Journal of Molecular and Cellular Cardiology 39 (2005) 133–147 www.elsevier.com/locate/yjmcc
Original article
Novel cell lines derived from adult human ventricular cardiomyocytes Mercy M. Davidson a,*, Claudia Nesti a, Lluis Palenzuela a, Winsome F. Walker a, Evelyn Hernandez a, Lev Protas b, Michio Hirano a, Nithila D. Isaac c a
Department of Neurology, College of Physicians and Surgeons, Columbia University, Room 5-431, 630 West 168th Street, New York, NY 10032, USA b Department of Pharmacology, Columbia University, New York, NY 10032, USA c Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, New York, NY, USA Received 2 July 2004; received in revised form 13 February 2005; accepted 4 March 2005 Available online 23 May 2005
Abstract Background. – We have established proliferating human cardiomyocyte cell lines derived from non-proliferating primary cultures of adult ventricular heart tissue, using a novel method that may be applicable to many post-mitotic primary cultures. Methods and results. – Primary cells from human ventricular tissue, were fused with SV40 transformed, uridine auxotroph human fibroblasts, devoid of mitochondrial DNA. This was followed by selection in uridine-free medium to eliminate unfused fibroblasts. The fused cells were subcloned and screened for cell type-specific markers. Four clones (AC1, AC10, AC12, AC16) that express markers characteristic of cardiomyocytes were studied. Clones were homogeneous morphologically, and expressed transcription factors (GATA4, MYCD, NFATc4), contractile proteins such as a- and b-myosin heavy chain, a-cardiac actin, troponin I, desmoplakin, a actinin, the muscle-specific intermediate filament protein, desmin, the cardiomyocyte-specific peptide hormones, BNP, the L-type calcium channel a1C subunit and gap junction proteins, connexin-43 and connexin-40. Furthermore, dye-coupling studies confirmed the presence of functional gap junctions. EM ultra structural analysis revealed the presence of myofibrils in the subsarcolemmal region, indicating a precontractile developmental stage. When grown in mitogen-depleted medium, the AC cells stopped proliferating and formed a multinucleated syncytium. When the SV40 oncogene was silenced using the RNAi technique, AC16 cells switched from a proliferating to a more differentiated quiescent state, with the formation of multinucleated syncyntium. Concurrently, the cells expressed BMP2, an important signaling molecule for induction of cardiac-specific markers, that was not expressed by the proliferating cells. The presence of the combination of transcription factors in addition to musclespecific markers is a good indication for the presence of a cardiac transcription program in these cells. Conclusions. – Based on the expression of myogenic markers and a fully functional respiratory chain, the AC cells have retained the nuclear DNA and the mitochondrial DNA of the primary cardiomyocytes. They can be frozen and thawed repeatedly and can differentiate when grown in mitogen-free medium. These cell lines are potentially useful in vitro models to study developmental regulation of cardiomyocytes in normal and pathological states. © 2005 Elsevier Ltd. All rights reserved. Keywords: Cardiomyocyte culture; Immortalization; Myogenic markers; Dedifferentiation; Connexin; Myosin; Desmin; Gap junction; Atrial granules; Cardiac transcription factors; RNAi
1. Introduction Cardiomyocytes exit the cell cycle and terminally differentiate in vivo in the perinatal period. Unlike skeletal muscle, the myocardium does not have satellite cells capable of proliferating in response to muscle injury [1,2]. Studies of skeletal myoblast cultures derived from muscle satellite cells have contributed significantly to our understanding of the mecha* Corresponding author. Tel.: +1 212 305 3761; fax: +1 212 305 3986. E-mail address:
[email protected] (M.M. Davidson). 0022-2828/$ - see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.yjmcc.2005.03.003
nisms that control proliferation and differentiation, for the study of genetic myopathies (see Campion [3] for review). By contrast, no analogous human ventricular cardiomyocyte cell line is available for similar studies, because cultures of cardiac tissue appear to have a finite lifespan in vitro. Terminally differentiated primary cultures which may be maintained for several weeks, undergo morphological and functional changes over time [4,5], and yield a heterogeneous population of cells. Attempts to establish immortalized cardiomyocyte cell lines that can proliferate in culture include AT-1 cells, estab-
134
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
lished from a mouse atrial tumor [6], MC29, a quail cell line from a rhabdomyosarcoma tumor [7], cell lines established from transgenic mice that express the SV40 T-ag [8–10], and by transformation of fetal cardiomyocytes with the SV40 oncogene [11–13]. These transformed cells suffer from numerous deficits including the lack of typical cardiomyocyte phenotype, limited capacity to be passaged, which compromises their applications to developmental and cellular studies, or de-differentiating on prolonged culture. Claycomb et al. [14] described a mouse atrial cardiomyocyte cell line, HL-1, derived from the AT-1 cells, that can be passaged serially, and differentiate while maintaining characteristics of adult mouse atrial cardiomyocytes. While useful for studying atrial myocytes, it is limited in answering questions about ventricular cardiomyocytes and especially those pertaining to mechanisms of human cardiogenesis and cardiomyopathies. Therefore, a readily available and stable line of proliferating cardiomyocytes that expresses specific markers of cardiac tissues and capable of differentiating under appropriate culture conditions would be a valuable tool for cardiovascular research. However, attempts to stably transform primary cardiomyocytes from adult heart with the SV40 oncogene have not been successful because they are postmitotic. Therefore, we have used a novel, mitochondrial function-based method to immortalize primary ventricular cardiomyocytes from adult human heart tissue, by fusion with a SV40 transformed fibroblast cell line devoid of mitochondrial DNA. The cell lines obtained by this method are stable, have been passaged for over 120 generations and can be regrown from frozen stocks while retaining their original phenotype. Furthermore, the RNA interference (RNAi) approach [15] was used to knock down the expression of SV40 large T-antigen (T-ag) gene, to switch the cells from a proliferative to a more terminally quiescent state, and to induce further differentiation. In order to confirm the cardiac phenotype of AC16 cells and to verify whether the cells have undergone further differentiation after SV40 silencing, real time and RT-PCR analyses were performed to determine the expression of several cardiacspecific genes. These stable cell lines in which proliferation and differentiation could be controlled by altering culture conditions and by silencing the expression of SV40 T-Ag, would serve as a useful in vitro model to study cardiac gene expression and function, during normal development and in pathological conditions at the cellular, organellar and molecular levels.
2. Materials and methods 2.1. Primary cultures Adult ventricular heart tissue (1 cm3) was obtained from an explanted ischemic human heart after Institutional Review Board approval (IRB#X0592). Ventricular tissue not involved in the infarct as determined by gross pathological examination was immediately dissected and minced under a dissec-
tion microscope (Carl Zeiss, Göttingen, Germany). The tissue was transferred to a glass tissue dissociation chamber maintained at 37 °C and trypsinized with fresh changes of trypsin every 15 min. The dissociated cells were pelleted and the individual cell pellets were resuspended in DMEM/F-12 (Invitrogen, Carlsbad, CA, USA) containing 0.6% penicillin and 1% streptomycin, supplemented with 12.5% fetal bovine serum (FBS) (growth medium). The cells were plated in 100 mm2 dishes and allowed to attach for 1 h at 37 °C in 5% CO2. The supernatant containing an enriched population of cardiomyocytes that did not attach to the culture dish, was transferred to a new 100 mm2 dish and cultured at 37 °C in 5% CO2. Repeated plating further enriched the cardiomyocyte population [16,17]. Further elimination of fibroblasts was achieved by successive complement fixation [18] using an antibody to the surface protein of fibroblasts (1B10; Sigma Chemical Co., St. Louis, MO). 2.2. Generation of SV40 transformed DWFb1q0 human fibroblasts The human skin fibroblast cell line (DWFb1) from a normal control was transformed with an SV40 based mammalian vector containing large T-ag and neomycin resistance genes (pRNS-1) [19]. Stable transfectants were isolated by selection in G-418 and checked for the expression of the large T-ag by immunocytochemistry. Four large T-ag positive clones were identified. Mitochondrial DNA (mtDNA) of the four clones was depleted by treatment with 50 ng/ml ethidium bromide in growth medium supplemented with 50 µg/ml uridine, as previously described [20]. This resulted in cells devoid of mtDNA that were entirely dependent on glycolysis for their energy requirements, and auxotrophic to uridine and pyruvate. One of these clones, identified as DWFb1q0, was used for fusion with the primary cardiomyocyte culture. 2.3. Fusion of primary cardiomyocytes with DWFb1q0 fibroblasts Fig. 1 illustrates schematically, the method used to generate the cardiomyocyte cell lines. Forty-eight hours after the final complement fixation step, DWFb1q0 (1 × 106) cells were layered on the cardiomyocytes (approximately 1 × 106 cells) growing on a 100 mm2 culture dish and incubated overnight at 37 °C. The cells were allowed to fuse using 50% (w/v) polyethylene glycol (PEG, MW 1500, ATCC, Manassas, VA, USA), prepared in DMEM, containing 10% DMSO for 1 min. Excess PEG was removed by gentle rinsing in 10% DMSO in DMEM/F-12. Cells were then allowed to recover in complete growth medium for 24 h before transfer to uridine-free DMEM/F-12 selection medium, supplemented with 12.5% dialyzed FBS to eliminate all traces of uridine. This selection eliminated unfused DWFb1q0 fibroblasts, and fibroblasts that had fused to themselves. 2.4. Subcloning and immunocytochemical screening The cells grown under selection were plated at low density (100 cells per 100 mm2 dish) and subcloned using glass
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
135
Fig. 1. Scheme of generation of human cardiomyocyte cell lines. Primary cardiomyocytes from adult ventricular tissue were fused with SV40 transformed mtDNA-less fibroblasts and selected in -Ur medium, subcloned and screened.
cloning rings. Over 50 colonies, each derived from a single cell, were isolated. These were continuously grown under uridine-free medium, and subsequently screened for the presence of SV40 large T-ag, b-myosin heavy chain (bMHC) and connexin-43 (Cx-43) by immunocytochemistry. Four clones designated AC1, AC10, AC12, AC16 that expressed all three antigens were selected for further characterization. 2.5. Growth curve and population doubling studies Growth curves of the four selected AC clones, parental SV40 transformed q0 fibroblasts (DWFb1q0) and normal control fibroblasts were determined. 5 × 104 cells in 10 ml of the growth medium were seeded in multiple 100 mm2 dishes. For cardiomyocytes, DMEM/F-12 supplemented with 12.5% FBS was used, and for fibroblasts, MEM supplemented with 15% FBS was used. 50 µg/ml uridine was added in the fibroblast medium to support the growth of DWFb1q0 cells. For growth in differentiation medium, 1 × 104 AC16 cells in 2 ml of DMEM F/12 supplemented with 12.5% FBS were seeded in 35 mm2 dishes. On the following day the medium was changed to DMEM F/12, 2% horse serum (HS). At 24-h time intervals, cells from individual plates were trypsinized and counted. Cell doubling time (DT) was calculated from the cell counts obtained in the exponential growth phase or by using the formula, DT = 关 t − t 0 兴 log 2 关 log N − log N 0 兴 where N and N0 are cell counts at times t and t0, respectively. 2.6. Differentiation in culture To study differentiation in culture, AC cells were grown in three different mitogen-depleted media to stop proliferation of cells and promote differentiation [21–23]. The cells were plated in 35 mm2 cluster dishes containing glass cover slips coated with 12.5 µg/ml fibronectin in 0.02% gelatin at a density of 1 × 105 cells per dish in regular growth medium and grown to confluence. The medium was then replaced by mitogen-deficient medium, DMEM/F-12 supplemented with 2% HS and insulin–selenium–transferrin supplement (ITS, Invitrogen) and cultured up to 4 months. Insulin promotes
glucose uptake, while transferrin provides a carrier for iron and both transferrin and selenite have antioxidant activity [24]. Parallel cultures were grown for the same period in a second mitogen-deficient medium, consisting of Nutrient Mixture F-14 (Invitrogen) supplemented with 0.5 mg/ml bovine serum albumin (BSA, Sigma Chemical Co.), and 10 µg/ml insulin (Sigma Chemical Co.). A third set of cultures were grown continuously in DMEM/F-12 supplemented with 2% HS (Invitrogen), insulin–transferrin–selenium- (ITS, Invitrogen) after being exposed to 5 µM 5-aza cytidine for 24 h, followed by 23 µM cytosine arabinoside (CA) (Sigma Chemical Co.) for 5 days to inhibit DNA synthesis and cell proliferation [25,26]. 2.7. Immunocytochemical screening Cells grown on glass coverslips in growth and in differentiating medium were fixed and permeabilized with 4% paraformaldehyde containing 0.1% Triton X-100 in PBS for 1 h. The cells were then incubated with the primary antibody for 1 h, washed with PBS and incubated with the appropriate secondary antibody conjugated with either FITC or Texas Red (Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA), mounted in 50% glycerol in PBS and examined with a Zeiss Axiovert 200 M, inverted fluorescent microscope (Carl Zeiss), using epi-illumination. Images were captured using a Cooke SensicamQE High Performance digital camera using SlidebookTM image analysis software (Intelligent Imaging Innovations, Inc., CO, USA). Six micrometers thick cryostat sections from autopsied atrial or ventricular heart tissue, DWFb1q0 fibroblasts and in some cases normal myoblasts and fibroblasts were used as controls. The first antibody was omitted for negative controls and stained concurrently to check for antibody specificity. The following primary antibodies were used to screen for the expression of cell-lineage markers: ventricular MHC, Cx-40, vimentin, desmin, troponin I (Chemicon International Inc., Temecula, CA), MHCMF20 (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA), MHC slow (Novocastra Laboratories, UK), ventricular myosin light chain 1 (Chromaprobe,
136
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
Mountainview, CA), Cx-43, skeletal muscle-specific MHC (Zymed Labs Inc., South San Francisco, CA), a-cardiac actin (Research Diagnostics Inc., Flanders, NJ), a-smooth muscle actin (DAKO, Carpinteria, CA), skeletal muscle actin (Accurate Chemical and Scientific Corporation, New York, USA), a actinin (Sigma Chemical Co.), atrial natriuretic peptide (ANP), desmoplakin (Research Diagnostics Inc.), fibroblastspecific protein 1 (FSP1) (Dr. Eric Neilson). Antibody to SV40 large T-ag (Pab 101, Santa Cruz Biotechnology, Santa Cruz, CA) was used to confirm transformation. Ki67 (Chemicon International Inc.) was used to detect proliferating cells. 2.8. Morphological studies 2.8.1. Cytochrome c oxidase (COX), succinate dehydrogenase (SDH) To evaluate mitochondrial function, COX and SDH histochemistry was performed as described [27]. After incubation with the substrates, the coverslips were rinsed in PBS, and mounted in glycerin-gelatin and examined with a Zeiss microscope (Carl Zeiss) with brightfield optics. 2.8.2. Light and electron microscopy Cells plated on cover slips and grown in regular medium and in mitogen-depleted medium for up to 4 months were stained with (H&E), examined under a Zeiss microscope and images were captured as described above. For electron microscopy (EM), the cultured AC cells grown in regular and in differentiating medium were fixed in 4% paraformaldehyde and 0.1% gluteraldehyde in cacodylate buffer, post-fixed with 1% osmium tetroxide and embedded in Spurr’s low viscosity medium [28]. One micrometer sections were stained with Toluidine blue and examined under light microscope. Sev-
enty nanometers sections were stained with uranyl acetate and lead citrate and viewed under TEM (model JEOL100 CX II). 2.8.3. Molecular genetic analyses Total RNA was extracted from normal human heart tissue, AC cells before and after SV40 silencing, and after growth for 2–4 weeks in mitogen-free medium to induce differentiation, using “Totally RNA” kit (Ambion, TX, USA). Purity of RNA was assessed by the ratio of A260 to A280 and only preparations with a ratio of more than 1.8 were used. The integrity of the RNA 28s and 16s rRNA bands was checked by agarose gel electrophoresis. RT-PCR was performed using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) according to the manufacturer’s protocol. The cDNA was amplified using the sets of primers indicated in Table 1. The housekeeping gene, COX subunit VIIc, encoded by the nuclear genome, and not by mtDNA, and therefore expressed by all cells, was amplified and used as loading control with every experiment. 2.8.4. RNA interference To knock down the expression of SV40 large T-Ag, three regions responsible for the virus transforming capacity [29] were amplified using the set of primers described in Table 2. The amplified DNA fragments were used as templates to produce siRNA using the Silencer siRNA Cocktail Kit (RNase III) (Ambion). The siRNAs were delivered to AC16 cells at a concentration of 80 nM each, using 8 µl of siPORT Amine, a polyamine mixture (Ambion), as transfection agent, following the manufacturer’s protocol. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) siRNA was used as positive control, and scrambled GAPDH, but with the same base compo-
Table 1 Primers used for RT-PCR analyses Genes GATA 4 BMP 2 MYCD NFATc4 a-MHC b-MHC a-Actin BNP CACNa1C FSP1 COX VIIc
Primers (5′–3′) F CCCCAATCTCGATATGTTTG R GATTATGTCCCCGTGACTGT F CCACCATGAAGAATCTTTGG R TGACCAACGTCTGAACAATG F CTTTTCCTGTCACACCCAAC R CTGCTTTACGGCATCTTCAT F AGACTCCAAGGTGGTGTTCA R TGATACCCTGGATAGGGACA F TGCGCATTGAGTTCAAGAAG R CAGCCTCTCATTCATCTCCT F GATGGCAGTCTTTGGGGCTGC R TGTAGAGCACCGCGGGCTCAT F AGGCCATCTTTCCAGCTAGT R CAAAGCGTAGCCCTCATAGA F CGCAAAATGGTCCTCTACAC R CCGTGGAAATTTTGTGCTC F CTGGACAAGAACCAGCGACAGTGCG R ATCACGATCAGGAGGGCCACATAGGG F TCTCTCCTCAGCGCTTCTTC R CTTCCTGGGCTGCTTATCTG F GCAGAGCTTCCAGCGGCTATGTTGG R GACAAACATATCTAGTATGG CATATG
Fragment size (bp) 715 713 923 791 389 285 387 298 563 347 300
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147 Table 2 Primers used for amplification of SV40 large T-antigen regions Region
Primers
TAg-N
Sense-AGCAGTGCAGCTTTTTCCTT Antisense-CTTTGCAGCTAATGGACCTTC Sense-TGCTCAGAAGAAATGCCATC Antisense-CACCACTGAATCCATTTTGG Sense-GAAGAATGGATGGCTGGAGT Antisense-GAAATGAGCCTTGGGACTGT
TAg-2 TAg-3
Fragment size (bp) 830 903 862
sition was used as negative control (Ambion). To evaluate efficiency of transfection, T-ag transcripts were quantitated and normalized to GAPDH transcripts by real time PCR at 24, 40, 48, 72 and 96 h T-ag immunostaining was done to evaluate silencing at the protein level. Additionally, efficiency of colony formation and of cell division were analyzed to confirm downstream effects of silencing. For growth curves, 1 × 104 cells, 96 h after silencing were plated in multiple dishes in regular growth medium and cells were trypsinized and counted after Trypan blue exclusion every 24 h. For analysis of colony forming efficiency, AC16 cells before and after silencing with T-ag siRNA and GAPDH siRNA (control) were plated at 50 cells per dish, in duplicate. The colonies were stained with 0.1% crystal violet for 5 min, rinsed and counted on day 12. 2.8.5. Real time PCR cDNA was obtained from 150 ng RNA using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). To assess the expression of SV40 large T-ag and GAPDH before and after silencing, as well as the cardiac transcripts MYCD, GATA4 and NFATc4, real time RT-PCR was performed using TaqMan FAM labeled probes (MYCD: Hs00538076; GATA4: Hs00171403; NFATC4: Hs00190037) from Applied Biosystems, Foster City, CA, USA. For SV40 large T-ag, we used a custom-designed TaqMan probe spanning exons 1 and 2. Expression levels were normalized to GAPDH probe (Hs99999905). In a 20 µl reaction, 1 µl cDNA and a 19 µl mix including 10 µl TaqMan Universal Master Mix, 1 µl Taqman Probe/Primer 20X mix and 8 µl distilled water were mixed and incubated following the PCR conditions: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min in a SDS 7000 System and analyzed using the SDS 7000 software (Applied Biosystems). Standard curves for MYCD, GATA4 and NFATc4 transcripts and GAPDH were set up by serial dilutions of cDNA from human heart tissue, and for T-ag transcript. cDNA from the AC16 cell line was used to establish a standard curve. Standards and samples were run in triplicate. 2.9. Electrophysiology 2.9.1. Patch clamp recording Ten single cells, from the same culture, were analyzed using standard patch clamp technique (whole cell configura-
137
tion, voltage clamp or current clamp mode) as previously described [30]. Cells were superfused at 35 °C with Tyrode solution of the following composition (in mM): 140 NaCl, 5.4 KCl, 1 CaCl2, 1 MgCl2, 5 HEPES, 10 glucose (pH 7.4). Glass pipettes, filled with solution containing 130 aspartic acid, 146 KOH, 10 NaCl, 1 CaCl2, 5 EGTA, 10 HEPES, 2 ATP Mg (pH 7.2), had resistance of 3–4 MX. An Axopatch-1D amplifier, a DigiData Interface and pClamp 8 software (Axon Instruments, Foster City, CA, USA) were used for data acquisition and analysis. 2.9.2. Dye-coupling studies AC16 cells plated on glass coverslip fragments in regular growth medium for 48 h were transferred to the recording chamber of an upright water-immersion microscope (Olympus BX50WI). Cells were superfused with extracellular recording solution (in mM): 124 NaCl, 2.5 KCl, 1.25 NaH2PO4, 1 MgSO4, 2 CaCl2, 25 NaHCO3, and 20 glucose, pH 7.4 at 25 °C, bubbled continuously with 95% O2–5% CO2. Borosilicate glass patch clamp electrodes (8–10 MX) were filled with a standard intracellular filling solution (in mM): 130 KCl, 5 NaCl, 10 HEPES, 0.4 CaCl2, 1 MgCl2, and 1.1 EGTA, pH 7.3 at 25 °C, to which 4% (w/v) Lucifer yellow CH potassium salt was added prior to filtering at 0.2 µm. Whole-cell patch clamp recordings were obtained under video microscopic guidance, and the Lucifer yellow-containing filling solution was allowed to diffuse into the recorded cell for 10 min prior to capturing an epifluorescent image of the microscope field. Integrated video still images were acquired using epifluorescent excitation with an appropriate filter set for Lucifer yellow (Chroma, Brattleboro, VT) and a cooled CCD camera (Scion Corporation, Frederick, MD) connected to a Macintosh computer using Scion Image Analysis software.
3. Results 3.1. Generation of immortalized cardiomyocyte cell lines Primary cultures enriched in cardiomyocytes, were fused with the q0 fibroblast cell line carrying the SV40 gene (DWFb1q0) (Fig. 1). Being respiration incompetent and requiring uridine for growth, the unfused q0 fibroblasts and the hybrids formed by fusion of q0 fibroblasts to each other were eliminated in uridine-free selection medium. Unfused primary cardiomyocytes, incapable of proliferation, did not survive serial passaging over several weeks. As a result, the surviving cells consisted of mainly fusion products of DWFb1q0 fibroblasts with either the cardiomyocytes or with fibroblasts from the primary culture. Initial screening of the isolated clones revealed that all the cells from the 50 clones were positive for the large T-ag by immunocytochemistry, indicating that they were transformed by the SV40 gene introduced by fusion with the DWFb1q0 cells (Fig. 5a). Only 19/50 clones co-expressed bMHC and Cx-43 (SF. 1h, i). Six
138
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
of 19 clones were scored to be very strongly positive for both antigens. We randomly selected four representative clones, AC1, AC10, AC12, AC16, that expressed T-ag (transformation marker), bMHC (myogenic marker) by immunocytochemistry (SF. 1g, k) and by RT-PCR (Fig. 8A), as well as Cx-43 (the most abundant gap junction protein in ventricular tissue) for further characterization. 3.2. Growth and differentiation characteristics Clones were passaged continuously in growth medium for over 120 passages. At regular intervals during passaging, several vials of cells were frozen to maintain stocks. Frozen stocks were viable when thawed for regrowth, and maintained their original phenotype even after storage in liquid nitrogen for more than 4 years. Growth rates of the AC16 clone, DWFb1q0 and control fibroblasts (DWFb1) were similar as shown in Fig. 2A. Proliferation of AC16 slows as cells approach confluence, similar to that of control primary fibroblasts. The calculated DT was 24.49 h for the AC clones, 23.91 h for the control fibroblasts and 23.09 h for the DWFb1q0 cells. Growth curves of AC16 cells in proliferating medium (AC16P) and in differentiating medium (AC16D)
are presented in Fig. 2B. In differentiating medium (CA/DMEM F-12 and 2% HS), virtually no cell division was observed. H&E staining performed to assess differentiation morphologically, revealed isolated discrete cells with a centrallylocated nucleus in proliferating medium (Fig. 3G). When cultivated in differentiating medium, control human skeletal myoblasts line up parallel to the long axis of the cells (Fig. 3D), fuse to form multinucleated myotubes (Fig. 3E, F). In AC16 cells, after 2 weeks of culture in differentiation medium, we observed several cells with polyploidy, the multiple nuclei appear to be within a single cell (Fig. 3A (arrow), B (white arrow). In the same cultures, we also noticed mononucleated cells lining up, as in the case of myoblast cultures (Fig. 3B, closed arrow) perhaps ready to fuse. In Fig. 3C, we see multinucleated cells lined up perhaps ready to fuse. EM analysis of AC16 cells grown in differentiating medium also shows evidence of multinucleated cells with a distinct cell membrane (Fig. 3H). Similar observations were made in all three differentiating media used. 3.3. Myofibrillogenesis and gap junctions in AC cells Transmission EM was performed on proliferating cells after 80 passages (Fig. 4). AC16 cells were elongated with ovoid nuclei, coupled by intercellular junctions, with welldeveloped RER and Golgi, abundant mitochondria with welldeveloped cristae; atrial granules were present (Fig. 4a). Myofibrillogenesis was seen, with long myofibrils mostly detected in the subsarcolemmal region and some in the cytoplasm. Some transverse filaments were seen both at the periphery as well as at cytoplasmic locations (Fig. 4a). In cells grown under differentiating conditions, bundles of myofilaments arranged in parallel were detected in the cytoplasm (Fig. 4b–d). Desmosomes were present at intermembrane locations (Fig. 4a, e). Multilaminar gap junctions were clearly visible (Fig. 4f). Neither organized sarcomeres nor T-tubules were discernible. 3.4. Myogenic cell markers are present in AC cells
Fig. 2. Growth curves of AC16 cells. A: Growth curve of AC16 cells in proliferating medium is similar to that of control human fibroblasts and DWFb1q0 fibroblasts. B: In differentiating medium (AC16D), the cells stop dividing after 24 h, while they continue to divide in proliferating medium (AC16P).
The results presented in Table 3 reveal that the cells expressed several antigens specific to cardiomyocytes, such as: a and bMHC (Fig. 8B, SF. 4g), Cx-43 (SF. 2h, i) and Cx-40 (Fig. 5l), major gap junction proteins of cardiac tissue; all the clones expressed the peptide hormone ANP (SF. 1g, h), the contractile proteins, a-cardiac actin (SF. 2f), a actinin, and troponin 1 (Fig. 5i–k). The cells did not stain with vimentin (Fig. 5c), an intermediate filament protein present in mesenchymal tissue, nor do they express FSP1, a fibroblastspecific protein that is present in abundance in DWFb1qo cells (SF. 3A1, B1) However, the cells expressed desmin (Fig. 5b), a muscle-specific marker, expressed by both skeletal and cardiac muscle. They also expressed desmoplakin (SF. 1f) an intercellular junctional protein, specific to muscle and VMLC-1 (SF. 1i, j), revealing a myogenic phenotype. How-
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
139
Fig. 3. H&E stain of AC16 cells (A–C) and human myotubes (D–F) grown in differentiating medium. (A): Multinucleated AC16 cells. (B): Cells line up for fusion (black arrow) and a binucleated cell (white arrow). (C): Some of the lined up cells with multinuclei appear fused. (D): Myoblasts line up parallel to the long axis (arrows) and in (E, F): myoblasts are fused to form multinucleated syncytium. (G) AC16 cells grown in proliferating medium. (H): EM of AC16 cells grown in differentiating medium, shows binuclear cell with a distinct cell membrane.
ever, the cells did not express MyoD, a late muscle differentiation factor (data not shown). 3.5. Expression of cardiac-specific molecules As shown in Table 1, the expression of several cardiacspecific transcripts was analyzed by RT PCR. AC16 cells expressed the heart-specific transcription factors GATA4, MYCD and NFATc4, contractile proteins a- and b-MHC, a-cardiac actin, peptide hormones, ANP, BNP and the L-type Ca channel, CACN a1C (Fig. 8). After SV40 silencing by RNAi and growth in differentiating medium, AC16 cells expressed the signaling molecule, BMP2, which was not expressed previously by the proliferating cardiomyocyte cell line (Fig. 8D). Quantitation of transcripts by real time RT-PCR, showed that both GATA4 and NFATc4 transcripts decreased with time, reaching low values at 96 h after silencing. NFATc4 mRNA, which is abundantly expressed by the AC cells is decreased
almost eightfold at 72 h and 18-fold at 96 h. MYCD expression, on the other hand, increased eightfold at 72 h, before falling to almost 10% at 96 h compared to unsilenced cells (SF. 6).
3.6. AC cells are populated by mitochondria from cardiomyocytes Histochemical staining for the respiratory chain enzymes revealed normal COX activity in the AC clones (Fig. 7a), in contrast to DWFb1q0 fibroblasts, which have no COX activity (Fig. 7c). This is because the DWFb1q0 fibroblasts lack mtDNA and therefore, have no functional respiratory chain. This clearly demonstrates that the mitochondria of the AC cells have originated from the primary cardiomyocytes. However, both AC 16 and DWFb1q0 cells stained normally for SDH (Fig. 7b, d), which is encoded by the nuclear DNA.
140
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
Fig. 4. Electron micrographs (a–f) of AC16 cells. a: Subsarcolemmal myofibrils (arrows), desmosome (arrowhead), and atrial granules (open arrow) are shown. Some transverse myofibrils in the cytoplasm are also seen (white arrow). b–d: In AC16 cells grown in differentiating medium cytoplasmic myofibrils are seen in bundles (arrows), some are subsarcolemmal (arrowhead) with no sarcomeric organization. e: Desmosomes at intercellular contacts are shown (arrows). e: Gap junctions are indicated by arrows. a–c: 32,000×, d: 27,000×, e, f: 57,000×.
3.7. Coupled gap junctions are present in AC cells When individual cells were injected with the tracer dye Lucifer yellow (522 MW) fluorescence was observed within the recorded cell and in 3–20 contiguous cells (N = 12/12 recordings). A gradient from the impaled cell was observed, indicating the presence of dye-coupling between neighboring cells (Fig. 6b). While numerous unlabeled cells could be observed in the same field, only contiguous, apposed cells were labeled, indicating that the dye transfer did not occur by extracellular uptake. These findings, together with our immunocytochemical demonstration of Cx-43 and Cx-40 and EM
studies support the conclusion that the gap junctions formed between the cardiomyocytes in culture are coupled and functional. 3.8. Silencing SV40 large T-ag 3.8.1. Quantitation of T-ag transcripts by real time RT-PCR At 24 h after silencing, we did not notice a change in the levels of large T-ag transcript normalized to that of GAPDH.
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
141
Fig. 5. Immunocytochemistry of AC cells (a–d, and i–k) and DWFb1q0 (e–h, and l–n) with antibodies to large T-antigen (a, e), desmin (b, f), vimentin (c, g), a actinin (i, j, m), troponin I (k, n), Cx-40 (l, o), no primary antibody (d, h). Bar = 40 µM.
Subsequently, we found a gradual decrease in the level, and at 96 h, the residual level of T-ag transcript was only 4.5% in silenced cells compared to unsilenced AC16 cells (SF. 5a).
3.8.2. Growth properties and T-ag expression Reduced levels of T-ag transcripts paralleled silencing at the protein level as shown in SF. 5b and were also reflected at
142
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
Table 3 Comparison of AC cells and primary cardiomyocytes in culture Markers Culture characteristics Cell division Differentiation Large T-Ag Contractile proteins a-MHC b-MHC VMLC-1 Troponin I a-Cardiac actin a-Skeletal actin Desmin Vimentin a-Actinin Myofilaments Sarcomeres Membrane proteins Desmoplakin Intercalated disc Gap junctions Cx-43 Cx-40 Transcription factors GATA4 MYCD NFATc4 Signaling molecule BMP2 Ion channel CACNa1C a
Primary cardiomyocytes
AC cells
NO NO –
YES YES +
+ + + + + – + – + + +
+ + + + + – + – + + –
+ + + + + (atrial)
+ – + + +
+ + +
+ + +
+
+a
+
+
After differentiation.
the functional level by inhibition of cell proliferation. Up to 6 days after silencing there was complete inhibition of growth of silenced AC cells as compared to unsilenced AC cells, after which time some growth was observed, probably due to unsilenced cells in the population (SF. 5c). We observed only a 30% colony formation efficiency in the T-ag silenced cells, and a 20% efficiency in GAPDH silenced cells (SF. 5d). The reduction in GAPDH silenced cells is perhaps due to inhibition in glycolysis. These results clearly indicate that the T-ag silencing resulted in knockdown of transcription, translation and function. 3.9. Electrophysiological properties of AC cells Mean capacitance of AC cells was 33.4 ± 4.2 pA/pF (N = 10) and mean membrane potential was –38.6 ± 4.3 mV (N = 10). In current clamp mode, none of the three cells recorded for 2 min each, had spontaneous changes in membrane potential. Stimulation of cells with 4 ms long depolarizing pulses to evoke action potential (AP) did not produce AP. In voltage-clamped cells, short (20 ms) depolarizing pulses, from holding potential of –70 mV or longer (200 ms) and of –50 mV (up to 60 mV), each evoked no inward time dependent current. An outward current was seen at potentials
more positive than –20 mV, which did not inactivate during the pulse duration (Fig. 6c). This current increased progressively with more positive potentials and at 60 mV, reached the value of 6.1 ± 1.3 pA/pF (N = 6). The current was significantly (P = 0.04) larger when KCl in Tyrode solution was replaced by 10 mM CsCl (two cells, 10.9 and 13.9 pA/pF). A ramp voltage clamp from –90 to 20 mV during 8 s (ramp protocol) also evoked outward current at voltages more positive than –30 or –20 mV and no obvious inward current at negative voltages. When long (2–5 s) hyperpolarizing pulses were applied in two cells from a holding potential of –35 mV, no time-dependent current was seen, even at the most negative pulse (–105 mV) (Fig. 6d). 4. Discussion 4.1. Immortalization technique We have established proliferating cardiomyocyte cell lines from non-proliferating primary cultures derived from adult heart tissue using a novel method that may be applied to any primary culture that has exited the cell cycle. This technique utilizes a mitochondrial function-based method to introduce the SV40 gene into post-mitotic cardiomyocytes that were consequently induced to re-enter the cell cycle. The stringent selection employed, permitted the growth of predominantly cardiomyocyte-DWFb1q0 hybrids and to a lesser extent, hybrids of other cell types that may be present in cardiac tissue. By immunoscreening for the expression of cell-lineage markers, clones that only express cardiac tissue-specific markers were selected and propagated. This technique has also been used in Dr. Davidson’s laboratory to immortalize vascular smooth muscle cells from human aorta, which have retained their original phenotype (unpublished data). Therefore, it can be generally applied to almost all post-mitotic primary cultures. By subcloning and by extensive screening of the clones for specific cell markers, it is possible to obtain proliferating cell lines with characteristics of virtually any tissue. 4.2. Origin of nuclear- and mtDNA of the AC clones From a culture of mixed hybrids that were obtained after fusion, initially we selected clones that expressed two markers, b-MHC and Cx-43, both of which are abundant in cardiomyocytes. After this preliminary selection, further immunocytochemical and molecular genetic analyses revealed the expression of several myogenic markers, namely, aMHC, bMHC, a-cardiac actin, desmin, ANP, BNP, desmoplakin VMLC-1, troponin I and several transcription factors. These markers are typically expressed by cardiomyocytes and therefore, could only have originated from the primary cardiomyocytes, and not from the DWFb1q0 fibroblasts, or from other cell types that constitute cardiac tissue. Consequently, it may be suggested that the clones may be under the dominant control of the cardiomyocyte nucleus.
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
143
Fig. 6. Lucifer yellow dye transfer (a, b) and electrophysiology (c, d) in AC cells. a: Brightfield image of glass electrode before injection with Lucifer yellow. b: Fluorescent image of dye spread to adjacent cells indicating coupled gap junctions. c: Outward current recorded from a voltage-clamped AC cell. Original current traces obtained by voltage steps ranging from –80 to 100 mV. Holding potential is –70 mV. d: Current–voltage curve constructed using values of current at the end of the pulses; N = 3 (three of six values for 60 mV given in the text are from these curves, three others are from protocol where the 60 mV step is the most positive).
The AC clones were selected and propagated in uridinefree medium that does not support the q0 fibroblasts, which are devoid of mtDNA. Furthermore, these q0 fibroblasts are negative for COX activity since they have no functional respiratory chain. On the contrary, the AC clones have respiration competent mitochondria with normal COX activity. Therefore, it is reasonable to assume that the mtDNA complement of the clones may also be of cardiomyocyte origin. Based on the expression of the myogenic markers and the presence of a functional respiratory chain, the cell lines developed by this method seem to have retained both the nuclear- and the mtDNA from the primary cardiomyocytes. 4.3. Myogenic phenotype of the AC clones
Fig. 7. COX/SDH histochemistry of AC16 cells showing normal COX (a) and SDH (b) staining of AC16 cells and negative COX (c) and normal SDH (d) staining of DWFb1q0 cells demonstrates cardiomyocyte origin of mtDNA in AC cells.
Both a and bMHC transcripts were detected by RT-PCR in the AC cells. a-MHC is the principal isoform found in adult hearts, that almost completely replaces bMHC soon after birth [31], and its expression is restricted to the cardiac chambers [32]. Detection of a-MHC transcript in the cells clearly indicates their cardiac origin. At the protein level, the myosins were typed using four different antibodies. AC16 cells react
144
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
Fig. 8. RT PCR analysis of AC cells. A: RT-PCR of bMHC and of COX VIIc (loading control) showing the presence of bMHC in AC16 (1, 4), and in human heart (2, 5), absent in DWFb1q0 (3, 6). B: Expression of BNP, 298 bp (1, 2), CaCNA1c, 563 bp (3, 4), a-cardiac actin, 387 bp (5, 6), aMHC, 389 bp (7, 8) in human heart (1, 3, 5, 7) and in AC16 (2, 4, 6, 8). C: Expression of GATA4 (1, 2), MYCD (3, 4), NFATc4 (5, 6) in adult human heart (1, 3, 5) and AC16 cells (2, 4, 6). D: RT-PCR analysis of AC16 before (1) and after (2) silencing the SV40 gene and human heart (3) showing expression of BMP2 after silencing. M: size marker.
with MF20 (Developmental Studies Hybridoma Bank), and the ventricular MHC (Chemicon) antibodies, both of which recognize the LMM epitope of a and b MHC. The cells also react with the Novocastra antibody which recognizes only slow myofibers, where bMHC predominates. They do not react with antibodies to skeletal muscle-specific MHC. b-MHC is expressed in cardiac muscle and is abundant in both fetal and adult human ventricle and in adult atrium [31]. Considering the data at the mRNA and at the protein level, the cells express both a and bMHC, and ventricular MLC1, indicating the cardiac tissue origin and phenotype. Additionally, the cells stained for the intermediate filament desmin, an early myogenic marker expressed by both skeletal and cardiac muscle, at the premyofibril stage of differentiation [33,34]. The cells also expressed a-cardiac actin, the adult heart-specific isoform, and do not express either the skeletal muscle or the smooth muscle isoforms. a-Cardiac actin is expressed by both the adult and fetal skeletal and cardiac muscle, and also by cultured cells from these tissues [35,36]. Although the cardiac and the skeletal muscle express many genes in common, their development is both temporally and spatially unrelated, and there is no evidence of skeletal muscle cells in the original tissue from which these cell lines were derived. The presence of a and bMHC and desmin confirms the myogenic origin of the cells, because they are not
expressed by non-myogenic cells, such as the DWFb1q0 fibroblasts. Furthermore, the clones did not express the FSP1 at the transcriptional and at the protein levels [37], and do not express the intermediate filament vimentin, a mesenchymal marker, normally expressed by fibroblasts in culture. H&E stain of differentiated AC16 cells and that of human myoblast controls and immunostaining with Ki67 antibodies indicate, that under conditions that favor differentiation, the AC16 cells seem to undergo karyokinesis, a characteristic feature of cardiomyocytes, as well as cell fusion (a property of skeletal myoblasts) to form multinucleated syncytia. 4.4. Cardiac transcription factors AC16 cells expressed the heart-specific transcription factors GATA4, MYCD and NFATc4 that are involved in myocardial differentiation and function. GATA4 is a zinc finger transcription factor which regulates the expression of a number of cardiac tissue-specific genes [38]. NFATc4 contributes to the development of several organ systems, particularly, the heart and blood vessels [39–41]. MYCD is abundantly expressed in embryonic cardiac and smooth muscle lineages (not in skeletal muscle) before becoming restricted to the myocardium after birth [42]. The expression of GATA4 and NFATc4 transcripts are down regulated as a result of T-ag
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
silencing, concomitantly with the inhibition of cell proliferation. MYCD expression on the other hand is transiently up regulated before reaching lower levels. These changes may perhaps be interrelated because MYCD is a known transcriptional co-regulator of cardiac genes. Silencing the SV40 gene also turned on the expression of BMP2 that was previously down regulated. BMP2, is a member of the bone morphogenetic protein family of secreted signaling molecules essential for heart specification and cardiomyocyte differentiation [43]. a1C subunit of the L-type Ca channel (CaCNa1C) is the predominant route for calcium entry into cardiac myocytes and essential for normal embryonic heart function and morphogenesis [44], and brain natriuretic peptide (BNP), is a hormone of cells of myocardial origin, preferentially produced and secreted by the ventricles of the heart without normal storage in granules [45]. Expression of these transcription factors in our cultures represents useful markers of cardiac myogenesis, and therefore, the AC cells may afford a good system to study transcriptional regulation of myocardial development. These findings taken together imply that AC16 cells are not only committed to the myogenic lineage but they are further into the pathway of cardiomyocyte differentiation, and may be intermediate in their stage of development, perhaps at the precontractile stage. This is supported by electron microscopic analysis of our cells which reveals myofibrils in the subsarcolemmal region, in contrast to mature cardiomyocytes, where organized sarcomeres and myofibrils lie along the long axis of the cells [46]. Furthermore, the contractile proteins are not organized into sarcomeres in the myofibrils and T-tubules are absent. These data may indicate that the AC cells may be precontractile, which is supported by the lack of spontaneous contractile activity seen in these cells. 4.5. Intercellular communication and gap junction coupling
145
Postnatally, Cx-43 is present in the ventricular myocardium with virtually no trace of Cx-40, while Cx-40 is present in the atrial myocardium and in the conduction system of most species [48,49]. Therefore, expression of Cx-43 may be considered typical of ventricular myocytes in culture. Surprisingly, the AC cultures derived from adult ventricular tissue also express Cx-40. During development, the expression patterns of these connexins are found to be overlapping [50]. Therefore, the expression of both Cx-43 and Cx-40 may perhaps be due to de-differentiation caused by the SV40 transformation. In this context, it is also interesting that the AC cells strongly express another atrial marker, ANP, expressed by atrial myocytes at all ages and in ventricles from fetal up to 2.5 years postnatal. ANP is stored in secretory granules, but is practically absent in adult ventricular tissue [51,52]. However, it is found to be upregulated and stored in long term cultures of adult rat atrial and ventricular cardiomyocytes [53]. The expression of atrial markers in cells derived from ventricular tissue may also be attributed to the immortalization by SV40 gene. 4.6. Electrophysiology The cells that were examined probably do not have major inward currents like INa and ICa,L and outward currents like IK1 or Ito; they also do not have pacemaker current, If. Paucity of voltage-activated conductances and a low resting membrane potential are consistent with an undifferentiated state of the cells examined, possibly due to transformation by SV40. Furthermore, all the functionally relevant cell types present in the intact myocardium and the extracellular matrix components, including neuronal factors that are required to obtain functionally active cardiomyocytes, are not present in our cultures [52]. The absence of sympathetic innervation may also contribute to the lack of a significant AP [54]. 4.7. SV40 large T-ag
When grown in mitogen-free medium, the AC cells with single centrally-located nucleus appear to be closely aligned in parallel and on prolonged culture, may resemble a multinucleated syncytium both on EM analysis and H&E histochemistry. Under conditions that do not favor cell division, the formation of multinucleated syncytium may be due to uncoupling of cytokinesis from nuclear division, which is a common feature of cardiomyocytes. However, H&E analysis support cell fusion as another mechanism for formation of multinucleated cells, similar to that observed in skeletal muscle cells. Intermyocyte communication through gap junction coupling was demonstrated by Lucifer yellow dye transfer studies. The AC cells in differentiating medium seem to communicate both as functional, as well as structural syncytium and the presence of coupled gap junctions and gap junction proteins Cx-43 and Cx-40 support this. While functional gap junctions are present early in skeletal muscle development, and in myoblast cultures, they are not present in myotube cultures and in adult skeletal muscle [47].
The introduction of the SV40 gene has made it possible to force primary cardiomyocytes to re-enter the cell cycle and provide an in vitro model which expresses several characteristics of cardiomyocytes. At the same time, the presence of the SV40 gene may prevent the inclusive expression of the cardiomyocyte phenotype, and therefore cause limitations on the cell lines. This can be overcome to some extent by silencing the large T-ag by the siRNA technique. Primary cardiomyocytes on prolonged culture tend to lose some of their terminally differentiated properties, and the presence of SV40 gene seems to enhance this effect in our cells. The developmental stage of the AC cells is determined by the SV40 gene, which may have caused the cells to dedifferentiate. De-controlling cell cycle regulation, the loss of organized contractile apparatus, the low AP, down regulation of transcription factors and the expression of atrial markers are perhaps due to the large T-ag expression. Nevertheless, in the absence of a human cardiomyocyte culture model, the AC
146
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147
cells can be useful for investigators for studies of regulation of cardiomyogenesis and function, both before and after silencing the SV40 gene. In summary, we have developed stable proliferating cell lines, which exhibit ultrastructural, molecular genetic and immunocytochemical characteristics of cardiomyocytes, and are capable of differentiating under altered culture conditions. The cells can be repeatedly frozen, thawed, and propagated. They express cardiomyocyte markers, have coupled gap junctions, and may be intermediate in their state of differentiation, perhaps at the precontractile stage. They may therefore be useful in vitro models to study signaling pathways that regulate cardiomyogenesis, to evaluate pharmacological and physiological effects of drugs in order to devise and test therapeutic strategies for myopathological conditions. In addition, the technique described could be utilized to immortalize other primary cells that have exited the cell cycle and are therefore incapable of proliferating in culture for extended periods of time.
[6]
Acknowledgements
[13]
We thank Dr. S. DiMauro, Dr. Eric Schon, Dr. E. Bonilla, Dr. Sara Shanske and Dr. Hal Skopicki for helpful discussions, Dr. R. Robinson for help with electrophysiology, Dr. Alexander Flint for dye transfer studies, and Dr. Dorothy Warburton, for the cytogenetic analysis. Dr. Eric Nielson is gratefully acknowledged for the FSP1 antibody. This work was supported by grants from the US National Institutes of Health HD32062 (M.H.) and grant # 9951061T from the American Heart Association, NY affiliate, to M.M.D.
[7]
[8]
[9]
[10]
[11]
[12]
[14]
[15] [16] [17]
[18]
Appendix A. Supplementary figures [19]
Supplementary figures associated with this article can be found, in the online version, at doi:10.1016/j.yjmcc.2005.03.003.
[20]
[21]
References [1]
[2]
[3] [4]
[5]
Murry CE, Wiseman RW, Schwartz SM, Hauschka SD. Skeletal myoblast transplantation for repair of myocardial necrosis. J Clin Invest 1996;98:2512–23. Chiu RC, Zibaitis A, Kao RL. Cellular cardiomyoplasty: myocardial regeneration with satellite cell implantation. Ann Thorac Surg 1995; 60:12–8. Campion DR. The muscle satellite cell: a review. Int Rev Cytol 1984;87:225–51. Claycomb WC, Palazzo MC. Culture of the terminally differentiated adult cardiac muscle cell: a light and scanning electron microscope study. Dev Biol 1980;80:466–82. Marvin Jr. WJ, Robinson RB, Hermsmeyer K. Correlation of function and morphology of neonatal rat and embryonic chick cultured cardiac and vascular muscle cells. Circ Res 1979;45:528–40.
[22]
[23]
[24]
[25]
[26]
Steinhelper ME, Lanson Jr. NA, Dresdner KP, Delcarpio JB, Wit AL, Claycomb WC, et al. Proliferation in vivo and in culture of differentiated adult atrial cardiomyocytes from transgenic mice. Am J Physiol 1990;259:H1826–H1834. Jaffredo T, Chestier A, Bachnou N, Dieterlen-Lievre F. MC29immortalized clonal avian heart cell lines can partially differentiate in vitro. Exp Cell Res 1991;192:481–91. Katz EB, Steinhelper ME, Delcarpio JB, Daud AI, Claycomb WC, Field LJ. Cardiomyocyte proliferation in mice expressing alphacardiac myosin heavy chain-SV40 T-antigen transgenes. Am J Physiol 1992;262:H1867–H1876. Negishi Y, Kudo A, Obinata A, Kawashima K, Hirano H, Yanai N, et al. Multipotency of a bone marrow stromal cell line, TBR31-2, established from ts-SV40 T antigen gene transgenic mice. Biochem Biophys Res Commun 2000;268:450–5. Brunskill EW, Witte DP, Yutzey KE, Potter SS. Novel cell lines promote the discovery of genes involved in early heart development. Dev Biol 2001;235:507–20. Wang YC, Neckelmann N, Mayne A, Herskowitz A, Srinivasan A, Sell KW, et al. Establishment of a human fetal cardiac myocyte cell line. In Vitro Cell Dev Biol 1991;27:63–74. Li R, Mickle D, Weisel R, Carson S, Omar S, Tumiah LC, et al. Human pediatric and adult ventricular cardiomyocytes in culture: assessment of phenotypic changes with passaging. Cardiovasc Res 1996;32:362–73. Goldman BI, Wurzel J. Human fetal cardiocytes in enriched culture. In Vitro Cell Dev Biol Anim 1995;31:731–4. Claycomb W, Lanson N, Stallworth B, Egeland D, Delcaprio J, Bahinski A, et al. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of adult cardiomyocyte. Proc Natl Acad Sci USA 1998;95:2979–84. Hannon GJ. RNA interference. Nature 2002;418:244–51. Polinger IS. Separation of cell types in embryonic heart cell cultures. Exp Cell Res 1970;63:78–82. Nag AC. Embryonic chick heart muscle cells. In: Piper HM, editor. Cell culture techniques in heart and vessel research. New York: Springer-Verlag; 1990. p. 4–19. Singer K, Scearce R, Tuck D, Whichard L, Denning S, Haynes BF. Removal of fibroblasts from human epithelial cell cultures with use of a complement fixing monoclonal antibody reactive with human fibroblasts and monocytes/macrophages. J Invest Dermatol 1989;92:166– 70. Litzkas P, Jha KK, Ozer HL. Efficient transfer of cloned DNA into human diploid cells: protoplast fusion in suspension. Mol Cell Biol 1984;4:2549–52. King MP, Attardi G. Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation. Science 1989;246:500–3. Mohamed SN, Holmes R, Hartzell CR. A serum-free, chemicallydefined medium for function and growth of primary neonatal rat heart cell cultures. In Vitro 1983;19:471–8. Libby P. Long-term culture of contractile mammalian heart cells in a defined serum-free medium that limits non-muscle cell proliferation. J Mol Cell Cardiol 1984;16:803–11. Nag AC, Ingland M, Cheng M. Factors controlling embryonic heart cell proliferation in serum-free synthetic media. In Vitro Cell Dev Biol 1985;21:553–62. Bottenstein J, Hayashi I, Hutchings S, Masui H, Mather J, McClure DB, et al. The growth of cells in serum-free hormonesupplemented media. Methods Enzymol 1979;58:94–109. Juttermann R, Li E, Jaenisch R. Toxicity of 5-aza-2′-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc Natl Acad Sci USA 1994;91:11797–801. Cozzarelli NR. The mechanism of action of inhibitors of DNA synthesis. Annu Rev Biochem 1977;46:641–68.
M.M. Davidson et al. / Journal of Molecular and Cellular Cardiology 39 (2005) 133–147 [27] Salviati L, Hernandez-Rosa E, Walker WF, Sacconi S, DiMauro S, Schon EA, et al. Copper supplementation restores cytochrome c oxidase activity in cultured cells from patients with SCO2 mutations. Biochem J 2002;363:321–7. [28] Spurr AR. A low-viscosity epoxy resin embedding medium for electron microscopy. J Ultrastruct Res 1969;26:31–43. [29] DeCaprio JA. The role of the J domain of SV40 large T in cellular transformation. Biologicals 1999;27:23–8. [30] Protas L, DiFrancesco D, Robinson RB. L-type but not T-type calcium current changes during postnatal development in rabbit sinoatrial node. Am J Physiol Heart Circ Physiol 2001;281:H1252–H1259. [31] Weiss A, Leinwand LA. The mammalian myosin heavy chain gene family. Annu Rev Cell Dev Biol 1996;12:417–39. [32] Morkin E. Control of cardiac myosin heavy chain gene expression. Microsc Res Tech 2000;50:522–31. [33] Furst DO, Osborn MKW. Myogenesis in the mouse embryo: differential onset of expression of myogenic proteins and the involvement of titin in myofibril assembly. J Cell Biol 1989;109:517–27. [34] Schultheiss T, Lin ZX, Ishikawa H, Zamir I, Stoeckert CJ, Holtzer H. Desmin–vimentin intermediate filaments are dispensable for many aspects of myogenesis. J Cell Biol 1991;114:953–66. [35] Franke WW, Stehr S, Stumpp S, Kuhn C, Heid H, Rackwitz HR, et al. Specific immunohistochemical detection of cardiac/fetal alpha-actin in human cardiomyocytes and regenerating skeletal muscle cells. Differentiation 1996;60:245–50. [36] Eppenberger-Eberhardt M, Flamme I, Kurer V, Eppenberger HM. Reexpression of alpha-smooth muscle actin isoform in cultured adult rat cardiomyocytes. Dev Biol 1990;139:269–78. [37] Strutz F, Okada H, Lo CW, Danoff T, Carone RL, Tomaszewski JE, et al. Identification and characterization of a fibroblast marker: FSP1. J Cell Biol 1995;130:393–405. [38] Patient RK, McGhee JD. The GATA family (vertebrates and invertebrates). Curr Opin Genet Dev 2002;12:416–22. [39] Graef IA, Chen F, Crabtree GR. NFAT signaling in vertebrate development. Curr Opin Genet Dev 2001;11:505–12. [40] Horsley V, Friday BB, Matteson S, Kegley KM, Gephart J, Pavlath GK. Regulation of the growth of multinucleated muscle cells by an NFATC2-dependent pathway. J Cell Biol 2001;153:329–38. [41] Bushdid PB, Osinska H, Waclaw RR, Molkentin JD, Yutzey KE. NFATC3 and NFATC4 are required for cardiac development and mitochondrial function. Circ Res 2003;92:1305–13.
147
[42] Wang D, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E, et al. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell 2001;105:851–62. [43] Walters MJ, Wayman GA, Christian JL. Bone morphogenetic protein function is required for terminal differentiation of the heart but not for early expression of cardiac marker genes. Mech Dev 2001;100:263– 73. [44] Rottbauer W, Baker K, Wo ZG, Mohideen MA, Cantiello HF, Fishman MC. Growth and function of the embryonic heart depend upon the cardiac-specific L-type calcium channel alpha1 subunit. Dev Cell 2001;1:265–75. [45] Azzazy HM, Christenson RH. B-type natriuretic peptide: physiologic role and assay characteristics. Heart Fail Rev 2003;8:315–20. [46] Artman M. In: Landes RG, editor. Developmental changes in myocardial inotropic responsiveness. Texas: Austin; 1994. [47] Constantin B, Cronier L. Involvement of gap junctional communication in myogenesis. Int Rev Cytol 2000;196:1–65. [48] Van Kempen MJ, Vermeulen JL, Moorman AF, Gros D, Paul DL, Lamers WH. Developmental changes of connexin40 and connexin43 mRNA distribution patterns in the rat heart. Cardiovasc Res 1996;32:886–900. [49] Severs NJ. The cardiac muscle cell. Bioessays 2000;22:188–99. [50] Delorme B, Dahl E, Jarry-Guichard T, Briand JP, Willecke K, Gros D, et al. Expression pattern of connexin gene products at the early developmental stages of the mouse cardiovascular system. Circ Res 1997;81:423–37. [51] Claycomb WC. Atrial-natriuretic-factor mRNA is developmentally regulated in heart ventricles and actively expressed in cultured ventricular cardiac muscle cells of rat and human. Biochem J 1988;255: 617–20. [52] Janssen PM, Lehnart SE, Prestle J, Hasenfuss G. Preservation of contractile characteristics of human myocardium in multi-day cell culture. J Mol Cell Cardiol 1999;31:1419–27. [53] Eppenberger-Eberhardt M, Messerli M, Eppenberger HM, Reinecke M. New occurrence of atrial natriuretic factor and storage in secretorially active granules in adult rat ventricular cardiomyocytes in long-term culture. J Mol Cell Cardiol 1993;25:753–7. [54] Lloyd TR, Marvin Jr. WJ. Sympathetic innervation improves the contractile performance of neonatal cardiac ventricular myocytes in culture. J Mol Cell Cardiol 1990;22:333–42.
