Veterinary Microbiology 163 (2013) 325–334
Contents lists available at SciVerse ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Mycobacterium avium subspecies paratuberculosis isolates from sheep and goats show reduced persistence in bovine macrophages than cattle, bison, deer and wild boar strains regardless of genotype ˜ o a, Iker A. Sevilla a, Jose´ Miguel Prieto b, Joseba M. Garrido a, Ramon A. Juste a, Naiara Abendan Marta Alonso-Hearn a,* a Department of Animal Health, Basque Institute for Agricultural Research and Development, NEIKER-Tecnalia, Technological Park of Bizkaia, Berreaga 1, Derio, E-48160 Bizkaia, Spain b Department of Agriculture of the Regional Government of the Principality of Asturias, Serida, Grado, Asturias, Spain
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 August 2012 Received in revised form 17 December 2012 Accepted 24 December 2012
Assessment of the virulence of isolates of Mycobacterium avium subsp. paratuberculosis (Map) exhibiting distinct genotypes and isolated from different hosts may help to clarify the degree to which clinical manifestations of the disease in cattle can be attributed to bacterial or to host factors. The objective of this study was to test the ability of 10 isolates of Map representing distinct genotypes and isolated from domestic (cattle, sheep, and goat), and wildlife animal species (fallow deer, deer, wild boar, and bison) to enter and grow in bovine macrophages. The isolates were previously typed using IS1311 PCR followed by restriction endonuclease analysis into types C, S or B. Intracellular growth of the isolates in a bovine macrophage-like cell line (BoMac) and in primary bovine monocyte-derived macrophages (MDM) was evaluated by quantification of CFU numbers in the initial inoculum and inside of the host cells at 2 h and 7 d p.i. using an automatic liquid culture system (Bactec MGIT 960). Individual data illustrated that growth was less variable in BoMac than in MDM cells. All the isolates from goat and sheep hosts persisted within BoMac cells in lower CFU numbers than the other tested isolates after 7 days of infection regardless of genotype. In addition, BoMac cells exhibited differential inflammatory, apoptotic and destructive responses when infected with a bovine or an ovine isolate; which correlated with the differential survival of these strains within BoMac cells. Our results indicated that the survival of the tested Map isolates within bovine macrophages is associated with the specific host from which the isolates were initially isolated. ß 2013 Elsevier B.V. All rights reserved.
Keywords: M. avium subsp. paratuberculosis Bovine macrophages Host–pathogen interaction Host adaptation Host response Strain diversity Pathogenesis
1. Introduction Mycobacterium avium subsp. paratuberculosis (Map) is the causal agent of Johne’s disease or paratuberculosis, a chronic gastrointestinal disease of domestic and wildlife animal species. Broadly speaking, Map isolates can be
* Corresponding author. Tel.: +34 944 034350; fax: +34 944 034310. E-mail address:
[email protected] (M. Alonso-Hearn). 0378-1135/$ – see front matter ß 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetmic.2012.12.042
classified in two genotypes based on culture characteristics and on genome analysis: sheep isolates (also called ‘‘S type’’ or ‘‘type I’’) and cattle isolates (also called ‘‘C type’’ or ‘‘type II’’) (Collins et al., 1990; Stevenson et al., 2002). Single nucleotide polymorphism analysis of the IS1311 insertion sequence distinguishes three types of strains: S, C and B (Whittington et al., 2001a). Although the classification of strains into C, S or B types may reflect a host preference, isolates of Map can cross these species barriers and be isolated from a broad range of animal species
326
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
(Muskens et al., 2001; Moloney and Whittington, 2008; Stevenson et al., 2009). Map is endocytosed by the M cells of the ileal Peyer’s patches and subsequently phagocytosed by subepithelial and intraepithelial macrophages (Harris and Barletta, 2001; Bermudez et al., 2010). Once inside host macrophages, there is both intracellular replication of Map and bactericidal activity by the host which reflects an initial T-helper 1 (Th1) cellular immune response (Zhao et al., 1999; Rowe and Grant, 2006; Alonso et al., 2007; Woo et al., 2007). However, since many phagosomes containing Map fail to mature, this can lead to intracellular persistence. We recently refined a method to quantitate Map by generating equations that relate the time to detection (TDD) recorded in an automatic liquid culture system (Bactec MGIT 960) to the estimated log10 CFU numbers ˜ o et al., 2012). In the present in an inoculum (Abendan present study, this method was used to assess the growth in bovine macrophages of 10 isolates of Map representing distinct genotypes and isolated from a diverse range of hosts. We then evaluated the characteristics of the cytokine profile generated in bovine macrophages by two of the Map isolates that exhibited differential intracellular growth pattern. The identification of isolates of Map with differential virulence may assist in further elucidating the pathogenesis of paratuberculosis and in the design of better strategies for controlling the infection. 2. Materials and methods 2.1. Map isolates, bacterial culture and preparation of bacterial suspensions Nine Map isolates from cattle (Bos taurus), sheep (Ovis aries), goat (Capra aegagrus hircus), red deer (Cervus elaphus), fallow deer (Dama dama), bison (Bison bison) and wild boar (Sus scrofa) species were selected from the collection of isolates at the Mycobacteria laboratory, NEIKER-Tecnalia, on the basis of varied hosts and genomic profiles as per Sevilla et al. (2007). These isolates of Map were previously recovered from fecal or tissue specimens of domestic or wildlife animal species and maintained as glycerol stocks at 80 8C (Aduriz et al., 1995; Sevilla et al., 2005). Aliquots of these glycerol stocks were utilized to directly inoculate all subsequent cultures for use in infection of macrophages, so that all infections were performed with organisms which had undergone only one previous laboratory passage. Most of the specimens were collected in several geographic areas of Spain, but two strains isolated in Portugal and United States were also included in the study. Map reference strain K10, a sequenced and laboratory-adapted strain recovered from a clinical case of paratuberculosis, was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). The 10 isolates of Map selected for our study were grown in T25 tissue culture flasks at 37 1 8C for up to 3 months in 10 ml of Middlebrook 7H9 broth (Difco Laboratories, Detroit, MI) supplemented with 10% (v/v) oleic acid-albumin-dextrose-catalase (OADC) (Becton, Dickinson and Company, Franklin Lakes, NJ), 0.05% (w/v) Tween-80 (Sigma–Aldrich, St. Louis, MO) and
2 mg l 1 of Mycobactin J (Allied Monitor Inc., Fayette, MO). Bacterial cells were harvested by centrifugation at 2000 g for 20 min in a Beckman Coulter Allegra X-12 centrifuge. Bacterial pellets were washed three times with sterile Hanks balanced salt solution (HBSS), resuspended in 2 ml of HBSS, and the resultant suspension was passed 20 times through a 27-gauge needle in order to declump cells. The turbidity of the bacterial suspension was adjusted to a McFarland standard of 1 with a Densimat (bioMerieux, Marcy l’Etoile, France). Only the top fraction of the suspension containing dispersed bacteria was used for the infection assays. 2.2. BoMac and monocyte-derived macrophages culture A SV40-transformed bovine peritoneal macrophage cell line (BoMac) was obtained from Dr. J.R. Stabel and maintained as previously described (Stabel and Stabel, 1995). For isolation of bovine mononuclear cells, peripheral blood was collected from the jugular vein of healthy Holstein cows older than 24 months at the time of slaughter. The blood was collected into heparinised Vacutainer tubes (Becton, Dickinson and Company, Sparks, MD), transferred under sterile conditions into sterile glass bottles and diluted 1:2 in HBSS. Twenty-five millilitres of blood:HBSS were layered over 10 ml of Ficoll–Paque (1084 g/cm3) (GE HealthCare Bio-Sciences, Uppsala, Sweden) in 50-ml centrifuge tubes. Cells were centrifuged at 900 g for 30 min to separate erythrocytes and polymorphonuclear cells from peripheral blood mononuclear cells (PBMC). PBMC were collected from the HBSS–Ficoll– Paque interface and washed three times with HBSS by centrifugation at 400 g for 10 min. The isolated PBMC were resuspended in RPMI-1640 supplemented with 20 mM L-glutamine, 10% heat-inactivated fetal bovine serum, 100 U/ml of penicillin and 100 mg ml1 of streptomycin (Lonza, Verviers, Belgium). PBMC were seeded at a density of 1 106 PBMC/ml into 24-well tissue culture plates and incubated for 2 h at 37 8C in a 5% CO2 incubator. Non-adherent cells were removed by washing twice with HBSS. Adherent cells were incubated for 7 days at 37 8C in supplemented RPMI-1640 medium to allow differentiation to monocyte-derived macrophages (MDM) prior to infection with Map. 2.3. Infection of BoMac cells and bovine MDM with Map Briefly, BoMac cells or differentiated MDM were inoculated in triplicate with 100 ml of single-cell suspensions of each of the 10 Map isolates (McFarland standard of 1). This level of infection did not alter cell viability over a 1week assay as was previously assessed by Trypan blue staining. After a 2 h infection time, the supernatant was removed and the cells were washed twice with HBSS to remove extracellular bacteria. Infected macrophages were lysed at this time point (considered as day 0) or cultured in supplemented RPMI-1640 medium without antibiotics at 37 8C for 7 days (day 7). At each time point, the supernatant was aspirated and infected macrophages were lysed by vigorous pipetting with 0.5 ml of 0.1% Triton X-100 (Sigma–Aldrich) in sterile water for 10 min.
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
327
Table 1 IS1311 PCR-REA types, PFGE profiles, and estimations of span, K, and plateau for the quantification of each Map isolate in the Bactec MGIT 960 system.a Isolate code
Region/country
Host
IS 1311 PCR-REA type
PFGE profile
Span
K
Plateau
K10 6 P38I 2349/06-1 711 311 855 622/07 681 6.1
United States Cantabria/Spain Aragon/Spain Portugal Bizkaia/Spain Menorca/Spain Toledo/Spain Asturias/Spain Toledo/Spain United States
Cattle Cattle Sheep Sheep Goat Goat Deer Fallow Deer Wild boar Bison
C C C S C S C C C B
1-1 52-1 2-1 – 2-1 16-47 68-1 – 2-1 2-1
11.48 16.44 9.972 11.82 17.25 9.511 10.95 21.06 8.755 13.35
0.0503 0.0220 0.0211 0.0724 0.0301 0.0612 0.1927 0.0106 0.0486 0.0881
1.316 6.080 0.634 3.222 8.208 3.016 1.317 11.25 0.760 1.710
a Growth of all the isolates in the Bactec MGIT 960 system fitted to a one-phase exponential-decay model according to the following equation (log10 inoculum size = span X e (K X TTD) + plateau). Span is the difference between TTD at time zero and the plateau, K is the degree of decay for the log10 CFU, and plateau is the value for log10 CFU curve flattening.
2.4. Viable Map quantification using the Bactec MGIT 960 system Supplemented Mycobacteria Growth indicator tubes (MGIT) (Becton, Dickinson and Company, Sparks, MD) were inoculated with 0.1 ml of each initial bacterial suspension or with 0.5 ml of the cell lysates for each time point. Each MGIT tube contained 7 ml of modified Middlebrook 7H9 broth base with casein peptone and an oxygen-sensitive fluorescent compound (tris-4,7diphenyl-1,10-phenathroline ruthenium chloride pentahydrate) embedded in silicone on the bottom of the tube. Each tube was supplemented with 800 ml of an enrichment supplement (BBL MGIT OADC growth supplement) and an antibiotic mixture (BBL MGIT PANTA Antibiotic Mixture) (Becton, Dickinson and Company). It is very well established that egg yolk is necessary for Map primary isolation but not for subculture (Cousins et al., 1995). Since all infections in MDM and BoMac cells were performed with Map organisms which had undergone one previous laboratory passage, the addition of egg yolk to MGIT tubes was unnecessary. The tubes were also supplemented with 2 mg ml1 of Mycobactin J. Inoculated vials were incubated at 37 2 8C for up to 41 days in the Bactec MGIT 960 instrument (Becton, Dickinson and Company) and were monitored automatically every hour for an increase of fluorescence. The earliest instrumental indication of positivity (i.e., time to detection (TTD)) for each tube was recorded. Any tube that was identified as positive was removed from the instrument, and a sample was tested by PCR to confirm the presence of Map. If a tube did not signal positive before 42 days (6 weeks) of incubation, it was removed from the instrument and determined to be negative. The predicted number of bacilli in each positive tube was calculated by using previously generated mathematical formulas which relates TTD (in days) to estimated log10 CFU numbers for each specific Map isolate (Table 1) (Abendan˜o et al., 2012). 2.5. Assessment of uptake, intracellular growth and persistence of Map isolates in BoMac cells Mean log10 CFU numbers from three replicate assays were calculated and statistically analyzed to compare the uptake, growth and persistence of the selected Map isolates
in BoMac cells. The percentages of uptake were calculated as the percentages of the inoculated bacteria that were recovered from each cell lysate at day 0. The intracellular growth of each isolate was expressed as the mean log10 increases in numbers of intracellular CFU from day 0 through day 7 of infection, calculated as the difference between day 7 and day 0 log10 CFU numbers. Growth ratios (fold) between day 0 and day 7 were calculated by dividing the number of log10 CFU numbers at day 7 by that at day 0. A growth ratio greater than 1 indicated that the strain exhibited multiplication inside bovine macrophages, whereas a growth ratio of less than 1 indicated that the bacteria was engulfed and gradually killed by macrophages. The ability of each Map isolate to persist within host cells is presented as the log10 CFU at day 7. 2.6. RNA isolation, c-DNA synthesis, and detection of several cytokines and proteins involved in apoptosis or tissue destruction by a two-step quantitative reverse-transcription PCR (qRT-PCR) BoMac cells were cultured and inoculated with two isolates of Map exhibiting differential growth pattern in bovine macrophages (isolates 6 and 2349/06-1). Uninfected cells were used as controls. At 4, 14 and 24 h p.i., the infected BoMac cells were lysed in 1 ml of Trizol and the total RNA was extracted following the manufacturer’s instructions (Life Technologies, Carlsbad, California). The extracted RNA was treated with Turbo DNase I (Life Technologies) for 20 min at 37 8C to eliminate genomic DNA contamination from the total RNA. The purity and yield of the RNA samples was analyzed using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE). RNA quality was determined by measuring the 260/ 280-nm absorbance ratio, and ratios of 1.8 or higher were considered acceptable for purified RNA. Total RNA was then reverse transcribed to c-DNA using the SuperScript VILO cDNA synthesis kit following the manufacturer’s instructions (Life Technologies). The reaction mixtures contained 2 ml of 10 X SuperScript Enzyme Mix, 4 ml of 5 X VILO Reaction Mix and 0.5 mg of RNA in a 20 ml cDNA synthesis reaction. Control reactions, lacking reverse transcriptase, were performed for every RNA sample. The reaction mixtures were incubated at 25 8C for 10 min,
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
328
Table 2 Genes and primer sequences used in the qRT-PCR assays. Code sequence protein in GenBank
Name
Abbreviation
Primers code/sequence (50 –3)
Concn. (nM)
AAA30583
Interleukin 1-alpha
IL1a
1F 2R
CAGTTGCCCATCCAAAGTTGTT TGCCATGTGCACCAATTTTT
200
ABX72069
Interleukin 6
IL6
Matrix metallopeptidase 3
MMP3-1
NP_776896
TIMP Metallopeptidase inhibitor 1 Interleukin 10
TIMP-1
XP_592497
Transforming growth factor, beta 1
TGFb-1
GCTGCTCCTGGTGATGACTTC GGGTGGTGTCATTTTTGAAATCTT TGATGTCGACGGCATTCAGT GGGCACCACAGGGTCATTAG ATGCTGCTGGTTGTGAGGAAT TGTCGCTCTGCAGTTTGCA CTTGTCGGAAATGATCCAGTTTT TCAGGCCCGTGGTTCTCA TGAGCCAGAGGCGGACTACT TGCCGTATTCCACCATTAGCA
100
XP_586521
5F 6R 15F 16R 17F 18R 25F 26R 27F 28R
NP_776391
Tumor necrosis factor, member 2
TNFa-2
29F 30R
CGCATTGCAGTCTCCTACCA GGGCTCTTGATGGCAGACA
100
NP_776511
Interferon gamma
IFNg
Nuclear gene encoding mitocondrial protein Beta-actin
BCL2-1
GGTCATTCAAAGGAGCATGGA GCTGCCATTCAAGAACTTCTGA CACCCCAGGGACAGCATA CGTCCCGGAAGAGTTCATTC ATGCTTCTAGGCGGACTGTTAG ACAAATAAAGCCATGCCAATCT
100
NP01070954
33F 34R 41F 42R 43F 44R
ABX72072
AAM98378
IL10
b-actin
42 8C for 90 min and 85 8C for 5 min. Real-time qPCR primers for the amplification of each selected host gene were designed using PrimerExpress 3.0 software and verified for theoretical non-specific annealing with PrimerBlast. Table 2 shows the list of the amplified bovine genes and the corresponding primer sequences. Briefly, real-time qPCR reactions were carried out in 20-ml reaction mixtures containing 10 ml of SYBR GreenER qPCR Supermix Universal (Life Technologies), the optimum concentration for each pair of primers and 1 ml of cDNA. Previously, we determined the concentration of each pair of primers (50, 100 or 200 nM) that provided optimal assay performance (minimum CT and maximum DRn) using c-DNA synthesized from non-infected cells as template, but did not produce nonspecific product formation with negative controls (Table 2). Real-time qPCR amplifications of cDNA were accomplished using the ABIPrism 7500 detection system (Applied Biosystem, Carlsbad, CA) under the following conditions: 1 cycle of 50 8C for 2 min, 95 8C for 10 min; 40 cycles of denaturation at 95 8C for 15 s, annealing at 60 8C for 60 s, and a melting curve analysis to measure the specificity of the amplification. Since the bactin gene is constitutively expressed, it was used as the endogenous control in the assays. To determine the changes in gene expression (n-fold) or relative quantitation (RQ), the following formula was used: RQ ¼ 2DðDC T Þ where DCT is CT (target) CT (b-actin) and D(DCT) is DCT (experimental) DCT (control). Results were expressed as relative quantification of transcription compared to those of control uninfected cells. 2.7. Statistical analysis Fisher’s exact test was employed to compare percentages of uptake (GraphPad Software, San Diego, CA). Intracellular growth after 7 days calculated as the mean log10 increase in
200 200 200 200
100 200
numbers of intracellular CFU between days 0 and 7 of culture, and log10 CFU at day 7 for all the isolates were compared by one-way analysis of variance (ANOVA) with the Tukey-Kramer multiple-comparison post-test of the InStat v 3.10 for Windows 95 (GraphPad Software). Log10 CFU numbers in the initial inoculum and at day 0 and 7 in BoMac and MDM were also compared by ANOVA with the GLM procedure of the SAS Software (SAS Institute Inc., Cary, NC). In the analysis; time p.i. (0 and 7 days), strain genotype (C, S and B), host of origin (cattle, sheep, goat, deer, bison, wild-boar, and fallow-deer) and cell model (BoMac and MDM) were considered as main effects. Statistical analysis of cytokine production, and log10 CFU numbers at days 0 and 7 for each Map isolate were compared by a t-test (GraphPad Software). In all analyses, differences were considered significant when P values were 0.05). However, significant differences between the log10 CFU numbers at day 0 and 7 p.i. were observed in both BoMac and MDM cells (ANOVA GLM Procedure, P < 0.001). Fig. 1 illustrates the variability in intracellular growth displayed by the various Map isolates in BoMac and MDM cells. As illustrated, the individual data indicated that growth was less variable in BoMac than in MDM cells. 3.2. Uptake, growth and persistence of Map isolates in BoMac cells As shown in Table 3 the percentages of uptake in BoMac cells were estimated in a range between 62 and 83% of the initial inoculum, depending of the isolate. When the percentages of uptake of all the Map isolates were compared, no statistical differences were obtained confirming that the different strains behaved similarly in the
initial binding (Fisher’s exact test, P > 0.05). The intracellular growth observed for each isolate between day 0 and day 7 in BoMac cells, as represented by the calculated fold change is showed in Table 3. Among the 10 tested isolates, 7 isolates (6.1, 622/07, 6, 681, 855, 2349/06-1, 711P) and the reference strain K10 exhibited growth as >1-fold the initial bacterial concentration. Two isolates (P381 and 311) showed reductions in bacterial counts. Statistical analysis of the data indicated that the isolates from cattle, bison, fallow deer, wild boar, and deer hosts and the sheep strain with S-genotype exhibited significantly increased bacterial counts after 7 days of infection when compared with baseline (t-test, P < 0.001). For instance, the bovine reference strain K10 and the bovine isolate 6 grew by 1.84 and 1.58-fold from day 0 to day 7 in BoMac cells incubated at 37 8C, respectively. Similarly, the isolates from wildlife animal species exhibited significantly increased bacterial counts in BoMac cells over 7 days
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
330
Table 3 Entry and intracellular growth of Map isolates and the reference strain K10 in BoMac cells. Isolate code
Host-IS1311 PCR/REA type
Entry (%)a
Estimated log10 CFU ( SD)b Day 0
K10 6.1 622/07 6 681 855 2349/06-1 711P P381 311 a b c d e f g
Cattle C Bison B Fallow deer C Cattle C Wild boar C Deer C Sheep S Goat C Sheep C Goat S
70.91 72.30 66.90 76.19 82.60 73.55 61.69 83.30 67.56 67.91
4.03 4.00 3.81 5.40 4.84 4.74 4.07 5.15 4.54 4.24
c
( 0.31) (0.68) ( 0.36) ( 0.44) ( 0.27) ( 0.00) ( 0.11) ( 0.61) ( 0.13) ( 0.20)
Foldd
Relative increases in log10 CFUe
1.84f 2.20f 2.17f 1.58f 1.45f 1.35f 1.31f 1.04 0.98 0.95
3.39 4.80 4.46 3.15 2.20 1.68 1.2g 0.2g 0.1g 0.2g
Day-7 7.42 8.80 8.27 8.55 7.04 6.41 5.32 5.38 4.43 4.03
( ( ( ( ( ( ( ( ( (
0.65) 0.22) 0.82) 0.51) 1.05) 0.19) 0.20)g 0.11)g 0.30)g 0.06)g
Entry was calculated as the percentage of the inoculated bacteria that was recovered from each cell lysate at day 0. Values shown are means of three repeated experiments standard deviations (SD). Day 0 = 2 h post infection. Growth ratios (fold) were calculated by dividing the number of log10 CFU at day 7 by that at day 0 for each Map isolate. Growth is presented as the mean log increases in numbers of intracellular CFU from day 0 through day 7 of infection. Indicates a significant change between day 0 and day 7 (P < 0.05). Indicates the isolates for which log CFU values differed significantly from that of the reference strain K10 (P < 0.05).
from the baseline, in a range between 2.20 and 1.35-fold (ttest, P < 0.05). In contrast, the sheep isolate with Sgenotype and the goat isolate with C-genotype showed the smallest variations in bacterial counts over 7 days from the baseline; 1.31 and 1.04-fold, respectively. The other two isolates from small ruminants, the goat isolate with an S genotype and the C-type isolate from sheep, showed reductions in bacterial counts over 7 days from baseline which indicated that these bacterial isolates were gradually killed by macrophages (t-test, P = 0.1575 and P = 0.5439, respectively). The intracellular growth exhibited for each isolate calculated as the mean log increase in numbers of intracellular CFU within BoMac cells between days 0 and 7 of culture is shown in Table 3. The six more rapidly growing isolates were obtained from cattle, bison, fallow deer, wild boar and deer hosts; with log10 CFU increases in a range between 4.80 and 1.68. By day 7, the K10 strain grew by 3.39 log10 CFU. In contrast, two isolates from sheep and goat hosts (2349/06-1 and 711) only grew 1.24 and 0.23 log10 CFU, respectively. The goat isolate with S genotype and the sheep isolate with C genotype showed a decrease in bacterial counts of 0.21 and 0.10 log10 CFU, respectively. Statistical analysis of the data indicated that there were no significant differences between the reference strain K10 or the bovine isolate 6, and the isolates from bison, fallow deer, wild boar and deer hosts in their ability to grow in BoMac cells (ANOVA, P > 0.05). Between the isolates from wildlife animal species no differences in growth in BoMac cells were observed. Although the sheep isolate with an S-genotype was able to grow in BoMac cells (1.31-fold and 1.24 log10 CFU increase), statistical analysis of the data indicated that all the isolates from goat and sheep hosts with S and C genotypes displayed significantly less growth than that of the K10 reference strain (ANOVA, P < 0.05). The ability of each Map isolate to persist within BoMac cells is presented as the estimated mean log10 CFU at day 7 in Table 3. After 7 days, the mean log10 CFU for the K10 strain, the bovine isolate 6 and the isolates from bison, fallow deer, wild boar and deer hosts were not significantly
different (ANOVA, P > 0.05). Statistical analysis of the data indicated that the mean log10 CFU at day 7 for the cattle, bison, fallow deer, wild boar and deer isolates were significantly higher than for all the isolates obtained from goat and sheep hosts (ANOVA, P < 0.05). 3.3. Differential gene expression in BoMac cells infected with a bovine or an ovine isolate of Map Two Map isolates that showed differential growth and persistence in BoMac cells were selected for gene expression analysis in infected BoMac cells. Mean foldchanges in gene expression between infected and noninfected cells as determined through real-time qRT-PCR analysis are shown in Fig. 2. Significant differences in the expression of several cytokines (IL6, TGFb-1, TNFa-2, IFNg, IL1a), genes related to apoptosis (BCL2-1) or tissue destruction (MMP3-1) after the infection of BoMac cells with the bovine or the ovine isolates were observed. Infection of BoMac cells with the bovine isolate resulted in a significant up-regulation of the interleukin-6 (IL6) at 14 and 24 h p.i. when compared with cells infected with the ovine isolate (t-test, P = 0.041 and P = 0.013). A significant up-regulation of the anti-inflammatory cytokine TGFb-1 was also detected in BoMac cells infected with the bovine isolate at 24 h p.i. when compared with cells infected with the ovine isolate (t-test; P = 0.009). Although differences were not statistically significant, the bovine isolate induced higher IL10 production at 14 or 24 h p.i. than the levels induced by the ovine isolate (ttest; P = 0.327 and P = 0.208, respectively). In contrast, BoMac cells infected with the ovine isolate showed a reduced anti-inflammatory response and a significant increase in the amount of the pro-inflammatory cytokine IL1a at 14 and 24 h p.i. when compared with cells infected with the bovine isolate (t-test, P = 0.001 and P = 0.002). It is possible that the increase in IL6 and TGFb1 expression 4 h after the infection with the ovine isolate was an initial response which was then quickly suppressed by the activation of IL1a.
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
331
Fig. 2. Expression of cytokines and proteins involved in apoptosis or tissue destruction in BoMac cells infected with the bovine isolate 6 (A) or with the ovine isolate 2349/06-1 (B) as measured by qRT-PCR at 4, 14 and 24 h p.i. Bars represented the average results of two independent infection experiments. Error bars represent SD between the two replicates. Statistically significant differences in the expression of the indicated genes between the two isolates of Map are showed with an asterisk (P < 0.05).
In regard to the apoptotic response, BoMac cells infected with the bovine isolate for 4 and 14 h p.i. had increased levels of expression of the apoptotic inhibitor BCL2-1 which might cause lower levels of apoptosis than in BoMac cells infected with the ovine isolate (t-test, P < 0.001). Significant decreased MMP3-1 expression was also found in BoMac cells infected with the bovine isolate at 4 and 24 h p.i. when compared with the levels of expression of this metalloprotease in cells infected with the ovine isolate (t-test; P = 0.002 and P < 0.001, respectively). Differences in induction of the inhibitor of tissue destruction TIMP-1 were not statistically significant at any of the time points studied but the bovine isolate did induce more TIMP-1 at 4 h p.i. than did the ovine isolate. 4. Discussion In the absence of a well characterized animal model, in vitro models (i.e., peripheral blood MDM and BoMac cells) provide an indirect tool to study Map–host interactions at the early events of the infection. BoMac is an in vitro differentiated macrophage-like cell line of bovine origin that has advantages over MDM cells in that the variability between donors commonly encountered with MDM is avoided, and that large numbers of cells can be readily grown and differentiated. In addition, BoMac cells develop macrophage functions including the ability to phagocytize bacteria, lyse chicken red blood cells with and without opsonization, generate reactive oxygen species (ROS),
produce key cytokines, and have the ability to participate in antibody-independent and antibody-dependent cellular cytotoxicity following activation (Stabel and Stabel, 1995; Tooker et al., 2002). Map–host cells interaction is not fully understood, in part because of the difficulties to quantify numbers of viable Map cells by routine bacteriological methods. Although previous studies have assessed the intracellular behavior of a few selected strains of Map, in the present study a panel of isolates of Map representing distinct genotypes and isolated from domestic and wildlife animal species were assessed for their intracellular growth in BoMac and bovine peripheral blood MDM cells by using an automatic culture system (Bactec MGIT 960). In BoMac cells we observed significant differences in intracellular growth and persistence between strains. In addition, a Stype isolate of Map isolated from sheep for which lower virulence is well established on epidemiological grounds (Moloney and Whittington, 2008) persisted at low levels within BoMac cells which verify the ability of this in vitro infection model to distinguish between strains of varying virulence. Previously, Janagama et al. (2006) using MDM from two donors consistently observed that a bovine isolate (B1018) remained in higher numbers within MDM cells relative to a sheep isolate (S7565). They used realtime amplification (qPCR) of the Map hsp65 gene to estimate total bacterial genome equivalents in infected MDM at 2, 16, 24, 48 and 96 h p.i., whereas we predicted numbers of viable Map organisms in cultured macrophages
332
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
at 2 h and 7 days p.i. by using the Bactec MGIT 960 system. It should be noted that qPCR quantifies total numbers of CFU and therefore it does not differentiate between viable and dead bacteria. In contrast, the Bactec MGIT 960 system is able to predict viable CFU numbers given a more realistic picture of the number of bacteria able to persist inside of macrophages at different times p.i. Due to the variable results obtained in MDM, we observed less robust differences in the intracellular growth and persistence of the tested isolates in this model of infection. Similarly, individual data illustrated the substantial variability in intracellular growth displayed by clinical isolates of M. tuberculosis in human blood monocytes from 11 subjects and this variability was observed even when monocytes from the same donor were infected with each organism (Li et al., 2002). Nevertheless, we should acknowledge that our goal was the identification of isolates of Map with differential behavior within bovine macrophages, rather than to compare the outcomes of infection within the two infection models (BoMac and MDM) which have inherent differences. All the Map isolates included in our study were internalized by BoMac cells with similar efficiency, indicating that equivalent numbers of bacteria were ingested and that the extent of phagocytosis was independent of strain type or host animal species of origin. The isolates from cattle, bison, fallow deer, wild boar and deer hosts evaluated in our study proliferated in BoMac cells more rapidly than the isolates from goat and sheep hosts. Moreover, the sheep isolate with a C genotype and the S-type isolate from goat showed reductions in bacterial counts in BoMac and in MDM as well, indicating that these bacterial isolates were killed by macrophages. When the data of all the strains were statistically analyzed, the observed differences between isolates in bovine macrophages grouped according to the host from which the isolates were isolated (ANOVA GLM Procedure, P = 0.012). In other words, the intracellular behavior of isolates of Map representing distinct genotypes varied depending of the host of origin (ANOVA GLM Procedure, P = 0.022). Similarly, strains of environmental Mycobacteria isolated from fish and humans including strains of M. avium, Mycobacterium peregrinum, Mycobacterium chelonae, and Mycobacterium salmoniphilum also had different abilities to grow within macrophages lines from humans, mice, and carp; which grouped according to the host from which the strains were isolated (Harriff et al., 2008). We observed that not all the strains with compatible abilities to enter and grow in macrophages shared genetic similarities (ANOVA GLM Procedure, P = 0.2491). In fact, our results showed that type S but also type C isolates from sheep and goat hosts showed a significant attenuated phenotype after 7 days of infection in BoMac cells, when compared with type C isolates from cattle, deer, fallow deer, wild boar and bison hosts. These findings suggested that for the isolates from sheep and goat hosts the phenotype inside of bovine macrophages was not dependent of the genotype of the infecting isolate. In other words, successful survival in macrophages was not a common characteristic of all the tested C type isolates. Similarly, a lack of correlation between genotype and
growth rate in the Bactec MGIT 960 system was also observed for the ovine isolates; with the chosen limited number of C, S and B type isolates growing at equivalent ˜ o et al., 2012). rates when cultured in MGIT tubes (Abendan Since type C strains are usually virulent strains for cattle, we can speculate that the conditions encountered within ovine or goat macrophages might alter the phenotype of the bacterium with a consequent decrease in invasiveness of bovine macrophages. Several studies have shown that virulence of many bacterial species is regulated by genes which respond to changes in environmental conditions (Mekalanos, 1992; Cossu et al., 2012). For instance, it was previously shown that growth of Map within a bovine mammary epithelial cell line (MAC-T cells) resulted in augmented ability to subsequently invade bovine epithelial cells (Patel et al., 2006). In a more recent study, it was suggested that a LuxR regulator might be involved in the regulation of the expression of genes affecting Map envelope’s composition and in the bacterium adaptation to the host (Alonso-Hearn et al., 2010). Recent data also suggest that specific Mycobacterial epitopes are present only within a given host (Janagama et al., 2010). Previously, it was shown that a bovine, a bison and a human type-C isolates induced anti-inflammatory and anti-apoptotic pathways in bovine MDM, which would favor bacterial survival and persistence (Janagama et al., 2006). In the present study, gene expression induced by two clinical isolates of Map with differential abilities to grow and survive inside BoMac cells was analyzed using qRT-PCR and the resulting data related to their differential survival phenotype in bovine macrophages. Because a strong correlation was observed between the intracellular behavior of the tested isolates and the patterns of production of specific cytokines or proteins related to apoptosis or tissue destruction (IL6, TGFb-1, IL1a, BCL2-1 and MMP3-1), the levels of expression of these proteins might be used to discriminate between isolates with differential virulence in the BoMac model. Bovine isolates of Map have been reported to induce early IL10 expression in MDM that antagonizes the pro-inflammatory cytokine response by down-regulating the production of TNFa (Weiss et al., 2005). Although we did not observed significant differences in IL10 gene expression in BoMac cells infected with our bovine or ovine isolates at any of the time points, the bovine isolate did induce more IL10 at 14 and 24 h p.i. and less TNFa-2 at 4 and 14 h p.i. than did the ovine isolate. Similarly, rapid intracellular macrophage grow rates by strains of M. tuberculosis correlated with rapid production of IL10 and suppression of TNFa in THP1 cells during the early stages of infection (Theus et al., 2005). The ovine isolate was significantly attenuated in growth in BoMac cells and this decrease in survival within the infected cells correlated with a reduced antiinflammatory response in the infected cells and with a significantly up-regulated pro-inflammatory immune response generally associated with elimination of Map and protection. This conclusion is supported by reduced expression of IL10 mRNA as well as normal levels of expression of IL6 and TGFb-1 (not different from the levels in uninfected cells) after 24 h of infection with the ovine isolate. In addition, the expression of the pro-inflammatory
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
cytokine IL1a was highly up-regulated in cells infected with the ovine isolate at 14 and 24 h p.i. and downregulated in BoMac cells infected with the bovine isolate at 24 h p.i. It is well known that the expression of IL1a in the presence of intracellular bacteria is one of the first steps leading to activation of macrophages and effective bacteria killing. Because our study used single Map isolates from various hosts carrying C or S genotypes and because there is great diversity among Map isolates, further studies with multiple isolates of these same host/genotype combinations are needed. In summary, our results showed that successful survival in BoMac cells was a common characteristic of the isolates obtained from cattle, deer, fallow deer, bison, and wild boar hosts. The successful survival within cells and the observed cytokine expression profile of the bovine isolate 6 correlated well with epidemiological data and clinical evidence of virulence, as suggested by the capacity of bovine isolates to persist for many years in different locations and to cause numerous outbreaks in cattle. In addition, the reduced survival in bovine macrophages of the isolates from goat and sheep hosts might explain why there are few reports of cattle naturally infected with Stype isolates (Whittington et al., 2001b; de Juan et al., 2005; Moloney and Whittington, 2008). It also suggests that isolates of Map from small ruminants may have less clinical consequences in cattle than Map isolates from cattle, deer, fallow-deer, bison and wild boar hosts which might have a selective advantage in causing bovine paratuberculosis. Acknowledgements Financial support for this work was provided by grants from the Instituto Nacional de Investigacio´n y Tecnologı´a Agraria y Alimentaria (INIA) and by European Funds for Regional Development (FEDER) (FAU2008-00018-C02 and RTA2011-06049). Dr. Marta Alonso-Hearn’s tenure is partly covered by the INIA tenure track program for the incorporation of PhD graduates into research institutions. ˜ o has a fellowship from the department of Naiara Abendan Agriculture of the Basque Government. Samples from fallow-deer were provided by Dr. Prieto from the Department of Agriculture of the Regional Government of the Principality of Asturias (Spain). Samples from wild-boar and deer were provided by the Instituto de Investigacio´n en Recursos Cinege´ticos (IREC). Samples from Portugal and USA were provided by A.C. Coelho and R. Whitlock, respectively. We thank Dr. Luiz Bermudez for helpful discussions. We are grateful to Kyle Hearn for the careful editing of the manuscript. References ˜ o, N., Sevilla, I.A., Garrido, J.M., Prieto, J.M., Juste, R.A., AlonsoAbendan Hearn, M., 2012. Quantification of Mycobacterium Avium subsp. paratuberculosis strains with distinct genotypes and isolated from domestic and wild-life animal species using an automatic liquid culture system. J. Clin. Microbiol. 50, 2609–2617. Aduriz, J.J., Juste, R.A., Cortabarrı´a, N., 1995. Lack of Mycobactin dependence of Mycobacteria isolated on Middlebrook 7H11 from clinical cases of ovine paratuberculosis. Vet. Microbiol. 45, 211–217.
333
Alonso, S., Pethe, K., Russell, D.G., Purdy, G.E., 2007. Lysosomal killing of Mycobacterium mediated by ubiquitin-derived peptides is enhanced by autophagy. Proc. Natl. Acad. Sci. U. S. A. 104, 6031–6036. Alonso-Hearn, M., Eckstein, T.M., Sommer, S., Bermudez, L.E., 2010. A Mycobacterium avium subsp. paratuberculosis LuxR regulates cell envelope and virulence. Innate Immun. 16, 235–247. Bermudez, L.E., Petrofsky, M., Sommer, S., Barletta, R.G., 2010. Peyer’s patch-deficient mice demonstrate that Mycobacterium avium subsp. paratuberculosis translocates across the mucosal barrier via both M cells and enterocytes but has inefficient dissemination. Infect. Immun. 78, 3570–3577. Collins, D.M., Gabric, D.M., de Lisle, G.W., 1990. Identification of two groups of Mycobacterium paratuberculosis strains by restriction analysis and DNA hybridization. J. Clin. Microbiol. 28, 1591–1596. Cossu, A., Sechi, L.A., Zanetti, S., Rosu, V., 2012. Gene expression profiling of Mycobacterium avium subspecies paratuberculosis in simulated multi-stress conditions and within THP-1 cells reveals a new kind of interactive intramacrophage behaviour. BMC Microbiol. 12, 87. Cousins, D.V., Evans, R.J., Francis, B.R., 1995. Use of the BACTEC radiometric culture method and polymerase chain reaction for the rapid screening of faeces and tissues for Mycobacterium paratuberculosis. Aust. Vet. J. 72, 458–462. de Juan, L., Mateos, A., Domı´nguez, L., Sharp, J.M., Stevenson, K., 2005. Genetic diversity of Mycobacterium avium subspecies paratuberculosis isolates from goats detected by pulsed-field gel electrophoresis. Vet. Microbiol. 106, 249–257. Harriff, M.J., Wu, M., Kent, M.L., Bermudez, L.E., 2008. Species of environmental Mycobacteria differ in their abilities to grow in human, mouse, and carp macrophages and with regard to the presence of Mycobacterial virulence genes, as observed by DNA microarray hybridization. Appl. Environ. Microbiol. 74, 275–285. Harris, N.B., Barletta, R.G., 2001. Mycobacterium avium subsp. paratuberculosis in veterinary medicine—a review. Clin. Microbiol. 14, 489–512. Janagama, H.K., Jeong, K.I., Kapur, V., Coussens, P., Sreevatsan, S., 2006. Cytokine responses of bovine macrophages to diverse clinical Mycobacterium avium subspecies paratuberculosis strains. BMC Microbiol. 6, 10. Janagama, H.K., Lamont, E.A., George, S., Bannantine, J.P., Xu, W.W., Tu, Z.J., Wells, S.J., Schefers, J., Sreevatsan, S., 2010. Primary transcriptomes of Mycobacterium avium subsp. paratuberculosis reveal proprietary pathways in tissue and macrophages. BMC Genomics 11, 561. Li, Q., Whalen, C.C., Albert, J.M., Larkin, R., Zukowski, L., Donald Cave, M., Silver, R.F., 2002. Differences in rate and variability of intracellular growth of a panel of Mycobacterium tuberculosis clinical isolates within a human monocyte model. Infect. Immun. 70, 6489–6493. Mekalanos, J.J., 1992. Environmental signals controlling expression of virulence gene determinants in bacteria. J. Bacteriol. 174, 1–7. Moloney, B.J., Whittington, R.J., 2008. Cross species transmission of ovine Johne’s disease from sheep to cattle: an estimate of prevalence in exposed susceptible cattle. Aust. Vet. J. 86, 117–123. Muskens, J., Bakker, D., de Boer, J., van Keulen, L., 2001. Paratuberculosis in sheep: its possible role in the epidemiology of paratuberculosis in cattle. Vet. Microbiol. 78, 101–109. Patel, D., Danelishvili, L., Yamazaki, Y., Alonso-Hearn, M., Paustian, M.L., Bannantine, J.P., Meunier-Goddik, L., Bermudez, L.E., 2006. The ability of Mycobacterium avium subsp. paratuberculosis to enter bovine epithelial cells is influenced by preexposure to a hyperosmolar environment and intracellular passage in bovine mammary epithelial cells. Infect. Immun. 74, 2849–2855. Rowe, M.T., Grant, I.R., 2006. Mycobacterium avium ssp. paratuberculosis and its potential survival tactics. Lett. Appl. Microbiol. 42, 305–311. Sevilla, I., Singh, S.V., Garrido, J.M., Aduriz, G., Rodrı´guez, S., Geijo, M.V., Whittington, R.J., Saunders, V., Whitlock, R.H., Juste, R.A., 2005. Molecular typing of Mycobacterium avium subspecies paratuberculosis strains from different hosts and regions. Rev. Sci. Tech. 24, 1061–1066. Sevilla, I., Garrido, J.M., Guijo, M., Juste, R.A., 2007. Pulsed-field gel electrophoresis profile homogeneity of Mycobacterium avium subsp. paratuberculosis isolates from cattle and heterogeneity of those from sheep and goats. BMC Microbiol. 7, 18. Stabel, J.R., Stabel, T.J., 1995. Immortalization and characterization of bovine peritoneal macrophages transfected with SV40 plasmid DNA. Vet. Immunol. Immunopathol. 45, 211–220. Stevenson, K., Hughes, V.M., de Juan, L., Inglis, N.F., Wright, F., Sharp, J.M., 2002. Molecular characterization of pigmented and nonpigmented isolates of Mycobacterium avium subsp. paratuberculosis. J. Clin. Microbiol. 40, 1798–1804. Stevenson, K., Alvarez, J., Bakker, D., Biet, F., de Juan, L., Denham, S., Dimareli, Z., Dohmann, K., Gerlach, G.F., Heron, I., Kopecna, M., May, L., Pavlik, I., Sharp, J.M., Thibault, V.C., Willemsen, P., Zadoks, R.N., Greig, A., 2009. Occurrence of Mycobacterium avium subspecies
334
N. Abendan˜o et al. / Veterinary Microbiology 163 (2013) 325–334
paratuberculosis across host species and European countries with evidence for transmission between wildlife and domestic ruminants. BMC Microbiol. 9, 212. Theus, S.A., Cave, M.D., Eisenach, K.D., 2005. Intracellular macrophage growth rates and cytokine profiles of Mycobacterium tuberculosis strains with different transmission dynamics. J. Infect. Dis. 191, 453–460. Tooker, B.C., Burton, J.L., Coussens, P.M., 2002. Survival tactics of M. paratuberculosis in bovine macrophage cells. Vet. Immunol. Immunopathol. 87, 429–437. Weiss, D.J., Evanson, O.A., de Souza, C., Abrahamsen, M.S., 2005. A critical role of interleukin-10 in the response of bovine macrophages to infection by Mycobacterium avium subsp paratuberculosis. Am. J. Vet. Res. 66, 721–726. Whittington, R.J., Marsh, I.B., Whitlock, R.H., 2001a. Typing of IS 1311 polymorphisms confirms that bison (Bison bison) with paratuberculosis
in Montana are infected with a strain of Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and other domesticated livestock. Mol. Cell. Probe. 15, 139–145. Whittington, R.J., Taragel, C.A., Ottaway, S., Marsh, I., Seaman, J., Fridriksdottir, V., 2001b. Molecular epidemiological confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratuberculosis in cattle in Australia and sheep and cattle in Iceland. Vet. Microbiol. 79, 311– 322. Woo, S.R., Heintz, J.A., Albrecht, R., Barletta, R.G., Czuprynski, C.J., 2007. Life and death in bovine monocytes: the fate of Mycobacterium avium subsp. paratuberculosis. Microb. Pathog. 43, 106–113. Zhao, B.Y., Czuprynski, C.J., Collins, M.T., 1999. Intracellular fate of Mycobacterium avium subspecies paratuberculosis in monocytes from normal and infected, interferon-responsive cows as determined by a radiometric method. Can. J. Vet. Res. 63, 56–61.
