 2.2. Choice of phylogenetic markers One mitochondrial DNA (mtDNA) gene (ND2) and three nuclear DNA (nDNA) loci (C-myc and two introns) were sequenced to provide multiple, independent datasets (Table 2). ND2 is used extensively in many avian phylogenetic studies and its use permits comparisons against other studies in relative levels of divergence (Sorenson et al., 1999; Zink and Barrowclough, 2008). The nuclear gene C-myc possesses a higher number of variable sites relative to other commonly used nDNA markers such as RAG-1 and RAG-2 (Treplin et al., 2008). Inclusion of C-myc also allows the absence of the three base pair insertion, diagnostic for the Passerida, to be comprehensively tested for the family. Primers for the two introns BA20454 and BA23989 (=B4 and B5, respectively, for brevity) were from Backström et al. (2008).
213
2.3. Molecular protocols All tissues, which primarily were heart and liver, had been cryofrozen but transferred to 70% ethanol immediately prior to transport to the laboratory for DNA extraction. Following genomic DNA extraction, PCR amplification was carried out in a Corbett PC-960C cooled thermal cycler, and negative controls were run with all amplifications. Loci were amplified using primers in Table 1 with PCR conditions from the respective primer sources. All amplifications produced a single band. Sequencing followed Pepper et al. (2006). Sequences were edited and assembled using Sequencher 4.8 (Genes Codes Corporation) and aligned in ClustalX (Thompson et al., 1997). Protein-coding regions of ND2 were translated into amino acid sequences using the vertebrate mitochondrial genetic code. No unexpected stop codons were observed. 2.4. Phylogenetic analyses Individual data sets were created for each of the four loci. For each, unweighted heuristic parsimony analyses were implemented in PAUP (Swofford, 2002) to derive overall assessment of relative levels of divergence and to assess consistency between the loci. Two sets of partitioned Bayesian analyses were performed on the combined four loci data set in MrBayes (v3.0b4: Huelsenbeck and Ronquist, 2001). The first used four partitions, one for each locus, and the second included three additional partitions for first, second and third codon positions of ND2. Results for both Bayesian analyses were highly consistent with each other and we only report the former. The default value of four Markov chains per run was used and the full analysis was run twice to ensure that overall tree-space was well sampled and to avoid the analysis becoming trapped in local optima. Each analysis ran for a total of 4,000,000 generations and the chain was sampled after every 100 generations. This resulted in 40,000 sampled trees. Log-likelihood values reached a plateau after approximately 100,000 generations (1000 sampled trees). The first 10,000 trees were discarded, leaving the last 30,000 trees to estimate Bayesian posterior probabilities. A maximum likelihood value was calculated for the partitioned Bayesian analysis tree. This tree was then manipulated to form a series of constraint trees that were consistent with various a priori systematic hypotheses, such as monophyly of subfamilies or genera (Table 3). The statistical difference between our best tree and the constrained threes was then evaluated with Kishino–Hasegawa tests in PAUP. 2.5. Molecular dating of avian lineages using mitochondrial data ‘Clock-like’ mutation rate of genes have been used to investigate divergence times (Päckert et al., 2007; Morgan et al., 2007), biogeographical regions (Weir and Schluter, 2004) and speciation-extinction rates (Barraclough and Vogler, 2002). Calibration of these rates, which are usually based on dates from fossil evidence or dated tectonic events, is not available for the Petroicidae. A ‘universal’ clock of 2% sequence divergence per million years (mya) has been used often for animal mitochondrial genomes, especially in birds, which have a poor fossil record (García-Moreno, 2004). Transferring rates between lineages has been controversial, as the consistency of molecular clocks across different groups is disputed (Arbogast et al., 2002; Ho et al., 2005). However, a recent review of all existing calibrated avian molecular clocks argued that 2% per Ma based on the mtDNA gene cytochrome b is an excellent estimation of divergence rates across 10 avian orders (Weir and Schluter, 2008). Given the strong linkage between mtDNA genes and similar mutation rates observed in mtDNA loci (Arbogast et al., 2002), we have applied the rate of 2% per Ma to our analysis
214
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219
Table 1 Summary details of specimens studied. Except where indicated with an asterisk, all specimens are from the Australian National Wildlife Collection (ANWC) where more locality details are databased. *Kansas University Natural History Museum. In addition to standard geographical direction identifiers (e.g., NW, northwest) abbreviations used are as follows: D., Drymodes; E., Eopsaltria; T., Tregellasia; Mel., Melanodryas; Mic., Microeca; Pach., Pachycephalopsis; Peneon., Peneonanthe; Peneoth., Peneothello; Pet., Petroica; Poec., Poecilodryas; ACT, Australian Capital Territory; NSW, New South Wales; NT, Northern Territory; QLD, Queensland; SA, South Australia; TAS, Tasmania; VIC, Victoria; WA, Western Australia; NA, not available. Species
Code in Figs. 1 and 2
Specimen
State/province
Locality
Latitude (°S)
Longitude (°E)
D. brunneopygia E. australis E. australis E. australis E. australis E. australis E. australis E. australis E. australis E. australis E. australis E. australis E. australis E. georgiana E. georgiana E. georgiana E. georgiana E. georgiana E. georgiana E. georgiana E. griseogularis E. griseogularis E. griseogularis T. (E.) capito T. (E.) leucops Mel. cucullata Mel. vittata Mic. flaviventris Mic. fascinans Mic. flavigaster Mic. griseoceps Pach. poliosoma Peneon. pulverulenta Peneoth. bimaculata Peneoth. cyanus Peneoth. cyanus Peneoth. sigillatus Peneoth. sigillatus Pet. boodang Pet. goodenovii Pet. phoenicea Pet. rodinogaster Pet. rosea Poec. albispecularis Poec. cerviniventris Poec. superciliosa
113 Eop1 Eop17 Eop18 Eop2 Eop22 Eop29 Eop30 Eop33 Eop43 Eop54 Eop62 Eop65 Eop66 Eop67 Eop68 Eop69 Eop70 Eop71 Eop73 Eop75 Eop78 Eop88 104 109 93 112 114 99 102 110 120 95 115 116 117 118 119 103 100 107 111 108 106 101 105
49642 20524 43452 43453 29209 44023 44878 44929 44962 45213 46301 49187 49256 29192 31892 31893 31902 31906 31918 31959 29153 29171 48353 28847 42925 49965 45368 5115 20844 28440 42929 * 7069 31369 * 12898 * 7899 * 12921 * 4574 * 4599 28761 20858 32014 44994 32208 31379 28435 31269
NSW QLD QLD QLD NSW NSW VIC VIC VIC NSW NSW NSW NSW WA WA WA WA WA WA WA WA WA SA QLD QLD SA TAS — QLD NT QLD Oro QLD Chimbu Sandaun E. Highlands Morobe Morobe SA QLD ACT VIC ACT QLD NT QLD
ca30 km SE Mount Hope Blackdown Tableland Kroombit Tops Kroombit Tops ca10 km W Wollongong Between Araluen and Braidwood ca10 km NW Bruthen Noojee State Forest 14 km SW Lavers Hill 22 km E Tenterfield ca30 km SW Newcastle ca10 km E Mangoplah ca35 km Ne Dubbo ca19 km NW Albany Brockman State Forest Brockman State Forest Brockman State Forest Brockman State Forest Brockman State Forest ca25 km SE Margaret River ca9 km SE Mt Barker ca10 SW Mt Barker 10 km S Yardea ca27 km S Atherton Eastern McIlwraith Range 21 km W Coonalpyn ca12 km N Gladstone New Caledonia ca2 km E Jackson Oilfields 49 km S Adelaide River Eastern McIwraith Range Mt Suckling Daintree River Estuary 10 km SSE Haia Mt. Stolle 10.7 km NW Herowana airstrip 14.2 km SSE Teptep 14.2 km SSE Teptep Myponga Reservoir 10 km E Nockatunga Brindabella Range 3 km E Beechforest Canberra Mt Lewis 50 km S Adelaide River ca24 km S Townsville
32.96 23.82 24.41 24.41 34.42 35.58 37.70 37.89 38.75 29.09 33.02 35.40 32.01 34.90 34.46 34.46 34.51 34.46 34.46 34.08 34.69 34.68 32.43 17.45 13.83 35.68 40.91 NA 27.68 13.51 13.83 NA 16.28 NA NA NA NA NA 35.40 27.73 35.38 38.64 35.26 16.58 13.51 19.40
146.11 149.07 151.04 151.04 150.78 149.80 147.78 145.89 143.27 152.26 151.43 147.35 148.90 117.87 116.11 116.11 116.10 116.11 116.11 115.22 117.72 117.58 135.45 145.48 143.47 139.61 147.95 NA 142.41 131.29 143.46 NA 145.42 NA NA NA NA NA 138.44 142.88 148.81 143.70 149.12 145.27 131.30 146.99
3. Results Table 2 Primers used in this study. Loci
Primer
Sequence 50 –30
Reference
ND2 ND2 ND2 ND2 C-myc C-myc C-myc C-myc 20454 20454 23989 23989
H6315 L5215 L6313 H5143 mycEX3A R mycEX3A mycEX3D RmycEX3D 20454 R20454 23989 R23989
TTCTACTTAAGGCTTTGAAGGC TATCGGGCCCATACCCCGAAAAT GCGGCTGAATAGGACTGAAC ATTTGGGGAGAAAGCCTGTT CAAGAAGAAGATGAGGAAAT TTAGCTGCTCAAGTTTGTG GAAGAAGAACAAGAAGAAGATG ACGAGAGTTCCTTAGCTGCT GTCCTGTGCCTTGTGTATGA CATCTCACAGTATTCCAGGC AGCGTTGGAGCTTTCTTCAT TTCAACCCAAGATTCATTCC
Kirchman et al. (2001) Hackett (1996) Sorenson et al. (1999) Sorenson et al. (1999) Ericson et al. (2000) Ericson et al. (2000) Ericson et al. (2000) Ericson et al. (2000) Backström et al. (2008) Backström et al. (2008) Backström et al. (2008) Backström et al. (2008)
of the Petroicidae, and we use uncorrected ‘p’ distances derived from ND2 sequence data to calculate preliminary estimates of divergence times (see also Arbogast et al., 2006).
The individual mtDNA and nDNA trees (Fig. 1) were highly concordant with the combined multi-gene (consensus) analysis (Fig. 2). Therefore, description of the phylogeny focuses on the combined multi-locus data set, with reference back to the individual trees where relevant differences are strongly supported. The edited alignment of ND2 comprised 1005 base pairs (bp) of which 51% were parsimony informative. B4 comprised 501 bp of which 17% were parsimony informative, B5 comprised 336 bp of which 12% were parsimony informative and C-myc comprised 528 bp of which 8% were parsimony informative. All species of Petroicidae lacked the 3 bp insertion in C-myc that diagnoses the Passerida. In total 2373 bp of sequence data were obtained for each specimen. The unweighted parsimony analyses and the parsimony bootstrap analyses for each individual gene tree are shown in Fig. 1 and a tree based on a combined analysis of the four loci is in Fig. 2. As expected, ND2 gave the most fully resolved gene tree and analyses of the nDNA data sets produced slightly more conservative topologies, but ones that are largely concordant with the ND2 tree.
215
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219
Table 3 Tests of alternative tree topologies consistent with alternative phylogenetic and taxonomic hypotheses. The ‘‘best” tree is the tree shown in Fig. 2 based on a partitioned Bayesian analysis of all four genes. A maximum likelihood value was calculated for this tree and then likelihood-based Kishino–Hasegawa tests of alterative arrangements were preformed as listed. P values for alternative hypotheses that could be rejected are in bold. Tree
ln L
Best tree 1. Monophyly of Eopsaltria I (E. australis, E. griseogularis, E. georgiana) 2. Monophyly of Eopsaltria II (E. australis, E. griseogularis, E. georgiana, E. flaviventris) 3. Monophyly of Paneothello by making Peneoenanthe the sister species 4. Monophyly of Microeca by making E. flaviventris the sister species 5. Monophyly of the three currently recognized subfamilies by making the Microeca/E. flaviventris clade sister to Petroica/ Pachycephalopsis clade
19087.29756
The combined analysis (Fig. 2) yielded three main clades with indicated posterior probabilities (PP): (I) – Petroica and Pachycephalopsis (97), (II) – Microeca (100) (including Eopsaltria flaviventris with PP = 100), (III) – Drymodes, Eopsaltria (excluding E. flaviventris), Tregellasia, Peneothello, Melanodryas and Poecilodryas (100). Clades I and II were consistently paraphyletic with respect to each other so we reject the monophyly of Petroicinae. All taxa within Clade III except Drymodes were united with PP = 100 in a strongly supported, monophyletic Eopsaltriinae. Clades II and III were strongly supported as sisters (PP = 100). Constraining the tree to retain monophyly of currently recognized subfamilies produced significantly (P = 0.030) longer trees. Topology testing showed trees constraining the species flaviventris to be within Eopsaltria were significantly longer (P = 0.001, Table 3). Within Eopsaltriinae and with flaviventris transferred to its strongly supported place within but not sister to Microeca (Table 3), the three species of Eopsaltria (E. australis, E. griseogularis, E. georgiana) were paraphyletic. This was because E. georgiana was sister to Tregellasia (Fig. 2, PP = 99). Topology testing on the consensus tree, however, could not reject monophyly of the three Australian Eopsaltria along with Tregellasia as their sister (P = 0.199, Table 3). Another clade in Eopsaltriinae comprised PeneoethelloPeneoenanthe-Melanodryas (PP = 100). Although monophyly of Peneothello was not supported (Fig. 2), joint constraints of monophyly of the sampled species of Peneothello with Peneonanthe pulverulenta and Melanodryas as sister taxa could not be rejected (p = 0.256). All genera previously ascribed to the Petroicinae were monophyletic, given that Microeca now includes New Caledonian flaviventris. The geographically widespread but morphologically conservative species of Petroica are monophyletic (PP = 100). Within Petroica, P. goodenovii, P. boodang and P. phoenicea form a wellsupported group (PP = 92) within which P. phoenicea is sister to P. goodenovii and P. boodang. Pairing of Petroica rosea and Petroica rodinogaster is slightly less supported (PP = 87). Petroica is wellsupported as sister to Pachycephalopsis poliosoma (PP = 97). Genetic distances between sampled Petroica spp. were relatively high for avian intrageneric comparisons, however, and ranged from 7.4% to 10% for ND2. Poecilodryas was monophyletic within Clade III (PP = 100) and within it the Australian species P. cerviniventris and P. superciliosa are strongly supported as sisters (PP = 100). Poecilodryas albispecularis is sister to this pair. The highest distances between species (>25%) were between Drymodes brunneopygia, Microeca fascinans, and the Petroica species boodang, phoenicea, rosea and rodinogaster. Using calibration suggested by Weir and Schluter (2008), we estimate divergence times among Drymodes and these other species of 12–13 million years ago (mya). 4. Discussion We used multiple independent loci and the most comprehensive taxon sampling of the family Petroicidae (Aves: Passeriformes)
Difference ln L
P value ()
10.60365 358.52398 7.48690 45.30394 26.70982
0.199 0.001 0.256 .002 0.030
to date to develop the first phylogenetic analysis of the family and to test existing systematic arrangements of taxa within it. We acknowledge that we have not rigorously tested the family’s monophyly but the issue is not in contention (Schodde and Mason, 1999). We address this elsewhere in a separate study for which taxon sampling has extended beyond the Petroicidae. Currently recognized subfamilies and genera find mixed support in our analysis. Notably, nuclear and mitochondrial data sets were consistently concordant in determining major groupings within the Petroicidae as well as confidently aligning ‘‘Eopsaltria” flaviventris with Microeca and not Eopsaltria. Further, strongly supported novel relationships emerged for a long problematic species the mangrove robin Peneoenanthe pulverulenta of tropical northern Australia. We first consider the intrafamilial relationships and then turn to generic and species-level issues not resolved by our nuclear and mitochondrial data. 4.1. Intrafamilial groupings Overall at the subfamily level, our findings suggest limitations to morphological characters used in diagnosis of subfamilies. We reject monophyly of Petroicinae because Microeca and Petroica are consistently paraphyletic with respect to each other. We agree with Boles (2007) that recognition of further divisions within it is warranted. One such division would comprise only Microeca (expanded to include the species formerly known as Eopsaltria flaviventris). In accordance with Article 11.7 of International Commission on Zoological Nomenclature (1999), we propose the new subfamily name, Microecinae. The other division is Petroicinae and would comprise Petroica and Pachycephalopsis. Monachella and Eugerygone, both of which are monotypic and incertae sedis, likely belong in either of these subfamilies but need to be included in later analyses to clarify their position. Further testing of the affinities of Pachycephalopsis poliosoma is warranted to clarify its subfamilial placement. Excluding the species flaviventris, which we discuss further below, we found strong support for monophyly of Eopsaltriinae (Eopsaltria, Tregellasia, Peneothello, Peneonathe, Melanodryas and Poecilodryas). Further subdivision (Schodde and Mason, 1999), however, is not consistently supported by our analysis. The third subfamily, Drymodinae, remains of uncertain affinity. We could only sample one of its two genera, Drymodes and so can only support continued provisional recognition of Drymodinae. We found no evidence suggesting that it is nested in any other subfamilial grouping we recognize. 4.2. Generic and species-level findings One of our most unexpected findings was that in all trees Eopsaltria (E. australis, E. griseogularis, E. georgiana and E. flaviventris) is paraphyletic because of the placements of E. georgiana and E. flaviventris. That E. flaviventris, the yellow-bellied robin of New
216
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219 Eop043.Eopsaltria australis B4 Eop054.Eopsaltria australis Eop022.Eopsaltria australis Eop029.Eopsaltria australis Eop033.Eopsaltria australis Eop030.Eopsaltria australis Eop062.Eopsaltria australis Eop001.Eopsaltria australis Eop017.Eopsaltria australis Eop021.Eopsaltria australis Eop065.Eopsaltria australis Eop018.Eopsaltria australis Eop075.Eopsaltria griseogularis Eop078.Eopsaltria griseogularis Eop088.Eopsaltria griseogularis Eop069.Eopsaltria georgiana Eop073.Eopsaltria georgiana Eop066.Eopsaltria georgiana Eop067.Eopsaltria georgiana Eop068.Eopsaltria georgiana Eop070.Eopsaltria georgiana Eop071.Eopsaltria georgiana 104.Tregellasia capito 109.Tregellasia leucops 116.Peneothello cyanus 117.Peneothello cyanus 118.Peneothello sigillatus 119.Peneothello sigillatis 095.Peneoenanthe pulverulenta 093.Melanodryas cucullata 112.Melanodryas vittata 115.Peneothello bimaculata 101.Poecilodryas cerviniventris 105.Poecilodryas superciliosa 113.Drymodes brunneopygia 106.Poecilodryas albispecularis 099.Microeca fascinans 102.Microeca flavigaster 114.Eopsaltria flaviventris 110.Microeca griseoceps 103.Petroica boodang 107.Petroica phoenicea 108.Petroica rosea 111.Petroica rodinogaster 100.Petroica goodenovii 120.Pachycephalopsis poliosoma 006.Calamanthus campestris
ND2
10 changes
B5
Eop022.Eopsaltria australis Eop033.Eopsaltria australis Eop054.Eopsaltria australis Eop029.Eopsaltria australis Eop030.Eopsaltria australis Eop043.Eopsaltria australis Eop065.Eopsaltria australis Eop088.Eopsaltria griseogularis Eop075.Eopsaltria griseogularis Eop078.Eopsaltria griseogularis Eop001.Eopsaltria australis Eop017.Eopsaltria australis Eop018.Eopsaltria australis Eop021.Eopsaltria australis Eop062.Eopsaltria australis Eop067.Eopsaltria georgiana Eop068.Eopsaltria georgiana Eop069.Eopsaltria georgiana Eop066.Eopsaltria georgiana Eop070.Eopsaltria georgiana Eop071.Eopsaltria georgiana Eop073.Eopsaltria georgiana 104.Tregellasia capito 109.Tregellasia leucops 116.Peneothello cyanus 117.Peneothello cyanus 095.Peneoenanthe pulverulenta 115.Peneothello bimaculata 093.Melanodryas cucullata 118.Peneothello sigillatus 119.Peneothello sigillatis 112.Melanodryas vittata 101.Poecilodryas cerviniventris 105.Poecilodryas superciliosa 106.Poecilodryas albispecularis 113.Drymodes brunneopygia 099.Microeca fascinans 102.Microeca flavigaster 110.Microeca griseoceps 114.Eopsaltria flaviventris 103.Petroica boodang 111.Petroica rodinogaster 107.Petroica phoenicea 108.Petroica rosea 100.Petroica goodenovii 120.Pachycephalopsis poliosoma 006.Calamanthus campestris 5 changes
Eop001.Eopsaltria australis Eop017.Eopsaltria australis Eop018.Eopsaltria australis Eop021.Eopsaltria australis Eop022.Eopsaltria australis Eop030.Eopsaltria australis Eop067.Eopsaltria georgiana Eop068.Eopsaltria georgiana Eop075.Eopsaltria griseogularis Eop078.Eopsaltria griseogularis Eop088.Eopsaltria griseogularis 116.Peneothello cyanus 117.Peneothello cyanus Eop073.Eopsaltria georgiana 112.Melanodryas vittata 104.Tregellasia capito 109.Tregellasia leucops Eop029.Eopsaltria australis Eop033.Eopsaltria australis Eop043.Eopsaltria australis Eop062.Eopsaltria australis Eop065.Eopsaltria australis Eop066.Eopsaltria georgiana Eop069.Eopsaltria georgiana Eop070.Eopsaltria georgiana Eop071.Eopsaltria georgiana 093.Melanodryas cucullata 115.Peneothello bimaculata 118.Peneothello sigillatus 119.Peneothello sigillatis Eop054.Eopsaltria australis 095.Peneoenanthe pulverulenta 101.Poecilodryas cerviniventris 105.Poecilodryas superciliosa 106.Poecilodryas albispecularis 099.Microeca fascinans 102.Microeca flavigaster 114.Eopsaltria flaviventris 110.Microeca griseoceps 113.Drymodes brunneopygia 100.Petroica goodenovii 103.Petroica boodang 108.Petroica rosea 107.Petroica phoenicea 111.Petroica rodinogaster 120.Pachycephalopsis poliosoma 006.Calamanthus campestris
1 change
Eop029.Eopsaltria australis Eop030.Eopsaltria australis Eop001.Eopsaltria australis Eop017.Eopsaltria australis Eop033.Eopsaltria australis Eop054.Eopsaltria australis Eop065.Eopsaltria australis Eop075.Eopsaltria griseogularis Eop078.Eopsaltria griseogularis Eop088.Eopsaltria griseogularis Eop022.Eopsaltria australis Eop062.Eopsaltria australis Eop043.Eopsaltria australis Eop066.Eopsaltria georgiana Eop073.Eopsaltria georgiana Eop067.Eopsaltria georgiana Eop068.Eopsaltria georgiana Eop069.Eopsaltria georgiana Eop070.Eopsaltria georgiana Eop071.Eopsaltria georgiana Eop018.Eopsaltria australis Eop021.Eopsaltria australis 104.Tregellasia capito 109.Tregellasia leucops 118.Peneothello sigillatus 119.Peneothello sigillatis 115.Peneothello bimaculata 116.Peneothello cyanus 117.Peneothello cyanus 106.Poecilodryas albispecularis 112.Melanodryas vittata 093.Melanodryas cucullata 095.Peneoenanthe pulverulenta 101.Poecilodryas cerviniventris 105.Poecilodryas superciliosa 113.Drymodes brunneopygia 099.Microeca fascinans 102.Microeca flavigaster 110.Microeca griseoceps 114.Eopsaltria flaviventris 103.Petroica boodang 107.Petroica phoenicea 108.Petroica rosea 100.Petroica goodenovii 111.Petroica rodinogaster 120.Pachycephalopsis poliosoma 006.Calamanthus campestris 1 change
C-Myc
Fig. 1. Individual parsimony gene trees for each of the four loci used in this study.
Caledonia, should be transferred to Microeca was one of the most strongly supported results of our study. It has been traditionally as-
signed to Eopsaltria due to similarities of plumage coloration with southern Australian E. griseogularis (Ford, 1979). Its position has
217
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219
Current Classification
Proposed Classification
Eop030. Eopsaltria australis Eop062 Eopsaltria australis Eop029 Eopsaltria australis Eop043 Eopsaltria australis
100
Eop054 Eopsaltria australis Eop022 Eopsaltria australis
87
Eop033 Eopsaltria australis Eop001 Eopsaltria australis Eop065 Eopsaltria australis
100
Eop017 Eopsaltria australis
100
Eop02 Eopsaltria australis
50 changes
Eop018 Eopsaltria australis
100
Eop075 Eopsaltria griseogularis Eop078 Eopsaltria griseogularis Eop088 Eopsaltria griseogularis
100
Eop067 Eopsaltria georgiana Eop068 Eopsaltria georgiana Eop069 Eopsaltria georgiana Eop070 Eopsaltria georgiana
100
Eop066 Eopsaltria georgiana Eop071 Eopsaltria georgiana
100
104 Tregellasia capito
Moved to Eopsaltria
109 Tregellasia leucops 116 Peneothello cyanus
100 80
117 Peneothello cyanus 095 Peneoenanthe pulverulenta
99
118 Peneothello sigillatus
100
100 57
100
119 Peneothello sigillatus 115 Peneothello bimaculata
Clade III
100
093 Melanodryas cucullata
100
112 Melanodryas vittata
100
101 Poecilodryas cerviniventris
100
105 Poecilodryas superciliosa 106 Poecilodryas albispecularis
100
113 Drymodes brunneopygia 099 Microeca fascinans
100
Clade II
100
Subfamily Drymodinae
102 Microeca flavigaster
100
114 Eopsaltria flaviventris
100 92
97
100
100 Petroica goodenovii 103 Petroica boodang 107 Petroica phoenicea
87
108 Petroica rosea 111 Petroica rodinogaster
Subfamily Drymodinae Subfamily Microecinae Moved to Microeca
110 Microeca griseoceps
Clade I
Subfamily Eopsaltriinae
Eop073 Eopsaltria georgiana
99 100
Subfamily Eopsaltriinae
Subfamily Petroicinae Subfamily Petroicinae
120 Pachycephalopsis poliosoma 006 Calamanthus campestris
Fig. 2. Molecular phylogeny for the Family Petroicidae based on a combined analysis of four genes including the mtDNA gene ND2 and the nuclear loci B4 and B5 (see Section 2 and C-myc (total of 2373 base pairs)). The phylogeny is based on a partitioned Bayesian analysis where each gene represented one partition, see text for details. Values on branches are Bayesian posterior probabilities and a parsimony scale bar is shown to illustrate branch lengths.
been questioned based on geographical distance between New Caledonia and E. griseogularis in southern Australia and the limited dispersal abilities of co-operative breeding Eopsaltria (Cockburn, 2003). Based on egg coloration and juvenal plumage, Boles (2007) suggested that its affinities lie with Microeca. Cursory morphological examination of specimens by one of us (LJ) at the Australian Museum, Sydney support Boles (2007): the species is an unremarkable member of Microeca closely resembling M. flavigaster and M. griseoceps with which it was consistently and strongly aligned in our analysis. Given the agreement between our molecular data and morphology, we recommend that this species now be called Microeca flaviventris. Erroneous placement in Eopsaltria was a result of misinterpreting the presumably homoplastic plumage pattern of yellow and grey underparts. The wide geographical range of Microeca includes the tropics of Australia and New Guinea and M. flaviventris is also an unexceptional Microeca in these terms.
Finally, Microeca comprises mostly pair breeders, as M. flaviventris is believed to be (Boles, 2007). Moving flaviventris to Microeca renders Eopsaltriinae monophyletic and obviates the anomaly of a single pair breeder in otherwise co-operatively breeding Eopsaltria (Edwards and Naeem, 1993; McLennan and Brooks, 1993). Using conventional estimates of the rate of mtDNA evolution (Weir and Schluter, 2008) we suggest that M. flaviventris differentiated from both M. flavigaster and M. fascinans approximately 8 mya. Next, we found that E. georgiana was unexpectedly and consistently more closely related to the two species of Tregellasia than to E. australis and E. griseogularis. Although we could not reject monophyly of these three species of Eopsaltria, this result signals a need for closer systematic and biogeographic study. Non-monophyly of the three Australian Eopsaltria has never been explicitly suggested although E. georgiana has been placed in monotypic Quoyornis. It would profoundly affect how the evolution of E. georgiana, a re-
218
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219
stricted range endemic species of south-western Western Australia, is to be interpreted. Tregellasia has been synonymized with Eopsaltria based on shared ventral yellow plumage (Keast, 1958; Ford, 1971) and DNA–DNA hybridization studies (Sibley and Monroe, 1990). E. georgiana, on the other hand, is the only Eopsaltria that lacks any yellow in its plumage and has never been linked with yellow-plumaged Tregellasia. Tregellasia and E. georgiana have restricted ranges in different habitats at opposite ends of the Australo-Papuan region. T. capito (pale-yellow robin) has two isolated populations in subtropical and tropical rainforests on the central and northern coasts of eastern Australia. T. leucops (white-faced robin), also of tropical rainforests, occurs in northern Australia only as an isolated population on Cape York Peninsula and is more widespread in New Guinea. E. georgiana, in contrast, occurs in moist thickets and gullies in sclerophyll forests of south-western Western Australia (Boles, 2007). Common to all three, however, is facultative co-operative breeding. This behavior has been hypothesized to have a limiting effect on dispersal (Arnold and Owens, 1998; Cockburn, 2003; Heinsohn and Double, 2004). Their close relationship in our analysis suggests a novel historical biogeography of this group. The most expedient taxonomic corollary of our findings is to expand the older name Eopsaltria Swainson, 1832 to include Tregellasia Mathews, 1912. We nonetheless urge further study of the relationships among these five species. E. australis and E. griseogularis were strongly supported as vicariant sister taxa that replace each other in the east and west of Australia, respectively. Considered conspecific by Ford (1979) because of morphological, plumage and behavioral similarities, the two are geographically isolated from each other and show substantial net genetic divergence of approximately 6–8%. We support species-level status for them (Schodde and Mason, 1999). Remarkably, we found greater than 5% divergence between two haplogroups within E. australis. We examine this result more closely elsewhere (Loynes et al., in preparation). Within Poecilodryas, our analysis is consistent with Schodde and Mason’s (1999) subgeneric assignment by morphology of the sister pair P. cerviniventris and P. superciliosa to subgenus Poecilodryas and their sister, P. albispecularis, to subgenus Heteromyias (Schodde and Mason, 1999). Heteromyias has previously been allied with Peneothello (Sibley and Monroe, 1990) and Pachycephalopsis (Mayr, 1986). Close relationship between P. superciliosa and P. cerviniventris is consistent with their being vicariant replacements of each other across the Gulf of Carpentaria. Though closely related, they are 9% divergent from each other for ND2. This is certainly consistent with their current recognition as separate species (Schodde and Mason, 1999; Boles, 2007; Christidis and Boles, 2008). Our sample of P. (H). albispecularis is from the Australian isolate P. (H). a. cinereifrons. It has been proposed that cinereifrons be raised to species-level (Keast, 1958; Christidis and Boles, 2008). We could not sample the New Guinean subspecies of P. (H). albispecularis. A final clade within Eopsaltriinae contains all members of Melanodryas, Peneoenanthe and the three sampled species of Peneothello. This group ranges throughout most of Australo-Papua including Tasmania. Within it, the two species of Melanodryas are the most closely related. Their genetic distance for ND2 (3.3%) is the lowest distance between any two species in this study. Again using Weir and Schluter (2008), we suggest that they diverged approximately 1.65 mya. The Tasmanian endemic M. vittata (dusky robin) is sexually monomorphic and has the duller, female plumage of sexually dichromatic and widespread mainland Australian species M. cucullata (hooded robin). Close relationship between these two species has long been accepted (Keast, 1958). Melanodryas was synonymised with Petroica by Keast (1958), but reinstated by Schodde (1975). Close relationship between Melanodryas and Eopsaltria has been suggested (Schodde and Mason, 1999; Boles, 2007). Our analysis clearly rejects all of these arrangements and
shows Melanodryas has affinities with Peneothello and Peneoenanthe, an arrangement that has not been proposed previously. Monophyly of Peneothello, which comprises four species, has never been tested. Our analysis finds no strong support for it. The three Peneothello species that we sampled are all broadly sympatric, having disjunct distributions in the highlands of New Guinea. Species-level relationships among the three we sampled and with respect to a fifth species Peneoenanthe pulverulenta (mangrove robin) of coastal northern Australia and New Guinea were inconsistently recovered in our analyses. Relationships and generic placement of Peneoenanthe pulverulenta have been among the most unstable of the entire family. Its association with Peneothello and Melanodryas that we found has not previously been proposed. Affinities have been suggested between it and Poecilodryas and Eopsaltria (Mayr, 1941; Schodde, 1975; Schodde and Mason, 1999; Christidis and Boles, 1994), or it has been left incertae sedis in monospecific Peneonanthe (Keast, 1958; Noske, 1978; Schodde and Mason, 1999). Placement in Eopsaltria has been argued on the basis of close resemblance in plumage color and pattern to E. georgiana (Schodde, 1975). We have discussed E. georgiana above and found no close relationship between it and Peneoenanthe pulverulenta. Their similarity in plumage is presumably again homoplastic. We advocate retention of Peneonanthe until a further analysis is done with complete taxon sampling in Peneothello. Within the entire family, robins of the genus Petroica are widely dispersed from small mid-Pacific Ocean islands to New Zealand and the west of Australia. Some species also disperse widely or are even migratory. Expanding Miller and Lambert’s (2006) study of the New Zealand members of Petroica, we find robust support for Petroica’s monophyly, which has been uncontentiously assumed based on conservative plumage and morphology. Boles (2007) introduced two informal subdivisions, which are partly supported here. The two pink plumaged robins, P. rosea (rose robin) and P. rodinogaster (pink robin), are sister taxa in our analysis, as Boles suggested. We could not test his grouping of New Zealand, Pacific Ocean and Australian species because only Australian Petroica species were available to us. Among the taxa we sampled, P. boodang (scarlet robin) is sister to P. phoenicea (flame robin), which Boles placed outside his other Petroica groupings. P. phoenicea, P. boodang, P. rodinogaster and P. rosea all share breeding ranges in the southeast corner of Australia. Further, P. boodang and P. phoenicea share breeding sites and directly compete for food (Robinson, 1992). Sympatry of closely related species of Australian birds is uncommon, and most sympatric species are less closely related to each other than they are to parapatric species (Cracraft, 1982; see Norman et al., 2007 for examples in Meliphagidae).Uniquely within the entire family, these species of Petroica are all strongly sexually dimorphic and show interspecific aggression during the breeding season (Robinson, 1989), perhaps relying on territoriality and male plumage as isolating mechanisms. In our analyses, all but B5, the slowest evolving locus, strongly distinguished the species of Petroica. This is consistent with the absence of hybridization, although a more detailed population analysis of these species could be warranted. Acknowledgments We acknowledge our debt to permit-granting agencies and collectors for availability of the specimens we have used. For diverse help with laboratory analyses, sampling and discussions we thank Lindell Bromham, Renee Catullo, Andrew Cockburn, Danielle Edwards, Geoff Kay, David Moore, Mitzy Pepper and John Trueman (Australian National University), Gaynor Dolman, Ian Mason and Robert Palmer (Australian National Wildlife Collection), A.T. Peterson and Mark Robbins (Kansas University Natural History Museum), Gavin Hunt (University of Auckland), and Jonathon
K. Loynes et al. / Molecular Phylogenetics and Evolution 53 (2009) 212–219
Ekstrom (The Biodiversity Consultancy). J.S.K. thanks the Australian Research Council for ongoing support. An anonymous reviewer made helpful comments on the manuscript. References Arbogast, B.S., Edwards, S.V., Wakeley, J., Beerli, P., Slowinski, J.B., 2002. Estimating divergence times from molecular data on phylogenetic and population genetic timescales. Annu. Rev. Ecol. Evol. Syst. 33, 707–740. Arbogast, B.S., Drovetski, S., Curry, P., Boag, P., Seutin, G., Grant, P., Grant, R., Anderson, D., 2006. The origin and diversification of Galapagos mockingbirds. Evolution 60, 370–382. Arnold, K.E., Owens, I.P.F., 1998. Cooperative breeding in birds: a comparative test of the life history hypothesis. Proc. R. Soc. Lond. B 265, 739–745. Backström, N., Fagerberg, S., Ellegren, H., 2008. Genomics of natural bird populations: a gene-based set of reference markers evenly spread across the avian genome. Mol. Ecol. 17, 964–980. Barker, F.K., Cibois, A., Schikler, P., Feinstein, J., Cracraft, J., 2004. Phylogeny and diversification of the largest avian radiation. Proc. Natl. Acad. Sci. USA 101, 11040–11045. Barraclough, T.G., Vogler, A.P., 2002. Recent diversification rates in North American tiger beetles estimated from a dated mtDNA phylogenetic tree. Mol. Biol. Evol. 19, 1706–1716. Beresford, P., Barker, F.K., Ryan, P.G., Crowe, T.M., 2005. African endemics span the tree of songbirds (Passeri): molecular systematics of several evolutionary ‘enigmas’. Proc. R. Soc. Lond. B 272, 849–858. Boles, W.E., 2007. Family Petroicidae (Australasian robins). In: Del Hoyo, J., Elliot, A., Christie, D.A. (Eds.), Handbook of the Birds of the World. Volume 12: Picathartes to Tits and Chickadees. Lynx Edicions, Barcelona, pp. 438–467. Boles, W.E., 1979. The relationships of the Australo-Papuan flycatchers. Emu 79, 107–110. Christidis, L., Boles, W.E., 1994. The Taxonomy and Species of Birds of Australia and Its Territories. Royal Australasian Ornithologists’ Union, Melbourne. Christidis, L., Boles, W.E., 2008. Systematics and Taxonomy of Australian Birds. CSIRO Publishing, Melbourne. Christidis, L., Schodde, R., 1991. Relationships of the Australo-Papuan songbirds – protein evidence. Ibis 113, 277–285. Cockburn, A., 2003. Cooperative breeding in oscine passerines: does society inhibit speciation? Proc. R. Soc. Lond. B 270, 2207–2214. Cracraft, J., 1982. Geographic differentiation, cladistics, and vicariance biogeography: reconstructing the tempo and mode of evolution. Am. Zool. 22, 411–424. Edwards, S.V., Naeem, S., 1993. The phylogenetic component of cooperative breeding in perching birds. Am. Nat. 141, 754–789. Ericson, P.G.P., Johansson, U.S., Parsons, T.J., 2000. Major divisions in oscines revealed by insertions in the nuclear gene c-myc: a novel gene in avian phylogenetics. Auk 117, 1069–1078. Ericson, P., Christidis, L., Irestedt, M., Norman, J., 2002. Systematic affinities of the lyrebirds (Passeriformes: Menura), with a novel classification of the major groups of passerine birds. Mol. Phylogenet. Evol. 25, 53–62. Ford, J., 1971. Distribution, ecology and taxonomy of some Western Australian passerine birds. Emu 71, 102–120. Ford, J., 1979. Speciation or subspeciation in the yellow robins. Emu 79, 103–106. García-Moreno, J., 2004. Is there a universal MtDNA clock for birds? J. Avian Biol. 35, 465–468. Gould, J., 1869. Handbook to the Birds of Australia. John Gould, London. Hackett, S.J., 1996. Molecular phylogenetics and biogeography of tanagers in the genus Ramphocelus (Aves). Mol. Phylogenet. Evol. 5, 368–382. Hartert, E., 1905. List of birds collected in north-western Australia and Arnhem Land by Mr. J.T. Tunney. Novit. Zool. 12, 194–242. Heinsohn, R., Double, M.C., 2004. Cooperate or speciate: new theory for the distribution of passerine birds. TREE 19, 55–57. Higgins, P.J., Peter, J.M., 2002. Handbook of Australian, New Zealand and Antarctic Birds. Volume 6 – Pardalotes to Shrike-thrushes. Oxford University Press, Melbourne. Ho, S.Y.W., Phillips, M.J., Cooper, A., Drummond, A.J., 2005. Time dependency of molecular rate estimates and systematic overestimation of recent divergence times. Mol. Biol. Evol. 22, 1561–1568.
219
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. International Commission on Zoological Nomenclature, 1999. International Code of Zoological Nomenclature. International Trust for Zoological Nomenclature, London. Keast, A., 1958. Variation and speciation in the Australian flycatchers. Rec. Aust. Mus. 8, 73–108. Kirchman, J., Hackett, S., Goodman, S., Bates, J., 2001. Phylogeny and systematics of ground rollers (Brachypteraciidae) of Madagascar. Auk 118, 849–863. Mathews, G.M., 1912. A reference-list to the birds of Australia. Novitat. Zool. 18, 171–455. Mathews, G.M., 1914. Additions and corrections to my list of the birds of Australia. Austral. Avian Rec. 2, 83–107. Mayr, E., 1941. Birds collected during the Whitney South Sea Expedition. Am. Mus. Novit. 1133, 1–8. Mayr, E., 1986. Family Eopsaltriidae. In: Mayr, E., Cottrell, G.W. (Eds.), Check-list of Birds of the World. Museum of Comparative Zoology, Cambridge, Mass, pp. 556–583. McLennan, D.A., Brooks, D.R., 1993. The phylogenetic component of cooperative breeding in perching birds: a commentary. Am. Nat. 141, 790–795. Miller, H.C., Lambert, D.M., 2006. A molecular phylogeny of New Zealand’s Petroica (Aves: Petroicidae) species based on mitochondrial DNA sequences. Mol. Phylogenet. Evol. 40, 844–855. Morgan, M.J., Roberts, J.D., Keogh, J.S., 2007. Molecular phylogenetic dating supports an ancient endemic speciation model in Australia’s biodiversity hotspot. Mol. Phylogenet. Evol. 44, 371–385. Norman, J.A., Rheindt, F.E., Rowe, D.L., Christidis, L., 2007. Speciation dynamics in the Australo-Papuan Meliphaga honeyeaters. Mol. Phylogenet. Evol. 42, 80–91. Noske, R.A., 1978. Comments on some of the scientific names used in the Interim List of Australian Songbirds. Aust. Birds 13, 27–35. Päckert, M., Martens, J., Tietze, D.T., Dietzen, C., Wink, M., Kvist, L., 2007. Calibration of a molecular clock in tits (Paridae) – do nucleotide substitution rates of DNA mitochondrial deviate from the 2% rule? Mol. Phylogenet. Evol. 44, 1–14. Pepper, M., Doughty, P., Keogh, J.S., 2006. Molecular phylogeny and phylogeography of the Australian Diplodactylus stenodactylus (Gekkota; Reptilia) species-group based on mitochondrial and nuclear genes reveals an ancient split between Pilbara and non-Pilbara D. Stenodactylus. Mol. Phylogenet. Evol. 41, 539–555. Robinson, D., 1989. Interspecific aggression and territorial behavior between scarlet robin Petroica multicolor and flame robin P. phoenicea. Emu 89, 93–101. Robinson, D., 1992. Habitat use and foraging behaviour of the scarlet robin and the flame robin at a site of breeding-season sympatry. Wildl. Res. 19, 377–395. Schodde, R., 1975. Interim List of Australian Songbirds. Royal Australasian Ornithologists’ Union, Melbourne. Schodde, R., Mason, I.J., 1999. The Directory of Australian Birds. Passerines. CSIRO Publishing, Melbourne. Sibley, C.G., Ahlquist, J.E., 1982. The relationships of the Australo-Papuan scrubrobins Drymodes as indicated by DNA–DNA hybridization. Emu 82, 101–105. Sibley, C.G., Ahlquist, J.E., 1985. The phylogeny and classification of the AustraloPapuan passerine birds. Emu 85, 1–14. Sibley, C.G., Monroe, B.L., 1990. Distribution and Taxonomy of the Birds of the World. Yale University Press, New Haven. Sorenson, M.D., Ast, J.C., Dimcheff, D.E., Yuri, T., Mindell, D.P., 1999. Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates. Mol. Phylogenet. Evol. 12, 105–144. Swofford, D., 2002. PAUP. Phylogenetic Analysis using Parsimony (and other methods), Sinauer Associates, Sunderland. Thompson, J.D., Gibson, T.J., Plewniak, F., Jenmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Treplin, S., Siegert, R., Bleidorn, C., Thompson, H., Fotso, R., Tiedemann, R., 2008. Molecular phylogeny of songbirds (Aves: Passeriformes) and the relative utility of common nuclear marker loci. Cladistics 24, 328–349. Weir, J.T., Schluter, D., 2004. Ice sheets promote speciation in boreal birds. Proc. R. Soc. Lond. B 271, 1881–1887. Weir, J.T., Schluter, D., 2008. Calibrating the avian molecular clock. Mol. Ecol. 17, 2321–2328. Zink, R.M., Barrowclough, G.F., 2008. Mitochondrial DNA under siege in avian phylogeography. Mol. Ecol. 17, 2107–2121.