Multipotential Mesenchymal Stem Cells Are Mobilized into Peripheral Blood by Hypoxia

EMBRYONIC STEM CELLS Multipotential Mesenchymal Stem Cells Are Mobilized into Peripheral Blood by Hypoxia GAE¨ L Y. ROCHEFORT,a BRUNO DELORME,b ADRIANA LOPEZ,b OLIVIER HE´ RAULT,b PIERRE BONNET,a PIERRE CHARBORD,b VE´ RONIQUE EDER,a JORGE DOMENECHb a

Upres-Ea3852; bInserm-Ea3855, Ifr135, Universite´ Franc¸ois Rabelais de Tours and Chru de Tours, Tours, France

Key Words. Stem cells • Mobilization • Blood • Hypoxia • Hematopoiesis

ABSTRACT MSCs constitute a population of multipotential cells giving rise to adipocytes, osteoblasts, chondrocytes, and vascularsmooth muscle-like hematopoietic supportive stromal cells. It remains unclear whether MSCs can be isolated from adult peripheral blood under stationary conditions and whether they can be mobilized in a way similar to hematopoietic stem cells. In this report, we show that MSCs are regularly observed in the circulating blood of rats and that the circulating MSC pool is consistently and dramatically increased (by

almost 15-fold) when animals are exposed to chronic hypoxia. The immunophenotype and the adipocytic, osteoblastic, and chondrocytic differentiation potential of circulating MSCs were similar to those of bone marrow MSCs. Hypoxia-induced mobilization appears to be specific for MSCs since total circulating hematopoietic progenitor cells were not significantly increased. Our data provide an in vivo model amenable to analysis of MSC-mobilizing factors. STEM CELLS 2006;24:2202–2208

INTRODUCTION

isolation in adult PB depends on the investigators, with reported successes [22–24] and failures [25, 26], which may be related to the low frequency of such cells at steady state. The cogent evidence that MSCs circulate into PB and can be mobilized into the bloodstream using appropriate agents such as cytokines would be of great therapeutic interest since it would allow the collection of MSCs from PB and the eventual manipulation of their subsequent homing to injured tissues. In this study, we found that MSCs are regularly observed in the circulating blood of rats and showed, to our knowledge for the first time, that the circulating pool is consistently and dramatically increased in animals subjected to chronic hypoxia. Our data provide an in vivo model amenable to analysis of MSC-mobilizing factors.

Mesenchymal stem cells (MSCs) constitute a population of multipotential cells giving rise to adipocytes, osteoblasts, chondrocytes, and vascular-smooth muscle-like hematopoietic supportive stromal cells [reviewed in 1– 6]. Like other stem cells, MSCs are capable of multilineage differentiation from a singlecell [7, 8] and in vivo functional reconstitution of injured tissues [9 –11]. One of the properties of stem cells is their capacity to home after infusion to the appropriate microenvironment(s) [12, 13]. Certain stem cells are able to exit their production site, circulating into blood before reseeding their target tissues. In the case of hematopoietic stem cells (HSCs), such circulation is essential during development since they migrate from one site to the next (embryonic aorta-gonad-mesonephros region, fetal liver, adult bone marrow). In the adult, HSCs can be mobilized using specific cytokines such as granulocyte colony-stimulating factor (G-CSF). For MSCs, the homing sites and their circulation into peripheral blood (PB) remain a matter of debate. It has been shown that bone marrow, bone, and spleen are sites of engraftment [9, 14, 15]; however, MSCs are found after infusion in multiple tissues, leading to the hypothesis that they can home into, and adjust their differentiation pathway to, diverse tissue microenvironments [16]. Although the existence of circulating MSCs has been proven in fetal and neonatal blood [17–21], their

MATERIALS

AND

METHODS

Rat Model of Chronic Hypoxia Adult male Wistar rats (7 weeks, 220 g; Harlan, Gannat, France, http://www.harlan.com) were housed for 3 weeks in a hypoxic chamber (50 kPa), which caused chronic hypoxia, as previously described [27], and were compared with matched control rats housed in normoxic conditions (101 kPa). Three weeks later, PB and bone marrow (BM) samples were collected to evaluate cell counts and to characterize mesenchymal and hematopoietic progenitor cells.

Correspondence: Jorge Domenech, M.D., Ph.D., Laboratoire d’He´matopoı¨e`se, Inserm-ESPRI-EA3855, Faculte´ de Me´decine, 10 Boulevard Tonnelle´, 37 032 Tours Cedex, France. Telephone: 33-247-47-47-21; Fax: 33-247-47-69-34; e-mail: domenech@ med.univ-tours.fr Received March 21, 2006; accepted for publication May 6, 2006; first published online in STEM CELLS EXPRESS June 15, 2006. ©AlphaMed Press 1066-5099/2006/$20.00/0 doi: 10.1634/stemcells.2006-0164

STEM CELLS 2006;24:2202–2208 www.StemCells.com

Rochefort, Delorme, Lopez et al. All animal investigations were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the NIH [28] and with European directives [29] and approved by the local ethics committee.

Generation of MSCs MSCs were obtained from rat femoral BM, as previously described [7, 15]. Briefly, bones were cleaned of adherent soft tissue, epiphyses were removed, and marrow was harvested by inserting a 18-gauge syringe needle into one end of the bone shaft and flushing into a 35-mm culture dish with proliferation culture medium consisting of ␣-minimal essential medium (␣MEM) (Invitrogen, Cergy Pontoise, France, http://www. invitrogen.com) supplemented with 20% (vol/vol) screened fetal calf serum (FCS) (HyClone, Erembodegem, Belgium, http:// www.hyclone.com). A single-cell suspension was obtained by passaging through needles of decreasing size. Cells were then centrifuged, and nucleated cells were counted and seeded at a density of 5 ⫻ 105 cells per cm2 in culture medium at 37°C in 95% humidified air and 5% CO2. At day 2, all nonadherent cells were removed by changing the medium; thereafter, medium was changed twice a week. The monolayer of adherent cells was trypsinized (0.25% trypsin-EDTA; Invitrogen) when it was halfconfluent, resuspended in culture medium, and seeded at 10,000 cells per cm2 (passage 1 [P1]). Eight- to 12-ml peripheral blood samples were collected in heparinized tubes. Low-density mononuclear cells (MNCs) were separated on Ficoll-Hypaque density gradient (Amersham, Saclay Orsay, France, http://www.amersham.com), counted, and cultured as described for BM; cell density at culture inception was 106 cells per cm2; at P1, density was 10,000 cells per cm2.

Mesenchymal Progenitor Cells For colony-forming unit fibroblast (CFU-F) assays, BM total cells were plated per triplicate at densities of 5 ⫻ 104, 5 ⫻ 105, and 5 ⫻ 106 cells per 25-cm2 flask in proliferation culture medium, whereas for PB MNCs, cell densities were 105, 106, and 107 cells per 12.5-cm2 flask. The culture medium was changed on day 2, and adherent colonies (⬎50 cells) deriving from CFU-Fs were counted on days 6 –10.

Hematopoietic Progenitor Cells BM and PB MNCs were assayed for colony-forming unitsgranulocyte-macrophage (CFU-GM), colony-forming unitsmacrophage (CFU-M), colony-forming units-erythroid (CFUE), burst-forming units-erythroid (BFU-E) and colony-forming units-mixed lineage (CFU-Mix) in semisolid culture medium. Briefly, MNCs were cultured in Iscove’s modified Dulbecco’s medium (Invitrogen) containing 1% (wt/vol) methylcellulose (Sigma-Aldrich, Saint Quentin Fallavier, France, http://www. sigmaaldrich.com), 1% (wt/vol) bovine serum albumin (SigmaAldrich), 1 ⫻ 10⫺4 M ␤-mercaptoethanol (Sigma-Aldrich), and 30% FCS (Invitrogen). Cells were plated at 2.5 ⫻ 104 cells per milliliter for BM and 2.5 ⫻ 105 cells per milliliter for PB in 35-mm plastic dishes containing human G-CSF (100 IU/ml; AbCys, Paris, France, http://www.abcysonline.com), rat granulocyte-macrophage colony-stimulating factor (1,000 IU/ml; AbCys), rat stem cell factor (5 IU/ml; AbCys), rat interleukin-3 (1 IU/ml; AbCys), and rat erythropoietin (10 ng/ml; R&D Systems, www.StemCells.com

2203

Lille, France, http://www.rndsystems.com). Cells were incubated at 37°C in a humidified 5% CO2 atmosphere, and colonies were scored on day 4 for CFU-E (aggregates ⬎50 hemoglobinized cells), and on day 10 for CFU-GM, CFU-M (aggregates ⬎50 nonhemoglobinized cells), BFU-E (aggregates ⬎200 hemoglobinized cells), and CFU-Mix (aggregates ⬎50 hemoglobinized and nonhemoglobinized cells).

MSC Immunophenotype Membrane antigen expression on BM- and PB-derived MSCs was determined at P2 by flow cytometry with a FACSCalibur flow cytometer (Becton, Dickinson and Company, Le-Pont-deClaix, France, http://www.bdbiosciences.com) using a 488-nm argon laser. Cells from single-cell suspension were incubated for 60 minutes at 4°C with monoclonal antibodies (Abs) against rat antigens, including CD31 (clone TLD-3A12; Serotec, Cergy St. Christophe, France, http://www.serotec.com), CD44 (clone OX-50; Serotec), CD45 (clone MRC OX-1; Serotec), CD54 (clone 1A29; Serotec), CD73 (clone 5F/B9; Becton, Dickinson and Company) and CD90 (clone MRC OX-7; Serotec). Irrelevant isotype-identical Abs (clone F8 –11-13; Serotec) served as negative control. Specific and unspecific Ab binding was detected with a secondary phycoerythrin-labeled anti-mouse Ab (Serotec). Samples were analyzed by collecting 10,000 events using Cell-Quest software (Becton, Dickinson and Company).

MSC Differentiation P2 BM- and PB-derived MSC differentiation potential was evaluated as follows. Adipogenic Induction. Cells were cultured for 14 days in ␣-MEM containing 10% (vol/vol) FCS, 100 ␮M isobutyl methylxanthine (Sigma-Aldrich), 60 ␮M indomethacin (Sigma-Aldrich), 1 ␮g/ml insulin (Sigma-Aldrich), and 0.5 ␮M hydrocortisone (Sigma-Aldrich), with medium changes every 3 days. Adipogenic differentiation was shown by cellular accumulation of large (⬃5 ␮m in diameter) lipid vacuoles that were stained with oil red O (Sigma-Aldrich) and counterstained with 4,6diamidino-2-phenylindole (AbCys). Osteogenic Induction. Cells were cultured for 21 days in ␣-MEM containing 20% (vol/vol) FCS, 0.1 ␮M dexamethasone (Sigma-Aldrich), 2 mM ␤-glycerophosphate (Sigma-Aldrich), and 150 ␮M ascorbic acid (Invitrogen); medium was changed every 3 days. Mineralization areas were revealed by von Kossa’s stain. Chondrogenic Induction. Cells at 80% confluence were trypsinized with 0.05% (vol/vol) trypsin-EDTA and resuspended in low-glucose DMEM containing 1 mM dexamethasone (Sigma-Aldrich), 1 mM sodium pyruvate (Invitrogen), 1⫻ insulin-transferrin-selenium (Invitrogen), 17 mM ascorbic acid (Invitrogen), 35 mM proline (Sigma-Aldrich), and 10 ng/ml transforming growth factor ␤1 (R&D Systems). Viable cells were counted and seeded at a density of 5 ⫻ 105 cells per pellet in 15-ml conical tubes. Cells were gently centrifuged to the bottom of the tubes and allowed to form compact cell pellets, then incubated in a humidified atmosphere at 37°C with 5% CO2 with medium changes every 3 days. After 21 days in

Hypoxia-Induced Mesenchymal Stem Cell Mobilization

2204

Table 1. Primers used for reverse transcription-polymerase chain reactions Target cDNA

Accession numbers

Housekeeping gene

Rplp0

NM_022402

Adipogenic differentiation

Lpl

NM_012598

Pparg2

NM_013124

Bglap2

NM_013414

Runx2

XM_346016

Col2a1

NM_012929

Col10a1

AJ131848

Osteogenic differentiation

Chondrogenic differentiation

Primer sequence (5ⴕ–3ⴕ) 5⬘: 3⬘: 5⬘: 3⬘: 5⬘: 3⬘: 5⬘: 3⬘: 5⬘: 3⬘: 5⬘: 3⬘: 5⬘: 3⬘:

TTTGGGCATCACCACTAAAATCTCCAGAG GCTCCCACCTTGTCTCCAGTCTTTATCAG CAGGATGCAACATTGGAGAAGCCATTC GGAGTCAATGAAGAGATGGATGGAGCG CTCCTGTTGACCCAGAGCATGGTGC TGATTCCGAAGTTGGTGGGCCAG TCTGCTGGCCCTGACTGCATTCTG CACCACCTTACTGCCCTCCTGCTTG CTCGCACTGGCGGTGCAACAAG TCTCATCATTCCCGGCCATGACG GAACAAGGACCCAGAGGTGACCGTG CAGGATTTCCAGGGGTACCAGGTTCTC TTGGACCACCAGGTATCCCAGGATTC GGGAGACCAGGCTCTCCAGTATGACC

Product size (bp) 87 113 114 109 107 97 160

Abbreviations: Bglap2, bone ␥-carboxyglutamate (gla) protein 2/osteocalcin; bp, base pair; Col10a1, pro-␣1(X) collagen; Col2a1, pro␣1(II) collagen; Lpl, lipoprotein lipase; Pparg2, peroxisome proliferator activated receptor ␥2; Rplp0, acidic ribosomal phosphoprotein large P0; Runx2, runt-related transcription factor 2.

culture, pellets were embedded in paraffin. Cartilage glycosaminoglycans were detected by staining with Safranin O (SigmaAldrich).

Reverse Transcription-Polymerase Chain Reaction Analysis Total RNA was extracted from undifferentiated (control) and differentiated BM- and PB-derived MSCs using Trizol reagent (Invitrogen). A total of 100 ng of RNA was analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using SuperScript One-Step RT-PCR with Platinum Taq system (Invitrogen). Polymerase chain reaction was carried out with primers specific for rat acidic ribosomal phosphoprotein large P0 (Rplp0), lipoprotein lipase (Lpl), peroxisome proliferator-activated receptor ␥2 (Pparg2), bone ␥-carboxyglutamate protein 2 (Bglap2), runt-related transcription factor 2 (Runx2), pro-␣1(II) collagen (Col2a1), and pro-␣1(X) collagen (Col10a1) (Table 1). Amplified cDNA fragments were electrophoresed through a 2% (wt/vol) agarose gel, stained by ethidium bromide, and photographed under an ultraviolet light transilluminator.

Statistical Analysis

The values presented for each group are means ⫾ SEM. Student’s t test was used for comparison of mean values between different groups.

RESULTS Hematological Parameters in Normoxic and Hypoxic Rats

Wistar rats were housed for 3 weeks in hypoxic conditions (n ⫽ 14), and none of them died; neither did control rats that were housed in normoxic conditions (n ⫽ 13). After 3 weeks, hematological parameters on PB samples were in close agreement with previous reports [30, 31]: hematocrit, hemoglobin values, and red blood cell counts were significantly increased (p ⬍ 10⫺5) in the hypoxic rat group compared with the normoxic rat group (Table 2), a finding clearly showing the effect of chronic hypoxia on erythropoiesis.

Mesenchymal and Hematopoietic Progenitor Cells Progenitor cell assays were performed on BM and PB samples from normoxic (BMN and PBN) and hypoxic (BMH and PBH) rats. As shown in Figure 1A, a dramatic increase in CFU-F frequency (of approximately 15-fold) was observed in the PB of rats subjected to chronic hypoxia (p ⬍ .001). Mean values (⫾SEM) were 1.2 ⫾ 0.2 and 17.7 ⫾ 2.9 CFU-Fs per 106 cells in PBN (n ⫽ 7) and PBH (n ⫽ 8) samples, respectively. Interestingly, CFU-F frequency in BM was unchanged by hypoxia, with values of 36.2 ⫾ 1.8 and 33.8 ⫾ 2.5 CFU-Fs per 106 cells in BMN (n ⫽ 7) and BMH (n ⫽ 8) samples, respectively. As shown in Figure 1B, the estimated total number of hematopoietic progenitor cells (HPCs) (mean ⫾ SEM) per 106 MNCs was 8,860 ⫾ 1,704 in BMN (n ⫽ 6), 11,501 ⫾ 1,773 in BMH (n ⫽ 6), 35 ⫾ 13 in PBN (n ⫽ 6) and 47 ⫾ 18 in PBH (n ⫽ 6). These total numbers were not statistically different when comparing normoxic and hypoxic rats, although limited increase of circulating CFU-GM numbers were found after hypoxia (p ⬍ .01).

Generation of MSCs Under Normoxic and Hypoxic Conditions PB cells from normoxic and hypoxic rats, set in culture in parallel to BM cells from normoxic rats, formed, by the third week, a homogeneous layer of cells that closely resembled BM MSCs (Fig. 2A). The cell surface antigen expression of PBN- and PBHderived adherent cells after two passages in culture was analyzed and compared with that of BM MSCs. The cultured adherent PBN- and PBH-derived cells were positive for CD44 (homing-associate cell adhesion molecule), CD54 (intercellular adhesion molecule-1), CD73 (ecto-5⬘-nucleotidase), and CD90 (Thy-1), but were negative for CD31 (platelet-endothelial cell adhesion molecule-1), CD45 (leukocyte common antigen) (Fig. 2B), and for CD18 (␤2 integrin), CD49d (␣4 integrin chain), and CD49f (␣6 integrin chain) (data not shown). The cell surface antigen expression pattern of PBN- and PBH-derived cells was therefore comparable to that of BM MSCs.

Rochefort, Delorme, Lopez et al.

2205

Table 2. Hematological characteristics of peripheral blood samples from normoxic and hypoxic rats Parameter White blood cellsa Red blood cellsb Hematocrit (%) Hemoglobin (g/l) Plateletsa

Normoxic rat blood (n ⫽ 7)

Hypoxic rat blood (n ⴝ 8)

Student’s t test p value

5.54 ⫾ 0.81 6.92 ⫾ 0.14 33.9 ⫾ 0.71 136.1 ⫾ 4.4 780 ⫾ 55

5.08 ⫾ 0.58 8.98 ⫾ 0.18 50.9 ⫾ 1.18 172.0 ⫾ 2.6 721 ⫾ 56

NS ⬍10⫺5 ⬍10⫺5 ⬍10⫺5 NS

Results are expressed by mean ⫾ SEM. NS: not significant. a Values ⫻ 109 (cells per liter). b Values ⫻ 1012 (cells per liter).

mineralized areas, and the accumulation of cartilage glycosaminoglycans. As shown in Figure 3A, PBN- and PBH-derived cells were positive for all specific markers, similarly to BM MSCs differentiated using identical protocols. In addition, PBN- and PBH-derived cells expressed mRNAs of Lpl and Pparg2 (adipocytic markers), Bglap and Runx2 (osteoblastic markers), and Col2a1 and Col10a1 (chondrocytic markers), as did BM MSCs (Fig. 3B). These results show that PB-derived adherent cells collected from normoxic and hypoxic rats display a trilineage-differentiation potential comparable to that of BM MSCs. Taken together, our results (CFU-Fs, differentiation potential, and immunophenotype) indicate that blood-derived adherent cells are bona fide MSCs.

DISCUSSION

Figure 1. Mesenchymal and hematopoietic progenitor cell frequencies in bone marrow (BM) and peripheral blood (PB). (A): CFU-F frequency. Number of CFU-Fs (mean ⫾ SEM) per 106 cells from seven BMN and PBN samples and eight BMH and PBH samples. ⴱ p ⬍ .001. (B): CFU-GM, CFU-M, CFU-E, BFU-E, and CFU-Mix frequency. Number of hematopoietic progenitor cells (mean ⫾ SEM) per 106 MNCs in BMN (n ⫽ 6), BMH (n ⫽ 6), PBN (n ⫽ 6), and PBH (n ⫽ 6). ⴱp ⬍ .05. Abbreviations: BFU-E, burst-forming units-erythroid; BMH, bone marrow of hypoxic rats; BMN, bone marrow of normoxic rats; CFU-E, colony-forming units-erythroid; CFU-GM, colony-forming units-granulocyte-macrophage; CFU-M, colony-forming units-macrophage; CFU-Mix, colony-forming units-mixed lineage; PBH, peripheral blood of hypoxic rats; PBN, peripheral blood of normoxic rats.

To assess the capacity of PBN- and PBH-derived adherent cells to differentiate into mesenchymal lineages, we cultured the cells in adipogenic, osteogenic, and chondrogenic induction media for 14 –21 days. We checked by specific stainings for the presence of cytoplasmic neutral lipid vacuoles, the formation of www.StemCells.com

This study indicates that a small number of MSCs consistently circulate in the PB under stationary conditions and that the circulating pool is greatly increased by hypoxia. Remarkably, this increase is relatively specific for MSCs, since HPCs showed no or little increase under hypoxic conditions. Several studies have been carried out to isolate MSCs in humans and in animals from adult PB using culture conditions equivalent to those used for BM-derived MSCs. Some studies concluded that cells similar to BM MSCs are present in PB from humans and animals [20, 22–24], whereas other studies led to opposite conclusions [25, 26]. The discrepancy of results may be due to the relatively low frequency of such cells, making their detection all the more dependent on the models and the methods used, including species, age, previous treatment, or means of enrichment [reviewed in 32]. In the present study, we report that low levels of multipotent MSCs were detected in the PB of adult rats at steady state. Moreover, we show, to our knowledge for the first time, that the circulating blood MSC pool is dramatically increased in hypoxic animals. Mechanisms of MSC mobilization into the bloodstream are unknown. They are probably different from those involved in growth factor-induced HSC mobilization, although some reports indicate that MSCs can be detected directly or indirectly in PB grafts after such mobilization procedure [24, 33, 34]. However, this mechanism is probably a rare event since, in our experience (unpublished data), as in that of others [25], CFU-Fs are not detected in the blood of large series of patients after G-CSF infusion. The mobilizing effect of hypoxia observed in our study concerned selective by CFU-Fs, since total circulating HPC level was not significantly increased. The BM CFU-F frequency was unchanged, suggesting that hypoxia either favors MSC

2206

Hypoxia-Induced Mesenchymal Stem Cell Mobilization

Figure 2. Characteristics of BM and PBderived cultured adherent cells. (A): Morphology. Passage 2 adherent cells from BMN, PBN, and PBH observed by phase contrast microscopy. Scale bar ⫽ 50 ␮M. (B): Immunophenotype. Fluorescence intensity histograms with specific antibodies (Abs) for membrane antigens (black line) and irrelevant isotypic-matched Ab as negative control (gray area). Experiments were performed in triplicate. Abbreviations: BMN, bone marrow of normoxic rats; MSC, mesenchymal stem cells; PBH, peripheral blood of hypoxic rats; PBN, peripheral blood of normoxic rats.

Figure 3. Mesenchymal stem cell differentiation potential of BM- and PB-derived adherent cells. (A): Histochemistry for Ad, Os, and Ch differentiation. Passage 2 BMN-derived (a, b, c), PBN-derived (d, e, f), and PBH-derived (g, h, i) adherent cells after culture in differentiation medium (Ad, Os, or Ch). Stains used were oil red O (a, d, g), Von Kossa’s stain (b, e, h), and Safranin O stain (c, f, i). All experiments were performed in triplicate. Scale bar ⫽ 50 ␮m. (B): mRNA expression of lineage-specific genes. Passage 2 BMN-, PBN-, and PBH-derived adherent cells after culture in differentiation medium (Ad, Os, or Ch) or in Ctl proliferation medium. All experiments were performed in triplicate. Abbreviations: Ad, adipogenic; Bglap2, bone ␥-carboxyglutamate protein 2; BMN, bone marrow of normoxic rats; Ch, chondrogenic; Col2a1, pro␣1(II) collagen; Coll0a1, pro-␣1(X) collagen; Ctl, control; Lpl, lipoprotein lipase; Neg, negative (polymerase chain reaction without cDNA); Os, osteogenic; PBH, peripheral blood of hypoxic rats; PBN, peripheral blood of normoxic rats; Pparg2, peroxisome proliferator-activated receptor ␥2; Rplp0, ribosomal phosphoprotein large P0 (Rplp0).

Rochefort, Delorme, Lopez et al. egress from the BM into the bloodstream without significantly increasing the BM pool or induces the mobilization of MSCs from other non-BM sources. Recent studies have demonstrated that long-term cultures of MSCs under an atmosphere of low oxygen that closely approximates documented in vivo oxygen tension enabled these cells to optimally proliferate, to differentiate [35], and to survive after infusion in vivo [36]. These findings indicate that MSC integrity and function can be preserved under hypoxic conditions, but the in vivo effect of chronic hypoxia on MSC mobilization had not been explored in these studies. Although the role of increased levels of erythropoietin cannot be excluded from our study (evidenced by increased hematocrit and hemoglobin levels), the dissociation observed in PB between increased CFU-Fs and unchanged numbers of erythroid progenitor cells suggests that another mechanism is at play. Chronic hypoxia could induce MSC mobilization through a number of direct or indirect mechanisms, including modification of local factors involved in the maintenance of MSCs within BM or other tissues, increased PB concentration of chemotactic factors specific for MSCs and/or increased vascular permeability favored by the neoangiogenesis described in animal models similar to ours [37]. A recent study has shown that hypoxia increases the in vitro migration capacity of MSCs, a phenomenon dependent on metalloproteinases (MMPs) [38]. In addition, hypoxia has been reported to stimu-

REFERENCES 1

Owen M. Marrow stromal stem cells. J Cell Sci Suppl 1988;10:63–76.

2

Caplan AI. Mesenchymal stem cells. J Orthop Res 1991;9:641– 650.

3

Prockop DJ. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 1997;276:71–74.

4

Bianco P, Riminucci M, Gronthos S et al. Bone marrow stromal stem cells: Nature, biology, and potential applications. STEM CELLS 2001; 19:180 –192.

5

Dennis JE, Charbord P. Origin and differentiation of human and murine stroma. STEM CELLS 2002;20:205–214.

6

Minguell JJ, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med (Maywood) 2001;226:507–520.

7

Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.

8

Dennis JE, Merriam A, Awadallah A et al. A quadripotential mesenchymal progenitor cell isolated from the marrow of an adult mouse. J Bone Miner Res 1999;14:700 –709.

9

2207

late expression of MMP-2 and vascular endothelial growth factor in endothelial cells [39, 40]. Our animal model provides the opportunity to test in vivo the role of such factors in the mobilization process of MSCs. Determination of the critical factors responsible for this process is of clinical importance since they could be used further to trigger at will the mobilization of endogenous MSCs without the cumbersome cell culture expansion step, a potential source of contamination or transformation. In conclusion, we report that few MSCs circulate in the PB under stationary conditions in rats. Large amounts of MSCs can be mobilized (an increase of almost 15-fold) under hypoxic conditions. These data demonstrate that MSCs can be mobilized into the PB via stimuli distinct from those involved in hematopoietic stem cell mobilization.

ACKNOWLEDGMENTS We are grateful to Elfi Ducrocq and Marie-Christine Bernard for expert technical assistance. This work was supported by grants from the French Regional Council of Centre and the European integrated project FIRST (Further Improvement of Radiotherapy of cancer through Side effect reduction by application of stem cell Transplantation Contract 503436).

DISCLOSURES The authors indicate no potential conflicts of interest.

14 Bensidhoum M, Chapel A, Francois S et al. Homing of in vitro expanded Stro-1– or Stro-1⫹ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 2004;103:3313–3319. 15 Rochefort GY, Vaudin P, Bonnet N et al. Influence of hypoxia on the domiciliation of mesenchymal stem cells after infusion into rats: Possibilities of targeting pulmonary artery remodeling via cells therapies? Respir Res 2005;6:125. 16 Liechty KW, MacKenzie TC, Shaaban AF et al. Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat Med 2000;6:1282–1286. 17 Gutierrez-Rodriguez M, Reyes-Maldonado E, Mayani H. Characterization of the adherent cells developed in Dexter-type long-term cultures from human umbilical cord blood. STEM CELLS 2000;18:46 –52. 18 Lee MW, Choi J, Yang MS et al. Mesenchymal stem cells from cryopreserved human umbilical cord blood. Biochem Biophys Res Commun 2004;320:273–278. 19 Lee OK, Kuo TK, Chen WM et al. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 2004;103:1669 –1675.

Pereira RF, Halford KW, O’Hara MD et al. Cultured adherent cells from marrow can serve as long-lasting precursor cells for bone, cartilage, and lung in irradiated mice. Proc Natl Acad Sci U S A 1995;92:4857– 4861.

20 Naruse K, Urabe K, Mukaida T et al. Spontaneous differentiation of mesenchymal stem cells obtained from fetal rat circulation. Bone 2004; 35:850 – 858.

10 Pereira RF, O’Hara MD, Laptev AV et al. Marrow stromal cells as a source of progenitor cells for nonhematopoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta. Proc Natl Acad Sci U S A 1998;95:1142–1147.

21 Campagnoli C, Roberts IA, Kumar S et al. Identification of mesenchymal stem/progenitor cells in human first-trimester fetal blood, liver, and bone marrow. Blood 2001;98:2396 –2402.

11 Horwitz EM, Gordon PL, Koo WK et al. Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: Implications for cell therapy of bone. Proc Natl Acad Sci U S A 2002;99:8932– 8937. 12 Loeffler M, Potten CS. Stem cells and cellular pedigrees: A conceptual introduction. In: Potten CS, ed. Stem Cells. London: Academic Press, 1997:1–28. 13 Devine SM, Bartholomew AM, Mahmud N et al. Mesenchymal stem cells are capable of homing to the bone marrow of non-human primates following systemic infusion. Exp Hematol 2001;29:244 –255.

www.StemCells.com

22 Zvaifler NJ, Marinova-Mutafchieva L, Adams G et al. Mesenchymal precursor cells in the blood of normal individuals. Arthritis Res 2000;2: 477– 488. 23 Kuznetsov SA, Mankani MH, Gronthos S et al. Circulating skeletal stem cells. J Cell Biol 2001;153:1133–1140. 24 Wu GD, Nolta JA, Jin YS et al. Migration of mesenchymal stem cells to heart allografts during chronic rejection. Transplantation 2003;75:679–685. 25 Lazarus HM, Haynesworth SE, Gerson SL et al. Human bone marrowderived mesenchymal (stromal) progenitor cells (MPCs) cannot be recovered from peripheral blood progenitor cell collections. J Hematother 1997;6:447– 455.

2208

26 Wexler SA, Donaldson C, Denning-Kendall P et al. Adult bone marrow is a rich source of human mesenchymal ‘stem’ cells but umbilical cord and mobilized adult blood are not. Br J Haematol 2003;121:368 –374. 27 Bonnet P, Bonnet S, Boissiere J et al. Chronic hypoxia induces nonreversible right ventricle dysfunction and dysplasia in rats. Am J Physiol Heart Circ Physiol 2004;287:H1023–H1028. 28 NIH. Guide for the Care and Use of Laboratory Animals. NIH Publications No. 85-23. 1996. Available at http://www.eur-lex.europa.eu/ LexUriServ/site/en/com/2001/com2001_0703en01.pdf. Accessed March 20, 2006. 29 European Directives 86/609/CEE. Available at http://www.nap.edu/ readingroom/books/labrats. Accessed March 20, 2006. 30 Tanaka M, Mizuta K, Koba F et al. Effects of exposure to hypobarichypoxia on body weight, muscular and hematological characteristics, and work performance in rats. Jpn J Physiol 1997;47:51–57. 31 Melin A, Obert P, Rebocho M et al. Cardiac morphology and function following long-term exposure to carbon monoxide at high altitude in rats. J Toxicol Environ Health A 2002;65:1981–1998. 32 Roufosse CA, Direkze NC, Otto WR et al. Circulating mesenchymal stem cells. Int J Biochem Cell Biol 2004;36:585–597. 33 Goan SR, Junghahn I, Wissler M et al. Donor stromal cells from human blood engraft in NOD/SCID mice. Blood 2000;96:3971–3978.

Hypoxia-Induced Mesenchymal Stem Cell Mobilization

34 Tondreau T, Meuleman N, Delforge A et al. Mesenchymal stem cells derived from CD133-positive cells in mobilized peripheral blood and cord blood: Proliferation, Oct4 expression, and plasticity. STEM CELLS 2005;23:1105–1112. 35 Lennon DP, Edmison JM, Caplan AI. Cultivation of rat marrow-derived mesenchymal stem cells in reduced oxygen tension: Effects on in vitro and in vivo osteochondrogenesis. J Cell Physiol 2001;187:345–355. 36 Iwase T, Nagaya N, Fujii T et al. Comparison of angiogenic potency between mesenchymal stem cells and mononuclear cells in a rat model of hindlimb ischemia. Cardiovasc Res 2005;66:543–551. 37 Hyvelin JM, Howell K, Nichol A et al. Inhibition of Rho-kinase attenuates hypoxia-induced angiogenesis in the pulmonary circulation. Circ Res 2005;97:185–191. 38 Annabi B, Lee YT, Turcotte S et al. Hypoxia promotes murine bonemarrow-derived stromal cell migration and tube formation. STEM CELLS 2003;21:337–347. 39 Ben-Yosef Y, Lahat N, Shapiro S et al. Regulation of endothelial matrix metalloproteinase-2 by hypoxia/reoxygenation. Circ Res 2002;90: 784 –791. 40 Ottino P, Finley J, Rojo E et al. Hypoxia activates matrix metalloproteinase expression and the VEGF system in monkey choroid-retinal endothelial cells: Involvement of cytosolic phospholipase A2 activity. Mol Vis 2004;10:341–350.