Multiple NADPH–cytochrome P450 reductases from Trypanosoma cruzi

Share Embed


Descrição do Produto

Molecular & Biochemical Parasitology 160 (2008) 42–51

Contents lists available at ScienceDirect

Molecular & Biochemical Parasitology

Multiple NADPH–cytochrome P450 reductases from Trypanosoma cruzi Suggested role on drug resistance ´ Patricio Portal, Silvia Fernandez Villamil, Guillermo D. Alonso, Matias G. De Vas, ´ Hector ´ Mirtha M. Flawia, N. Torres, Cristina Paveto ∗ Instituto de Investigaciones en Ingenier´ıa Gen´etica y Biolog´ıa Molecular, Consejo Nacional de Investigaciones Cient´ıficas y T´ecnicas and Departamento de Fisiolog´ıa, Biolog´ıa Molecular y Celular, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Vuelta de Obligado 2490, 1428 Buenos Aires, Argentina

a r t i c l e

i n f o

Article history: Received 27 December 2007 Received in revised form 12 March 2008 Accepted 13 March 2008 Available online 21 March 2008 Keywords: Cytochrome P450 reductase Trypanosoma cruzi Drug resistance

a b s t r a c t Cytochrome P450 hemoproteins (CYPs) are involved in the synthesis of endogenous compounds such as steroids, fatty acids and prostaglandins as well as in the activation and detoxification of foreign compounds including therapeutic drugs. Cytochrome P450 reductase (CPR, E.C.1.6.2.4) transfers electrons from NADPH to a number of hemoproteins such as CYPs, cytochrome c, cytochrome b5, and heme oxygenase. This work presents the complete sequences of three non-allelic CPR genes from Trypanosoma cruzi. The encoded proteins named TcCPR-A, TcCPR-B and TcCPR-C have calculated molecular masses of 68.6 kDa, 78.4 kDa and 71.3 kDa, respectively. Deduced amino acid sequences share 11% amino acid identity, possess the conserved binding domains for FMN, FAD and NADPH and differ in the hydrophobic 27-amino acid residues of the N-terminal extension, which is absent in TcCPR-A. Every T. cruzi CPRs, TcCPR-A, TcCPR-B and TcCPR-C, were cloned and expressed in Escherichia coli. All of the recombinant enzymes reduced cytochrome c in a NADPH absolutely dependent manner with low Km values for this cofactor. They all were also strongly inhibited by diphenyleneiodonium, a classical flavoenzyme inhibitor. In addition, TcCPRs could support CYP activities when assayed in reconstituted systems containing rat liver microsomes. Polyclonal antiserum rose against the recombinant enzymes TcCPR-A and TcCPR-B demonstrated its presence in every T. cruzi developmental stages, with a remarkable expression of TcCPR-A in cell-cultured trypomastigotes. Overexpression of TcCPR-B in T. cruzi epimastigotes increased its resistance to the typical chemotherapeutic agents Nifurtimox and Benznidazole. We suggest a participation of TcCPR-B in the detoxification metabolism of the parasite. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Molecular damage caused by a great diversity of unwanted endobiotic by-products or xenobiotics may lead to necrosis or apoptosis. Therefore, detoxification is critical for a proper function of the cell. The mechanism of detoxification involves two stages: phase 1 (functionalization reactions), which results in the addition of chemically reactive functional groups, thus allowing further metabolism of otherwise non-reactive, typically lipophilic compounds required for phase 2 (conjugative reactions), where the addition of side groups increase solubility, and thus aid excretion.

Abbreviations: CYP, cytochrome P450; CPR, cytochrome P450 reductase; DCIP, 2,6-dichloroindo phenol; DPI, diphenyleneiodonium; DTT, 1,4-dithio-dl-threitol; G6PD, glucose-6-phosphate dehydrogenase; NR1, human novel reductase; OYE, old yellow enzyme; GFP, green fluorescent protein. ∗ Corresponding author. Tel.: +54 11 4783 2871; fax: +54 11 4786 8578. E-mail address: [email protected] (C. Paveto). 0166-6851/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2008.03.007

Cytochrome P450s (CYPs) are major agents of phase 1 metabolism, which usually act by hydroxylation. CYPs must be restored to their reduced state by a P450 reductase in each catalytic cycle [1]. NADPH-dependent cytochrome P450 reductase (CPR, E.C.1.6.2.4) belongs to a large family of electron transfer flavoproteins that utilize both FAD and FMN as tightly bound prosthetic groups [2]. This family also includes a subunit of bacterial sulfite reductase [3] as well as nitric oxide synthases (NOS) [4,5]. CPRs catalyze the electron transfer from NADPH to cytochrome P450, heme oxygenase, cytochrome b5 and squalene epoxidase [6]. The various members of the CYP super family are involved in CPRsupported oxidative metabolism of a wide range of xenobiotics and endogenous compounds [7]. It has also been reported that CPR is the key factor of rate limitation for catalytic activities of CYPs [8]. In animals, a single CPR is known to interact with a number of different P450 enzymes [9]. However, multiple CPR isoforms with different molecular weights, regulation and subcellular localization have been characterized in higher plants [10].

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

Therefore, plants appear to deploy distinct CPR isoforms to meet high reductive demand for the P450-mediated reactions [11]. All CPRs present amino acid sequence similarities ranging from 30% up to 90% among bacteria, yeast, fungi, plants, invertebrates and vertebrates, being the binding domains of FMN, FAD and NADPH the highest conserved regions [12]. More recently, a novel cytoplasmic flavoprotein oxidoreductase (NR1) containing both FAD and FMN prosthetic groups and catalyzing NADPH-dependent reactions has been described in humans [13]. Interestingly, this enzyme resembles CPR sequence arrangement and structure but differs from CPR in lacking the amino-terminal membrane anchor. Although its function remains unclear, the enzyme appears widely expressed in human cancer cell lines and could therefore play a potential role in the activation (or deactivation) of drugs used in cancer therapy and cell death associated with one-electron reductions [14]. Although CYPs and CPRs have been intensively studied in a wide range of organisms, little research has been done in trypanosomatids. Trypanosoma cruzi is the protozoan parasite responsible for the American trypanosomiasis known as Chagas’ disease. Throughout its life cycle, this parasite is exposed to oxidative stress imposed by reactive oxygen species (ROS) derived from its own aerobic metabolism and from the host immune response. Agosin et al. [15] have demonstrated that both cytosolic and microsomal preparations from T. cruzi epimastigotes can hydroxylate p-nitroanisole and aniline and can demethylate aminopyrine, and that these reactions are inhibited by the P450 inhibitors carbon monoxide, proadifen and metirapone. Furthermore, these authors have described the purification and kinetic characterization of a cytosolic flavincontaining enzyme that catalyzes the reduction of cytochrome c in T. cruzi [16]. On the other hand, Berger and Fairlamb have demonstrated the presence of cytochrome P450 mixed function oxidases in organisms causing the three major human and domestic animal trypanosomiasis, Trypanosoma brucei brucei, T. cruzi and Leishmania donovani [17]. In addition, the existence of several members of the P450 superfamily (CYP51) in trypanosomatids has been recently reviewed by Lepesheva et al. [18]. CYP51 (sterol 14␣-demethylase) has been shown to catalyze the oxidative removal of the 14␣methyl group from post-squalene sterol precursors. Based on the information provided by the complete genome sequencing of T. brucei brucei, T. cruzi, and L. major, several genes coding for CYP51 have been reported for each genus, all of them sharing high sequence identities. Moreover, Buckner et al. [19] cloned a T. brucei cytochrome P450 reductase gene and demonstrated the participation of the recombinant protein in raising the ergosterol content in an erg11-deficient yeast strain cotransfected with both the T. cruzi sterol 14␣-demethylases and T. brucei CPR. Since depletion of the sterol biosynthetic pathway end product in trypanosomatids causes death [20,21], the enzymes responsible for the correct function of this metabolic route have been proposed as targets for an antiparasitic therapy [22]. T. cruzi is refractory to known antiprotozoal agents [23]. Though remarkable progress has been made in the understanding of parasites biochemistry and molecular biology in the last years, the mechanisms of resistance are not yet well understood. Since, as mentioned above, CPRs are involved in the cell detoxifying system, it would be interesting to establish the particular role of these enzymes in the mentioned processes in the parasite. Here we report the identification and characterization of a novel CPR family in T. cruzi. We also present the biochemical behavior of the recombinants TcCPR-A, TcCPR-B and TcCPR-C cloned, expressed and purified from bacterial systems. Finally, we examined the pos-

43

sible correlation between augmented TcCPR-B specific activity and Nifurtimox and Benznidazole increased resistance in overexpressing T. cruzi epimastigote cells.

2. Materials and methods 2.1. Strains and media T. cruzi epimastigote forms (CL Brener Strain) were cultured at 28 ◦ C for 7 days in LIT medium (5 g/l liver infusion, 5 g/l bactotryptose, 68 mM NaCl, 5.3 mM KCl, 22 mM HNa2 PO4 , 0.2% (w/v) glucose, 0.002% (w/v) hemin) supplemented with 10% (v/v) calf serum, 10 units/ml penicillin and 10 mg/l streptomycin. Cell viability was assessed by direct microscopic examination. Amastigotes and trypomastigotes grown on Vero cells cultures were kindly given by Berta Cazzulo [24]. Escherichia coli strain DH5␣ was used as host for plasmid DNA propagation, and strain BL21(DE3)pLysS host (F− ompT hsdSB (rB − mB − ) gal dcm (DE3) pLysS (CamR ) for protein expression. Cultures of E. coli were grown in Luria–Bertani (LB) medium containing ampicillin or ampicillin and chloramphenicol when indicated.

2.2. Enzymes and chemicals All radiochemicals used in this work were purchased from Dupont NEN Life Science Products Inc., Boston, MA and restriction endonucleases were from New England Biolabs Inc., Beverly, MA. Bacto-tryptose, yeast nitrogen base and liver infusion were from Difco Laboratories, Detroit, MI. All other reagents were purchased from Sigma Chemical Co., St. Louis, MO.

2.3. Preparation of T. cruzi DNA and RNA Genomic DNA was purified as described [25]. Total RNA was prepared from 4 × 1010 epimastigotes using the total RNA isolation (TRIzol) reagents (Gibco BRL, Life Technologies, Rockville, MD) as described by the manufacturers.

2.4. Cloning of TcCPR genes A consensus sequence obtained from the alignment of several organism CPRs was used to screen T. cruzi databases (http://www.tigr.org/tdb/e2k1/tca1/ and http://www.genedb. org/genedb/tcruzi/index.jsp). Oligonucleotides carrying hemirestriction sites were designed from the identified sequences (Table 1). PCR amplifications of TcCPR genes were carried out using 600–800 ng of T. cruzi genomic DNA, 100 ng of each indicated primer, 1–2.5 mM MgCl2 , 0.2 mM dNTPs and 1–2 U of Taq polymerase (Promega, Madison, WI) in a final volume of 50 ␮l. PCR products were cloned into pGEM T-Easy vector and sequenced.

Table 1 Oligonucleotides used in this study Name

Sequence

FwTcCPR-A RvTcCPR-A FwTcCPR-B RvTcCPR-B FwTcCPR-C RvTcCPR-C

5 5 5 5 5 5

actaagcttatgcatgagggggctgaa 3 actctcgagcgccgaccacgagtccac 3 atctcgagatgttgccgtaggtggattgcc 3 ataagctttcaatagacgtctttcatgta 3 ccatggtgcttttctacctaattgggac 3 gtcgacggatgcagaccaaacatctttt 3

44

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

2.5. Sequence analysis Sequence identity was analyzed with BLASTP (http://www.ncbi. nlm.nih.gov/blast/index.html). ClustalW (http://www.ebi.ac.uk/ clustalw/) was used to generate multiple sequence alignments using default parameter setting. Protein domains were determined using SMART (URL http://smart.emblheidelberg.de/), PROSITE (URL http://us.expasy.org/prosite/) and Pfam (http://pfam.sanger.ac.uk/) software. BOXSHADE (3.21) software (http://www.ch.embnet.org/software/BOX form.html) was used to generate backgrounds. The phylogenetic relationships were analyzed within a subset of flavoproteins (CPR, NOS, OYE and NR1). Multiple alignments were carried out using ClustalX (1.83) program and neighbor-joining algorithm for the tree topology inference. 2.6. Southern and Northern blot analysis Southern blot analysis was performed with 5 ␮g of genomic DNA previously digested with the indicated restriction endonucleases. The products were resolved into 0.8% agarose gels, transferred to a Hybond N+ Nylon membrane (Amersham Pharmacia Biotech, Piscataway, USA) and hybridized at 65 ◦ C in Church’s buffer [1% (w/v) BSA, 7% (w/v) SDS, 1 mM EDTA pH 8, 0.5% (w/v) HNa2 PO4 ] with the specific probes: a 697 bp, a 1040 bp and a 1077 bp DNA fragment carrying the 5 region of TcCPR-A, TcCPR-B and TcCPR-C, respectively. Blots were subjected to sequential stringent washes at 65 ◦ C and exposed to AGFA CP-BU NEW films (AGFA Gevaert N.V., Belgium) or scanned using a phosphoimager STORM 820 (Amersham, Pharmacia, USA). For Northern blot analysis, 15 ␮g of total RNA was electrophoresed on a 1.5% formaldehyde-agarose gel, transferred and hybridized as described for Southern blot. All probes were labeled with [␣-32 P]-dCTP using the Prime-a-Gene kit (Promega, Madison, WI) following the manufacturer’s instructions. 2.7. Parasite transfection T. cruzi epimastigote cells of CL Brener strain were transfected with either the 8371-bp construct obtained by subcloning the 2109-bp coding region of TcCPR-B in the pTREX integrative expression vector (pTREX-TcCPR-B) [26] or with the transfection control plasmid carrying the green fluorescent protein gene (pTREX-GFP), ´ gently given by Dr. Mart´ın Vazquez. Electroporations were carried out using a gene pulser electroporator (Bio-Rad Laboratories) under the following conditions: 5 × 107 parasites grown in LIT medium at 28 ◦ C were harvested by centrifugation, washed with PBS, and resuspended in 0.35 ml of electroporation buffer (PBS containing 0.5 mM MgCl2 , 0.1 mM CaCl2 ). The cell suspension was mixed with 50 ␮g of plasmid DNA in 0.2 cm gap cuvettes (Bio-Rad Laboratories). The parasites were electroporated with a single discharge of 400 V, 500 ␮F with a time constant of about 5 ms. After transfection, parasites were left to recover for 24 h at 28 ◦ C in LIT medium, followed by the selection in the same medium but containing 250 ␮g/ml G418 (Gibco BRL) for a 2-week period, and then raised to 500 ␮g/ml. The pTREX-GFP construction was used as a selection control. Complete selection evidenced by total GFP positive control population, observed under a fluorescence microscope, was obtained after about 60 days. 2.8. Expression and purification of recombinant TcCPR-A, TcCPR-B and TcCPR-C The 1836 bp band corresponding to the full-length gene sequence of TcCPR-A was sub-cloned into the HindIII and XhoI restriction sites of pET-22b+ expression vector and the 1887 bp

band corresponding to TcCPR-C was cloned into the NcoI and SalI restriction sites of pET-22b+ to generate the respective fusion proteins with a C-terminal His Tag rTcCPR-A and rTcCPR-C. The 2109 bp segment corresponding to TcCPR-B gene was subcloned into the XhoI and HindIII site of pRSET-A expression vector fused with an N-terminal 6xHis Tag (rTcCPR-B). All plasmid constructions were sequenced. Recombinant proteins were expressed in E. coli BL21 carrying either the pET-TcCPR-A, the pRSET-TcCPR-B or pET-TcCPR-C constructions. Cells were grown to OD600 = 0.5–0.6 and induced with 0.1 mM isopropyl-1-thio-␤-d-galactopyranoside for 4 h at 28 ◦ C. Recombinant proteins were purified as follows. All steps were carried out at 4 ◦ C. Cells were subjected to one freeze-thawing cycle at −20 ◦ C and suspended in buffer A (50 mM Tris–HCl pH 8.0, 1.0 mM EDTA, 10% (v/v) glycerol, 10 mM ␤-mercaptoethanol) supplemented with 0.5 mM DTT, 0.3 M NaCl and the protease inhibitors (1 ␮g/ml E-64, 1 mM pepstatine A, 1 mM phenylmethylsulfonylfluoride, 0.1 mM tosyl-lysine chloromethyl ketone). The suspension was sonicated in a Sonifier Cell Disruptor (Model W185, Heat Systems-Ultrasonic Inc., Plainview, IL, NY, USA) by means of five 1-min treatments at 45–50 W, to total cell disruption. The cell homogenate was centrifuged at 27,000 × g for 30 min, and the supernatant (cell-free extract) used for recombinant enzyme purification by metal affinity Ni2+ -NTA resin columns (Qiagen, Valencia, USA) following the manufacturer’s instructions. The purity was analyzed by SDS-PAGE. 2.9. Microsomal membrane and cytosol preparation Pellets containing (2–3) × 1011 epimastigotes were ground in liquid nitrogen. The homogenate was diluted with 10–20 ml of 250 mM sucrose, 25 mM Tris–HCl, pH 7.4 (Tris/sucrose buffer) supplemented with 0.5 mM DTT, 0.3 M NaCl and protease inhibitors 1 ␮g/ml E-64, 1 mM pepstatine A, 1 mM PMSF, 0.1 mM TLCK, and centrifuged for 10 min at 12,000 × g. The supernatant was then ultracentrifuged for 1 h at 100,000 × g. The resulting pellet was resuspended in Tris/sucrose buffer with a glass-Teflon homogenizer and ultracentrifuged as above. The pellet was then resuspended in Tris/sucrose buffer and appropriately diluted for protein assay [27]. Cell-free extract, i.e. pellet (P100) and supernatant (S100) of 100,000 × g were used for Western blot analysis and enzymatic activity. 2.10. Enzyme assays NADPH-dependent reductase activity was assayed as described by Kuwahara et al. [28] with slight modifications. Briefly, the reaction mixture contained 0.1 M potassium phosphate buffer (KPB) pH 7.7, 20% (v/v) glycerol, an electron acceptor, and the indicated enzyme source. The reaction was initiated by the addition of 0.1 mM NADPH at 30 ◦ C. The reduction rate of every substrate was followed by the increase of absorbance at 550 nm for cytochrome c, 480 nm for adrenochrome formation, and at 600 nm for DCIP in a DU® 640B Spectrophotometer. One unit of CPR was defined as the amount of enzyme that reduces 1 ␮mol of cytochrome c per minute at 30 ◦ C. Extinction coefficients (cm−1 mM−1 ) used were 21 to calculate the concentration of the reduced form of cytochrome c and DCIP and 4.02 for adrenochrome formation. Menadione reduction was determined by following the reoxidation of NADPH at 340 nm. 7-Ethoxycoumarin O-deethylase activity was assayed by monitoring the fluorescence emitted by 7-hydroxycoumarin at 458 nm [29]. Essentially, microsomal preparations from either trypanosomatids or rat liver (2 mg protein/ml) were incubated in a reaction mixture containing 50 mM Tris–HCl pH 7.8,

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

0.1 mM NADPH, 1.3 mg/ml glucose-6-phosphate, 5 mM MgCl2 , 0.2 U/ml glucose-6-phosphate dehydrogenase and 0.5 mM 7ethoxycoumarin. All samples were incubated for 15 min at 30 ◦ C. The reaction was stopped by adding ZnSO4 and Ba(OH)2 and fluorescence emitted by 7-hydroxycoumarin was monitored in an Aminco-Bowman spectrofluorometer set at an excitation/emission pairing of 338/458 nm. All enzymatic rates were corrected for enzymatic activity in the absence of cofactors solution. Aminopyrine N-demethylase activity was measured by the spectrophotometric procedure of NASH, based on the Hantzsch reaction to determine the formaldehyde production at 415 nm as previously described Mazel [30]. 2.11. Protein content Protein concentration was measured by Bradford method [31]. 2.12. Antibody preparation Antisera against every rTcCPRs were obtained by respective immunization of female BALB/c strain mice via intraperitoneal injection of 100 ␮g of recombinant protein plus 0.1 ml of incomplete Freund’s adjuvant. After two more subsequent injections every 15 days, mice were bled for sera by exposing the ocular cavity. Antibodies were tested for titer and cross reactivity using the recombinant protein and T. cruzi extracts. Appropriate measures were taken to minimize pain or discomfort of the experimental animals used in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). 2.13. Western blot Procedures for SDS-PAGE of protein samples were carried out as described by Laemmli [32]. Polypeptides were electrotransferred from polyacrylamide gels to Hybond-C membranes (Amersham Pharmacia Biotech, Piscataway, USA). The membranes were blocked with 5% (w/v) non-fat milk suspension in TBS-Tween for 2 h. After 1 h incubation with 1:1000 dilution of the respective mouse antiserum, detection was carried out by incubating with a 1:5000 dilution of a goat anti-mouse IgG labeled with peroxidase (KPL Inc., Gaithersburg, MA). The latter was developed with the ECL PlusTM Western Blotting Detection System (NEN Life Science Products Inc., Boston, MA). The verification of loaded protein was performed on the previously stripped membrane through the detection of ␣-tubulin with monoclonal mouse anti ␣-tubulin from Sigma (1/2000 for 1 h). 2.14. Trypanocidal effect assays and EC50 determination Epimastigotes from CL Brener carrying the pTREX-GFP and pTREX-TcCPR-B were cultured in LIT medium supplemented with 10% (v/v) fetal bovine serum (FBS) at 28 ± 0.5 ◦ C in 96 wells culture flasks. Cultures (1 × 106 parasite/ml) were incubated with increasing amounts of Benznidazole (Bz) or Nifurtimox (Nfx) (1–50 ␮M) solubilized in DMSO. In all the experiments, the final concentration of DMSO was fixed below toxic level (1%). Each experiment was performed in triplicate. Counting in a Neubauer chamber monitored parasite growth. Inhibition was calculated as the ratio between parasite growth in presence or absence of each drug, after 72 h of culture. The concentration of drug that produces death to 50% of parasites (EC50) was calculated

45

by a dose–response curve using non-linear regression analysis carried out with Prism 5.0 Software (GraphPad, San Diego, CA). 2.15. Statistical analysis Values are expressed as mean ± S.D. of at least three independent experiment performed in triplicates. The significance of the differences between the means at different drug concentration in inhibition experiments was evaluated by using Student’s t-test and the two ways ANOVA multiple comparison tests followed by Bonferroni’s post-test. 3. Results 3.1. Sequence analysis and cloning of TcCPR genes Three different non-overlapping sequences corresponding to respective coding regions of 1836 bp, 2109 bp and 1887 bp were identified in T. cruzi genome database, all of them showing high identity with CPRs and NOS from other organisms. The structural analysis of these protein sequences demonstrated the presence of the FAD, FMN and NADPH binding domains characteristic of flavoproteins. As a result from the study of the context feature map described in T. cruzi Gene Database, the ORFs codify for nonallelic forms of putative NADPH-dependent CPRs. The predicted proteins have calculated molecular masses of 68.6 kDa, 78.4 kDa and 71.3 kDa and were named TcCPR-A, TcCPR-B and TcCPR-C, respectively (GenBank accession numbers ABJ09678, ABI15738 and ABJ09679), all of them showing high identity with human CPR, 25.8%, 26.4% and 33.7%, respectively. The alignment of the three predicted reductase protein sequences showed amino acid identity of 10.7% and when compared by pairs the similarities ranged between 56 and 64%. The most striking difference reside in the N-terminal region and consists in the presence of a predicted transmembrane helix domain in TcCPR-B and TcCPR-C, which is absent in TcCPR-A (Fig. 1). The relationships of T. cruzi CPRs with those belonging to a variety of other organisms were investigated. A BLAST search carried out using the T. cruzi encoded proteins allowed the identification of CPR-codifying sequences from several organisms (Protozoa, Plantae, Animalia and Fungi), some of which have been functionally characterized. The analysis of the trypanosomatid genomes revealed that T. cruzi and L. major possess three different CPR genes while T. brucei possesses four gene sequences. As a result from a phylogenetic tree approach using CPRs and other flavoproteins (NOS, OYE and NR1), it is clear that a majority of putative trypanosomatid CPRs grouped together in a branch exclusive to these parasites (Fig. 2). This analysis strongly supports the theory that trypanosomatids diverged early in evolution from the main eukaryotic branch of the phylogenetic tree [33]. Interestingly, TcCPR-A, together with TbCPR-1 and LmCPR-1 and other putative CPRs, appears to be related to human NR1. A detailed analysis of the primary structure of all the encoded proteins from this cluster showed that they all lack the predicted transmembrane domain, characteristic from known CPRs. We decided to name this cluster the “NR1-like CPR”. Full-length coding sequences of TcCPR-A, TcCPR-B and TcCPR-C were obtained through PCR amplification, using the corresponding forward (FwTcCPR) and reverse (RvTcCPR) oligonucleotides listed in Table 1. The cloning of both genes in pGEM-T Easy vector and consecutive sequencing and BLAST analysis confirmed the sequence identity.

46

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

Fig. 1. Alignment of the deduced amino acid sequences for TcCPR-A, TcCPR-B and TcCPR-C from T. cruzi, Homo sapiens (HsCPR, NP 000932.3), Arabidopsis thaliana (AtCPR, CAB58576.1) and Saccharomyces cerevisiae (ScCPR, NP 011908.1). Multiple sequence alignment was performed by using the ClustalW software. Backgrounds were generated with BOXSHADE 3.21 software (white for different residues, black for identical residues, gray for similar and conserved residues). A putative transmembrane domain is indicated at the N-terminal region. Brackets also indicate prosthetic group and cofactor binding domains. The amino acid motif SR—K–Y responsible for the interaction with the 2 phosphate of NADP+ is conserved in all sequences (arrow head).

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

47

Fig. 2. Phylogenetic tree of reported and putative CPR, NOS and OYE from protozoa, fungi, animalia and plantae, based on amino acid sequences. The following amino acid sequences were used for the analysis: (1) Trypanosoma cruzi TcOYE (AAX55669.1), (2) Pichia stipitis OYE (ABN65609.1), (3) Kluyveromyces marxianus OYE (BAD24850.1), (4) A. thaliana CPR (AAF02110.1|AC009755 3), (5) H. sapiens NR1 (NP 055249.1), (6) Branchiostoma floridae CPR (AAQ10794.1), (7) Leishmania major CPR 1 (CAJ07987.1), (8) Trypanosoma brucei CPR 1 (XP 844345.1), (9) T. cruzi TcCPR-A (ABJ09678.1), (10) Taxus cuspidata CPR (AAT76449.1), (11) Pseudotsuga menziesii CPR (CAA89837.3), (12) Centaurium erythraea CPR (AAS92623.1), (13) A. thaliana ATR2 (CAA46814.1), (14) Artemisia annua CPR (ABL09938.1), (15) A. thaliana ATR1 (CAA46815.1), (16) Cunninghamella echinulata (AAF89959.1|AF195660 1), (17) Phanerochaete chrysosporium CPR 2 (AAG31350.1|AF193061 1), (18) P. chrysosporium CPR 1 (AAG31351.1|AF193062 1), (19) Candida albicans CPR (XP 720425.1), (20) S. cerevisiae CPR (NP 011908.1), (21) Schizosaccharomyces pombe CPR (P36587), (22) Aspergillus niger CPR (S38427), (23) Gibberella fujikuroi CPR (CAE09055.1), (24) Mus musculus CPR (NP 032924.1), (25) H. sapiens CPR (NP 000932.3), (26) Bombyx mori CPR (BAA95684.1), (27) Bombyx mandarina CPR (ABJ97709.1), (28) Aedes aegypti CPR (EAT45397.1), (29) Drosophila melanogaster CPR (NP 723173.1), (30) T. brucei CPR 3 (XP 828830.1), (31) T. brucei CPR 4 (XP 828912.1), (32) L. major CPR 3 (CAJ05350.1), (33) T. cruzi TcCPR-C (ABJ09679.1), (34) L. major CPR 2 (XP 843361.1), (35) T. brucei CPR 2 (XP 827553.1), (36) T. cruzi TcCPR-B (ABI15738.1), (37) Physarum polycephalum NOS (AAK43730.1), (38) B. floridae NOS (AAQ02989.1|AF396968 1), (39) Rattus norvegicus NOS (BAA02090.1), (40) H. sapiens iNOS (AAC19133.1), (41) H. sapiens eNOS (P29474), (42) H. sapiens nNOS (NP 000611.1), (43) Aplysia californica NOS (AAK83069.1|AF288780 1), (44) B. mori NOS (NP 001036963.1), (45) Rhodnius prolixus NOS (Q26240), (46) Anopheles stephensis NOS (O61608). Asterisk (*) indicates T. cruzi CPRs.

3.2. Genomic organization T. cruzi genomic DNA was digested with endonucleases that cut specifically either within or outside each gene. Each blot was

hybridized with the corresponding probe, described under Section 2. The results indicate that a single-copy gene encodes for TcCPRA, TcCPR-B and TcCPR-C (not shown). Northern blot analysis of T. cruzi epimastigote total RNA screened with the same three frag-

48

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

Fig. 3. Northern blot. Northern blots containing total RNA isolated from epimastigotes were probed as described under Section 2. Molecular size markers are indicated on the left (kb).

ments as respectives probes revealed single hybridization bands of about 1800 b, 2100 b and 1900 b for TcCPR-A, TcCPR-B and TcCPR-C, respectively (Fig. 3).

Fig. 4. TcCPR-A, TcCPR-B and TcCPR-C expression profiles in T. cruzi. (A) Immunoblot of recombinant and native TcCPRs. Cytosolic (Tc S100) and particulated (Tc P100) fractions from T. cruzi epimastigote were immunoreacted on the same blot by anti-TcCPR-A (␣-TcCPR-A), anti-TcCPR-B (␣-TcCPR-B) and anti-TcCPR-C (␣-TcCPR-C) antibodies. Specificity of the antibodies was verified by reacting with E. coliexpressed recombinant CPRs from T. cruzi (rTcCPR-A, rTcCPR-B and rTcCPR-C, respectively). Identity of the recombinant proteins was confirmed by reacting with anti-histidine-tag (␣-His). (B) Immunoblot of TcCPR-A and TcCPR-B in the three main biological stages of T. cruzi: amastigote (a), epimastigote (e), cultured trypomastigotes (t). All lanes contain 80 ␮g of total cell extract. Table 2 Kinetic parameters of the recombinant TcCPR-A, TcCPR-B and TcCPR-C Enzyme

Km Cyt c (␮M)

Km NADPH (␮M)

DPI inhibition (%)

3.3. Biochemical characterization of recombinants TcCPRs expressed in E. coli

rTcCPR-A rTcCPR-B rTcCPR-C

54.88 ± 4.41 51.09 ± 6.0 5.77 ± 3.92

18.0 ± 2.4 17.0 ± 1.11 9.8 ± 1.12

64 ± 7.10 76 ± 4.45 62 ± 5.91

Recombinant TcCPR-A and TcCPR-C were expressed using the pET22b(+) and TcCPR-B using pRSET-A vectors, respectively. The expression was confirmed by SDS-PAGE. In all cases the yield of soluble enzyme was improved by growing the cells at 28 ◦ C instead of 37 ◦ C. Subsequent addition of 10% (v/v) glycerol in the lysis buffer stabilized the enzymes. The recombinant enzymes were further purified by using Ni2+ -NTA resin column and we used anti His antibody to identify the His tagged recombinant proteins (Fig. 4). However, considerable amount of enzyme protein was lost during the purification procedure and its activity highly decreased after freezing and thawing. The purified recombinant enzymes extracted as a band from an SDS-PAGE gel were used to raise respective antibodies against rTcCPR-A, rTcCPR-B and rTcCPR-C. Kinetic behavior of recombinant proteins was characterized in the bacterial cytosolic fraction since the enzymes become unstable after purification. Negligible background activity present in the supernatant of non-expressing bacteria was substracted on each experiment. Enzymatic activities corresponding to all recombinant TcCPRs showed a saturable dependence for NADPH and cytochrome c (data not shown). Km values obtained for NADPH and cytochrome c are shown in Table 2 and are in good agreement with those obtained by Kuwahara et al. for the reductase activity found in T. cruzi cytosol [16]. Diphenyleneiodonium (DPI) is widely used as a non-competitive inhibitor of flavoenzymes, particularly NADPHdependent ones. The inhibition of rTcCPR-A, rTcCPR-B and rTcCPR-C activities in the presence of 30 ␮M DPI was 64%, 76% and 62%, respectively (Table 2). Every rTcCPR used mainly NADPH as electron donor. The activity with other alternative substrates was further investigated. The recombinant enzymes were able to reduce DCIP, but not menadione or adrenaline (Table 3).

Determination of Km for Cyt c was performed in a reaction mixture containing 100 ␮M NADPH with varying amounts of Cyt c; Km for NADPH was determined using 100 ␮M Cyt c varying NADPH concentrations. Values were obtained by Lineweaver–Burke plot analysis.

To demonstrate the functionality of rTcCPRs as a cytochrome P450 reductases, we tested the ability of the recombinant enzymes to support CYP-dependent reactions, using a reconstituted heterologous system carrying rat liver microsomal preparation as source of CYP. Aminopyrine demethylase activity of rat microsomes increased from 0.44 ± 0.062 nmol/(min mg) protein to 2.45 ± 0.20 nmol/(min mg) protein, 2.35 ± 0.21 nmol/(min mg) protein and 4.41 ± 0.21 nmol/(min mg) protein by addition of 10 ␮g of rTcCPR-A, rTcCPR-B or rTcCPR-C, respectively. The 7-ethoxycoumarin O-deethylation by cytochrome P450 was slightly increased from 1.25 ± 0.09 nmol/(min mg) protein of purified microsome to 1.95 ± 0.11 nmol/(min mg) protein, only after the addition of 10 ␮g of rTcCPR-A. Table 3 Activity of rTcCPR-A, rTcCPR-B and rTcCPR-C with different substrates Substrate

Cofactor

Enzyme activity (mU/mg) rTcCPR-A

rTcCPR-B

rTcCPR-C

Cyt c

NADPH NADH

132.04 ± 12.33 1.17 ± 0.09

30.41 ± 2.4 0

231.11 ± 19.18 0

DCIP Menadione Adrenaline

NADPH NADPH NADPH

71.33 ± 5.03 0 0

13.48 ± 1.23 0 0

ND 0 0

Reductase activity was assayed as described under Section 2. Substrates concentration was 100 ␮M except for adrenaline (500 ␮M).

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

49

Fig. 5. Overexpression of TcCPR-B in epimastigote cells. (A) Southern blot analysis of wild type and pTREX-TcCPR-B epimastigote cells. 5 ␮g of genomic DNA from wild type or pTREX-TcCPR-B cells were digested with the following restriction endonucleases: EcoRI, XhoI or BamHI which do not cut the TcCPR-B gene or with PstI or NruI (that cut in positions 2049 and 1859 inside the TcCPR-B gene, respectively). A radiolabeled 1040-bp fragment corresponding to the 5 region of TcCPR-B was used as a probe. (B) Western blot analysis from GFP- or TcCPR-B-overexpressing epimastigote cells. Western blots were performed using 30 ␮g of cytosolic protein and revealed with anti TcCPR-B antibody. Equivalence in protein loading was controlled by inmunodetection of ␣-tubulin using mouse anti ␣-tubulin. (C) Cytochrome c reductase specific activity from cytosolic fraction of pTREX-GFP and pTREX-TcCPR-B epimastigote cells.

3.4. TcCPRs identification in T. cruzi Taking into account previous reports from Kuwahara et al. [16] confirming that two-thirds of the reductase activity localize in the cytosolic fraction, we studied by Western blot TcCPR-A, TcCPR-B and TcCPR-C proteins presence in subcellular fractions from epimastigote cells. Bands of the expected molecular weight (68 kDa for TcCPR-A and 78 kDa for TcCPR-B) were detected in the cytosolic fraction (Fig. 4A) when revealed with the specific polyclonal mouse antisera raised against the recombinant proteins (rTcCPRA or rTcCPR-B) as described under Section 2. Otherwise, a slight band of about 71 kDa was revealed by anti-TcCPR-C antiserum in the microsomal fraction of epimastigotes cell. The correspondence of every native protein molecular mass with the His-tagged rTcCPRA rTcCPR-B and rTcCPR-C was confirmed using commercial anti-His antibody. On the other hand, TcCPR-A antiserum also recognized a minor band (coincident with TcCPR-B molecular weight) in the cytosolic fraction of T. cruzi. This signal could be probably due to the recognition of conserved epitopes present in the shared domains. No signal was detected when pre-immune antiserum was assayed against purified recombinant proteins or subcellular epimastigote fractions (data not shown). We further analyzed the expression of every TcCPRs in all developmental stages of T. cruzi (Fig. 4B). Cell-free extracts from mammalian host stage amastigotes, epimastigotes and cellcultured trypomastigotes were subjected to Western blot analysis.

In all cases TcCPR-A and TcCPR-B were detected in every developmental stage being TcCPR-A strongly expressed in trypomastigotes. Under this experimental condition the antisera against TcCPRC could not reveal the presence of this reductase in the crude extracts. 3.5. Overexpression of TcCPR-B in T. cruzi NADPH–cytochrome P450 reductases are implicated in drug metabolism through redox cycling of CYP [5] and in addition play a role as direct electron donor [34]. In order to obtain experimental data to infer a role for TcCPRs in parasites we decided to overexpress the recombinant proteins in epimastigotes. T. cruzi epimastigote cells over-expressing either TcCPR-B (pTREX-TcCPR-B) or the green fluorescence protein (pTREX-GFP) were obtained as described in Section 2. After a 60-day selection, the transfected parasites showed no significant differences either at morphological level or in their growth rate as compared with wild-type non-transfected CL Brener strain cells. The presence of an additional TcCPR-B gene copy in the transfected parasites was investigated by Southern blot analysis (Fig. 5A). Taking into account that none of the restriction enzymes used cut inside the first 1040bp of the TcCPR-B gene (region that was used as probe), the single hybridization bands observed in the wild-type analysis indicated that this reductase is codified by a single copy gene. On the other hand, the extra hybridization bands observed in the pTREX-TcCPRB group indicate a successful integration of the extra copy of this

Fig. 6. Effect of nitroheterocyclic trypanocidal compounds against transfected cultured epimastigotes. pTREX-GFP cells, grey bars; pTREX-TcCPR-B cells, black bars. In the assays conditions, 100% corresponds to 7 × 106 parasites. Epimastigote cells were incubated for 72 h in the presence or absence of different concentration of Nfx (A) or Bz (B). The results are the mean of three independent experiments performed in triplicates. For any other experimental detail see Section 2. *p < 0.05.

50

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51

gene. Western blot assay demonstrated a higher expression level of TcCPR-B (Fig. 5B), which correlates with about twofold increase of the enzyme specific activity (Fig. 5C). To investigate whether overexpression of TcCPR-B could exert an effect on drug resistance, we studied epimastigote survival upon the treatment of both TcCPR-B and GFP-transfected parasites with the nitroheterocyclic trypanocidal compounds Nifurtimox (Nfx) or Benznidazole (Bz). Fig. 6 shows the percentage of surviving parasites after treatment with Nfx concentrations ranging from 1 ␮M to 50 ␮M and Bz concentrations ranging from 2.5 ␮M to 50 ␮M. The pTREX-TcCPR-B showed slightly but yet statistically significant increased resistance to Nfx, mainly observed at high drug concentration at 72 h of the growth curve. EC50 value shifted from 1.3 ± 0.087 ␮M to 2.8 ± 0.11 ␮M for TcCPR-B overexpressing cells, (P < 0.0001). More striking results were observed with Bz treatment, where significant increased resistance was obtained at almost every concentration assayed. Parasites overexpressing TcCPR-B shifted Bz EC50 from 2.61 ± 0.13 ␮M to 12.35 ± 0.19 ␮M (P < 0.0001). 4. Discussion Three sequences corresponding to nonallelic genes, coding for NADPH-dependent cytochrome P450 reductases are reported in the present work. As is the case for some plant species [11], we found that, in T. cruzi, CPRs are encoded by a small gene family. The sequence similarity to one another and to several flavoprotein reductases from other related and non-related organisms suggests that all TcCPRs would possess similar in vitro catalytic activities. The significant differences found among the sequences of TcCPRs, particularly the absence of a putative transmembrane peptide on the N-terminal segment (Fig. 1), would give account, as predicted for human NR1 [13] for different cellular localization and consequently for distinct metabolic roles. Southern blot analysis showed that CPRs are single-copy genes, which is consistent with the result obtained in the database search. The expression in T. cruzi epimastigotes at mRNA level was demonstrated by Northern blot. Shen and Kasper [35] have proposed that both cytochrome c and cytochrome P450 interact with two clusters of acidic amino acids present between residues 200–220 of the CPR FMN-binding site. Acidic clusters present in the homologous region of TcCPRs could be responsible for similar electrostatic interaction. In this work we demonstrated that recombinant TcCPRs reduced cytochrome c in an absolutely NADPH-dependent manner showing high affinity for both substrates. We demonstrated the functionality of the recombinant proteins serving as an electron donor to some hemoproteins using a reconstituted system. The presence of multiple isoforms of CPR in T. cruzi, together with the previous reports of putative CYPs [17], argues for a well-supported P450-mediated molecular system. The presence of at least two 80%-identical CPRs has been demonstrated in parsley and a distinct metabolic role has been clearly assigned to each one [10]. Differential regulation of these CPR1 and CPR2 is particularly interesting in view of both the existence of only a small number of CPRs relative to the large variety of CPR-dependent reactions and the reported mutual exchangeability of various CPRs in reconstitution experiments [36]. The occurrence of multiple CPRs in the parasite might reflect the diversity of metabolic pathways involved in the synthesis of a wide range of primary and secondary metabolites as well as for xenobiotic detoxification, all of them concerning electron transfer. It is very important to consider that CPRs have been described as the electron donor proteins for several oxygenase enzymes found in the endoplasmic reticulum of most eukaryotic cells, with the main role of regulating the electron transfer of two electrons in a wide range

of processes [37]. In addition to its physiological function, CPRs play a role in the reduction of one-electron acceptors such as several therapeutically important anticancer agents [14,38]. Defense mechanisms against oxidative stress have been related to drug resistance and widely investigated in trypanosomatids. Several enzyme-mediated pathways centered upon the unusual thiol trypanothione have been described to explain the removal of hydroperoxides [39]. In addition, glucose-6-P dehydrogenase (G6PD) from T. cruzi has also been related to oxidative stress in the parasite [24]. The TcCPR gene family here described increases the number of known proteins possibly involved in redox metabolism and xenobiotic detoxification in the parasite. The increased level of TcCPR-A in the trypomastigote form, which is particularly exposed to stress during mammalian cell invasion, supports the suggestion of an active role of this enzyme in oxidative stress defense mechanisms. Overexpressing TcCPR-B epimastigotes presented significantly increased resistance to Bz and in a minor mode to Nfx. Both drugs are believed to inhibit parasites growth by increasing oxidative stress. In fact, Maya et al. have reported that Nfx and Bz diminish the free thiol concentration in the epimastigote form of T. cruzi [40]. Resistance to Bz in the parasite has been related to genetic adaptability by Murta et al. [41] These authors demonstrated by microarray analysis that the transcription of TcOYE gene, coding for a NADPH oxidoreductase, is down-regulated in a T. cruzi population with in vitro induced resistance to Bz. Furthermore, a variety of T. cruzi strains have been shown to be inherently resistant to the widely used anti-T. cruzi drugs Benznidazole and Nifurtimox [42]. In mammalian cells, resistance to oxidative stress appears to be a multifactorial reaction involving the clustering of transcriptionally regulated genes. As an example of this, Biagiotti et al. have demonstrated the correlation in the expression of several enzymes responsible for reducing power in the olfactory bulb: G6PD, CPR and glutathion reductase [43]. It is well known that acquisition of resistance to Bz is probably a complex process with more than one stage involved. Taking into account the structural and biochemical characterization of TcCPR-B and the observed increased resistance to Bz of the stable transformed pTREX-TcCPR-B epimastigotes, we suggest a significant role of this reductase in the nitroheterocyclic detoxifying pathways in T. cruzi. The metabolic reactions in which TcCPRs are involved is yet to be established. Hence, the study of T. cruzi CPRs will provide more data to support a plausible explanation for the drug resistance phenomenon. Acknowledgements We are grateful to The Institute for Genomic Research (TIGR) genome projects and the Sanger institute genome project (GeneDB). We also thank Lic. Cristian Meyer for the critical reading of the manuscript and Dr. M. Dubin for the aminopyrine demethylase assay. We are indebted to Ms. Berta Franke de Cazzulo for trypomastigote and amastigote supply. We thank Consejo Nacional de Investigaciones Cient´ıficas ´ y Tecnicas (Argentina), University of Buenos Aires (Argentina) ´ Cient´ıfica y Tecnologica ´ and Agencia Nacional de Promocion (Argentina), for supporting this study. S.F.V., G.D.A., M.G.M.F., H.N.T. and C.P. are members of Scientific Investigator Career of CONICET, Argentina. P.P. and M.G.D.V. are research fellows. References [1] Gibson GSP. Introduction to Drug Metabolism. UK: Bath; 2001. [2] Murataliev MB, Feyereisen R, Walker FA. Electron transfer by diflavin reductases. Biochim Biophys Acta 2004;1698:1–26.

P. Portal et al. / Molecular & Biochemical Parasitology 160 (2008) 42–51 [3] Ostrowski J, Barber MJ, Rueger DC, Miller BE, Siegel LM, Kredich NM. Characterization of the flavoprotein moieties of NADPH-sulfite reductase from Salmonella typhimurium and Escherichia coli. Physicochemical and catalytic properties, amino acid sequence deduced from DNA sequence of cysJ, and comparison with NADPH–cytochrome P-450 reductase. J Biol Chem 1989;264:15796– 808. [4] Iyanagi T. Structure and function of NADPH–cytochrome P450 reductase and nitric oxide synthase reductase domain. Biochem Biophys Res Commun 2005;338:520–8. [5] Masters BS. The journey from NADPH–cytochrome P450 oxidoreductase to nitric oxide synthases. Biochem Biophys Res Commun 2005;338:507–19. [6] Nelson DR, Koymans L, Kamataki T, et al. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 1996;6:1–42. [7] Guengerich FP. Catalytic selectivity of human cytochrome P450 enzymes: relevance to drug metabolism and toxicity. Toxicol Lett 1994;70:133–8. [8] Cheng J, Wan DF, Gu JR, et al. Establishment of a yeast system that stably expresses human cytochrome P450 reductase: application for the study of drug metabolism of cytochrome P450s in vitro. Protein Expr Purif 2006;47:467– 76. [9] Louerat-Oriou B, Perret A, Pompon D. Differential redox and electron-transfer properties of purified yeast, plant and human NADPH–cytochrome P-450 reductases highly modulate cytochrome P-450 activities. Eur J Biochem 1998;258:1040–9. [10] Koopmann E, Hahlbrock K. Differentially regulated NADPH:cytochrome P450 oxidoreductases in parsley. Proc Natl Acad Sci USA 1997;94:14954–9. [11] Ro DK, Ehlting J, Douglas CJ. Cloning, functional expression, and subcellular localization of multiple NADPH–cytochrome P450 reductases from hybrid poplar. Plant Physiol 2002;130:1837–51. [12] Porter TD, Beck TW, Kasper CB. NADPH–cytochrome P-450 oxidoreductase gene organization correlates with structural domains of the protein. Biochemistry 1990;29:9814–8. [13] Paine MJ, Garner AP, Powell D, et al. Cloning and characterization of a novel human dual flavin reductase. J Biol Chem 2000;275:1471–8. [14] Kwasnicka-Crawford DA, Vincent SR. Role of a novel dual flavin reductase (NR1) and an associated histidine triad protein (DCS-1) in menadione-induced cytotoxicity. Biochem Biophys Res Commun 2005;336:565–71. [15] Agosin M, Naquira C, Paulin J, Capdevila J. Cytochrome P-450 and drug metabolism in Trypanosoma cruzi: effects of phenobarbital. Science 1976;194:195–7. [16] Kuwahara T, White Jr RA, Agosin M. A cytosolic FAD-containing enzyme catalyzing cytochrome c reduction in Trypanosoma cruzi. I. Purification and some properties. Arch Biochem Biophys 1985;239:18–28. [17] Berger BJ, Fairlamb AH. Cytochrome P450 in trypanosomatids. Biochem Pharmacol 1993;46:149–57. [18] Lepesheva GI, Zaitseva NG, Nes WD, et al. CYP51 from Trypanosoma cruzi: a phyla-specific residue in the B’ helix defines substrate preferences of sterol 14alpha-demethylase. J Biol Chem 2006;281:3577–85. [19] Buckner FS, Joubert BM, Boyle SM, Eastman RT, Verlinde CL, Matsuda SP. Cloning and analysis of Trypanosoma cruzi lanosterol 14alpha-demethylase. Mol Biochem Parasitol 2003;132:75–81. [20] Braga MV, Urbina JA, de Souza W. Effects of squalene synthase inhibitors on the growth and ultrastructure of Trypanosoma cruzi. Int J Antimicrob Agents 2004;24:72–8. [21] Garzoni LR, Caldera A, Meirelles Mde N, et al. Selective in vitro effects of the farnesyl pyrophosphate synthase inhibitor risedronate on Trypanosoma cruzi. Int J Antimicrob Agents 2004;23:273–85. [22] Hankins EG, Gillespie JR, Aikenhead K, Buckner FS. Upregulation of sterol C14demethylase expression in Trypanosoma cruzi treated with sterol biosynthesis inhibitors. Mol Biochem Parasitol 2005;144:68–75. [23] Docampo R. Sensitivity of parasites to free radical damage by antiparasitic drugs. Chem Biol Interact 1990;73:1–27.

51

[24] Igoillo-Esteve M, Cazzulo JJ. The glucose-6-phosphate dehydrogenase from Trypanosoma cruzi: its role in the defense of the parasite against oxidative stress. Mol Biochem Parasitol 2006;149:170–81. [25] Pereira CA, Alonso GD, Paveto MC, et al. Trypanosoma cruzi arginine kinase characterization and cloning. A novel energetic pathway in protozoan parasites. J Biol Chem 2000;275:1495–501. [26] Lorenzi HA, Vazquez MP, Levin MJ. Integration of expression vectors into the ribosomal locus of Trypanosoma cruzi. Gene 2003;310:91–9. [27] Previato JO, Sola-Penna M, Agrellos OA, et al. Biosynthesis of O-Nacetylglucosamine-linked glycans in Trypanosoma cruzi Characterization of the novel uridine diphospho-N-acetylglucosamine:polypeptide. Nacetylglucosaminyltransferase-catalyzing formation of N-acetylglucosamine alpha1–>O-threonine. J Biol Chem 1998;273:14982–8. [28] Kuwahara T, White Jr RA, Agosin M. A cytosolic flavin-containing enzyme catalyzing reduction of cytochrome c in Trypanosoma cruzi: kinetic studies with cytochrome c as substrate. Arch Biochem Biophys 1985;241:45–9. [29] Dubin M, Fernandez Villamil SH, Stoppani AO. Inhibition of microsomal lipid peroxidation and cytochrome P-450-catalyzed reactions by beta-lapachone and related naphthoquinones. Biochem Pharmacol 1990;39:1151–60. [30] Mazel P. Experiments illustrating drug metabolism in vitro. In: LaDu BN, Mandel H, Way E, editors. Fundamentals of drug metabolism and drug disposition. Baltimore: William and Wilkins; 1971. p. 546–56. [31] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 1976;72:248–54. [32] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5. [33] Michels PA, Marchand M, Kohl L, Allert S, Wierenga RK, Opperdoes FR. The cytosolic and glycosomal isoenzymes of glyceraldehyde-3-phosphate dehydrogenase in Trypanosoma brucei have a distant evolutionary relationship. Eur J Biochem 1991;198:421–8. [34] Keyes SR, Fracasso PM, Heimbrook DC, Rockwell S, Sligar SG, Sartorelli AC. Role of NADPH:cytochrome c reductase and DT-diaphorase in the biotransformation of mitomycin C1. Cancer Res 1984;44:5638–43. [35] Shen AL, Kasper CB. Role of acidic residues in the interaction of NADPH–cytochrome P450 oxidoreductase with cytochrome P450 and cytochrome c. J Biol Chem 1995;270:27475–80. [36] Durst F, Nelson DR. Diversity and evolution of plant P450 and P450-reductases. Drug Metabol Drug Interact 1995;12:189–206. [37] Fuziwara S, Sagami I, Rozhkova E, et al. Catalytically functional flavocytochrome c himeras of P450 BM3 and nitric oxide synthase. J Inorg Biochem 2002;91:515–26. [38] Walton MI, Wolf CR, Workman P. The role of cytochrome P450 and cytochrome P450 reductase in the reductive bioactivation of the novel benzotriazine diN-oxide hypoxic cytotoxin 3-amino-1,2,4-benzotriazine-1 4-dioxide (SR 4233, WIN 59075) by mouse liver. Biochem Pharmacol 1992;44:251–9. [39] Wilkinson SR, Kelly JM. The role of glutathione peroxidases in trypanosomatids. Biol Chem 2003;384:517–25. [40] Maya JD, Repetto Y, Agosin M, et al. Effects of nifurtimox and benznidazole upon glutathione and trypanothione content in epimastigote, trypomastigote and amastigote forms of Trypanosoma cruzi. Mol Biochem Parasitol 1997;86: 101–6. [41] Murta SM, Krieger MA, Montenegro LR, et al. Deletion of copies of the gene encoding old yellow enzyme (TcOYE), a NAD(P)H flavin oxidoreductase, associates with in vitro-induced benznidazole resistance in Trypanosoma cruzi. Mol Biochem Parasitol 2006;146:151–62. [42] Buckner FS, Wilson AJ, White TC, Van Voorhis WC. Induction of resistance to azole drugs in Trypanosoma cruzi. Antimicrob Agents Chemother 1998;42:3245–50. [43] Biagiotti E, Ferri P, Dringen R, Del Grande P, Ninfali P. Glucose-6-phosphate dehydrogenase and NADPH-consuming enzymes in the rat olfactory bulb. J Neurosci Res 2005;80:434–41.

Lihat lebih banyak...

Comentários

Copyright © 2017 DADOSPDF Inc.