Experimental Hematology 2012;40:207–215
Para-NO-aspirin inhibits NF-kB and induces apoptosis in B-cell progenitor acute lymphoblastic leukemia Naveed I. Khana, Adam Cisternea, Rana Baraza, Kenneth F. Bradstockb, and Linda J. Bendalla a
Westmead Institute for Cancer Research, Westmead Millennium Institute, University of Sydney, Sydney, New South Wales, Australia; bDepartment of Haematology, Westmead Hospital, Sydney, New South Wales, Australia (Received 9 July 2011; revised 6 November 2011; accepted 10 November 2011)
Although patients with acute lymphoblastic leukemia (ALL) usually achieve complete remission, disease relapse is common and difficult to treat. Para-NO-aspirin (para-NO-ASA) is a novel drug with demonstrated efficacy against a number of solid tumors and most recently chronic lymphocytic leukemia. In this study, we used ALL cell lines to assess the effects on cell viability by flow cytometry and investigated the mechanism of cell death using chemical inhibitors of key molecules and assessed the effects by flow cytometry, electrophoretic mobility shift assay, Western blotting, and quantitative reverse transcription polymerase chain reaction. Para-NO-ASA induced cell death in the pre-B ALL cell lines in association with increased reactive oxygen species, and suppression of nuclear factorLkB (NF-kB) activity. Chemical inhibitors of NF-kB similarly induced apoptosis in ALL cells, suggesting a role for suppression of NF-kB in para-NO-ASALinduced cell death. Modulation of NF-kB was not via regulation of IkB but potentially through suppression of ROCK1 and loss of reduced glutathione. Our results demonstrate that para-NO-ASA potently induces apoptosis in B-lineage ALL cells via a reactive oxygen speciesLdependent mechanism that is associated with suppression of NF-kB activity. Ó 2012 ISEH - Society for Hematology and Stem Cells. Published by Elsevier Inc.
Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children, and represents 15% of all leukemias in adults. Although almost all children respond to chemotherapy and achieve remission, in up to 20% of patients the disease returns and the prognosis for these patients is poor [1]. In adults with ALL, only 30% to 40% achieve durable complete remissions. Relapse in adult patients is very difficult to treat, with !12% survival at 5 years [2]. Currently, there is an urgent requirement for new drugs with efficacy against ALL. Nitric oxidedonating nonsteroidal anti-inflammatory drugs (NSAIDs) represent a promising class of compounds with wide anticancer properties [3]. One of the betterstudied nitric oxidedonating NSAIDs, para-NO-aspirin (para-NO-ASA), showed a several hundred-fold increase in potency compared with aspirin [4]. Para-NO-ASA is
Offprint requests to: Linda J. Bendall, B.Sc., Ph.D., Westmead Institute for Cancer Research, Westmead Millennium Institute, Westmead, NSW 2145, Australia; E-mail:
[email protected] Supplementary data related to this article can be found online at doi: 10.1016/j.exphem.2011.11.001
believed to mediate anticancer effects by modulating a number of cellular processes, including inhibition of b-catenin/Wnt, and nuclear factorkB (NF-kB) signaling pathways, and activation of the p38 mitogen-activated protein kinase (MAPK) and c-jun N-terminal kinase (JNK) pathways [5]. We and others have shown that Wnt signaling enhances the survival and proliferation of ALL cells [6,7], while others have demonstrated that NF-kB signaling is constitutively activated in B-lineage ALL [8]. Activation of p38 MAPK and JNK has also been associated with apoptosis induction in ALL cells [9,10]. Together this suggests that para-NOASA may be a useful compound for the treatment of ALL. We found that para-NO-ASAinduced cell death was primarily mediated by induction of reactive oxygen species (ROS) and subsequent apoptosis. Cell death was largely independent of MAPK signaling and demonstrated little evidence to support the involvement of inhibition of Wnt signaling. However, para-NO-ASAinduced cell death was dependent on ROS generation and this was associated with suppression of constitutively activated NF-kB in ALL cells. Inhibitors of NF-kB induced a similar cell death in ALL cells, suggesting that suppression of NF-kB is sufficient for para-NO-ASAinduced cell death.
0301-472X/$ - see front matter. Copyright Ó 2012 ISEH - Society for Hematology and Stem Cells. Published by Elsevier Inc. doi: 10.1016/j.exphem.2011.11.001
208
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
Figure 1. Para-NO-ASA induces caspase-dependent apoptosis in ALL cells. (A) Representative dot plots showing Annexin V/propidium iodide (PI) staining of NALM6 cells treated with 10 mM para-NO-ASA for the times in hours indicated on the plots. (B) The mean 6 standard error (SE) of duplicate experiments showing the proportion of viable, early apoptotic and late apoptotic cells where the ALL cell lines, NALM6, Reh, and LK63 were treated with 10 mM para-NO-ASA for the indicated times. (C) ALL cell lines, NALM6, Reh, and LK63 were treated with the indicated concentration of para-NO-ASA for 24 hours and viability assessed by flow cytometry. Mean 6 standard deviation of a representative experiment is shown (n $ 5). *p ! 0.05. (D) Activation of caspases, as measured by Z-VAD fluorescein isothiocyanate (FITC) staining, in the specified cell lines following the indicated time of exposure to 10 mM NOASA. Mean 6 SE of a representative experiment is shown (n 5 4). In (E), cells were preincubated with 100 mM Z-VAD FMK for 20 min before the addition of para-NO-ASA. Viability was assessed using Annexin V and 7-amino-actinomycin D staining by flow cytometry. Vertical bars represent SE of a representative repeat experiment (n 5 5). #p ! 0.05 compared to cultures not pretreated with Z-VAD FMK.
Materials and methods Chemicals and reagents Para-NO-ASA [2-(acetyloxy)benzoic acid 4-(nitrooxymethyl)phenyl ester] was purchased from NicOx (Sophia Antipolis, France) or Caymans Chemicals (Ann Arbor, MI, USA). N-acetyl cysteine, the NF-kB inhibitors Bay11-7085 and caffeic acid phenethyl ester, and the ROCK1 inhibitors Y27632 and 1-(5-Isoquinolinylsulfonyl) homopiperazine dihydrochloride (Fasudil), were obtained from Sigma-Aldrich (Sydney, NSW, Australia). The following antibodies were purchased: mouse antib-catenin (BD Pharmingen, North Ryde, NSW, Australia), anti-ROCK1, antip38 MAPK, antiphospho-p38 MAPK (Thr180/Tyr182), and antiphospho-SAPK/ JNK (Thr183/Tyr185) (Genesearch, Arundel, QLD, Australia) antib-actin (Sigma-Aldrich) and anti-IkBa (Cell Signaling Technologies, Danvers, MA, USA). The JNK inhibitor SP600125, the p38 MAPK inhibitor SB203580 and its control SB202474 were purchased from Calbiochem (Darmstadt, Germany). Leukemic cell lines Pre-B ALL cell lines NALM6 (DSMZ, Braunschweig, Germany), Reh (ATCC, Manassas, VA, USA) and LK63 (gift of Prof. A. Boyd, QMIR, Australia) were cultured in RPMI medium with 10% fetal calf serum as described previously [11].
Flow cytometry Apoptosis was assessed using the Annexin V detection kit from BenderMed Systems (Burlingame, CA, USA) or BD Pharmingen. Viable cells were gated as Annexin V and vital dye doublenegative and expressed as a percentage of total cells. ROS was detected by incubation with 20 mM of 20 ,70 - dichlorofluorescein diacetate (H2DCFDA) dye (Molecular Probes, Invitrogen, Grand Island, NY, USA) for 30 min at 37 C in the dark. Data acquisition was performed on a FACSCalibur flow cytometer and analyzed using CELLQuest software (Becton Dickinson, Sydney, NSW, Australia). Reduced glutathione (GSH) levels were measured after incubation with 400 mM monochlorobimane (Molecular Probes) for 20 min at room temperature as described by Webb et al. [12], before analysis on an LSRII flow cytometer. Semi-quantitative reverse transcription polymerase chain reaction Total RNA was extracted using Trizol reagent and genomic DNA removed by RNase-free DNase. RNA was reverse-transcribed with MMLV Reverse Transcriptase and oligo-dT primers for 60 min at 42 C. Polymerase chain reaction analysis was performed using Taq DNA polymerase with the following cycles: 95 C for 30 sec, 55 C for 30 sec, and 72 C for 60 sec, with a first cycle at
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
209
Figure 2. Production of ROS is partially responsible for para-NO-ASAinduced cell death. ROS production in NALM6 cells treated with 10 mM para-NOASA for the indicated times (A) or with indicated concentrations of para-NO-ASA for 3 hours (B) was measured by incorporation of DCFDA intracellular dye and assessed by flow cytometry. Mean 6 standard deviation (SD) of triplicates is shown from one of two experiments. ALL cells were pretreated with 2.5 mM N-acetyl cysteine (NAC) for 1 hour before addition of 10 mM para-NO-ASA and ROS production in NALM6 cells (C), or survival of the indicated cell lines, as measured by Annexin V/propidium staining (D), is shown. Bars indicate mean 6 SD of repeat experiments (n $ 2). *p ! 0.05 compared to untreated control. #p ! 0.05 compared to cells treated with the same dose of para-NO-ASA in the absence of NAC. ND 5 not determined.
95 C for 10 min and a final cycle at 72 C for 10 min. Samples were analyzed in the linear phase of the reaction (35 cycles for ROCK1 and 30 cycles for glyceraldehyde phosphate dehydrogenase). Specific primers for glyceraldehyde phosphate dehydrogenase have been reported previously [13], and those for ROCK1 were: forward - ATGATGTGCCTGAAAAATGGG; and reverse - AAAAATACCCCAACCGACCAC. Amplified products were resolved in a 2% agarose gel, visualized with ethidium bromide staining and imaged using KODAK Image Station 4000MM (Molecular Imaging Systems, Carestream Health
Australia, Richmond, Vic, Australia), and composite images compiled using Adobe Photoshop 5.0. Western blotting ALL cells were incubated as indicated and lysates prepared as described previously [14]. Equal amounts of protein were separated on 7.5% or 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and transferred onto nitrocellulose membranes as described [14]. Membranes were incubated with specific primary antibodies, followed by appropriate secondary antibodies
210
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
Figure 3. Signaling through p38 MAPK is involved in NO-ASAinduced cell death. (A) A Western blot representative of two experiments showing phosphorylation of p38 MAPK and JNK in NALM6 cells treated with 10 mM NO-ASA for the indicated time periods. (B) Inhibition of NO-ASAinduced phosphorylation of p38 MAPK and JNK by the antioxidant N-acetyl cysteine (NAC). A representative Western blot from two experiments is shown. Survival (C) and caspase-3 activation (D) in NALM6 cells pretreated with inhibitors of p38 MAPK (10 mM SB203580) or JNK (20 mM SP600125) for 1 hour before the addition of 10 mM NO-ASA. Cell survival was measured after 24 hours of treatment, while caspase-3 activation was analyzed after 12 hours of treatment. SB202747 was used as the control for SB203580. Mean 6 standard deviation of three experiments is shown. *p ! 0.05 compared to dimethyl sulfoxide (DMSO) control in the presence of NO-ASA.
conjugated to horseradish peroxidase. Bands were visualized using enhanced chemiluminescence (Perkin-Elmer, Boston, MA, USA). Electromobility shift assay Cell lysates were prepared from 107 leukemic cells in 10 mM Tris, 150 mM NaCl (pH 7.5), containing 1% Triton X100, 1 mM ethylenediaminetetraacetic acid, 4 mM Na3VO4, 10 mM NaF, 4 mg/mL aprotinin, 1 mM phenylmethylsulfonyl fluoride, 0.1 mg/mL leupeptin (all obtained from Sigma-Aldrich), and protease inhibitor tablets (Roche, Sydney, NSW, Australia) as per manufacturer’s instruction at 4 C for 30 min and the lysates clarified by centrifugation at 14,000g for 10 min. Gel shift was conducted using 5 to 10 mg protein lysate incubated in binding buffer (20 mM Tris-Cl [pH 8], 10% (v/v) glycerol, 1 mM ethylenediaminetetraacetic acid, 1 mM dithiothreitol, 1 mg poly dI-dC, 25 mM KCl, and 3% bovine serum albumin) for 15 min before addition of probe radiolabeled with 32P-ATP (3000 Ci/mmol) (MP Biomedicals Australasia,
Seven Hills, NSW, Australia) using T4 polynucleotide kinase. Probes were double-stranded NF-kB probe F: AGTTGAGGGGACTTTCCCAGGC and R: TCAACTCCCCTGAAAGGGTCC (Promega Corporation, Madison, WI, USA). Excess cold probe (100) was added where indicated and samples incubated for 15 min at room temperature before addition of 1 mL loading buffer (0.1% [wt/vol] bromophenol blue and 10% [vol/vol] glycerol). Samples were loaded onto an electromobility shift assay gel (4% [wt/vol] acrylamide/1 TBE), which had been cast in a large Bio-Rad protean II apparatus and pre-pherosed at 150 V for 30 min. Samples were run at 200 V for 2 hours, the gels dried at 80 C for 40 to 50 min and exposed to x-ray film at 70 C. Statistical analysis Comparisons between two groups were performed using Student’s t tests and between multiple groups using two-way analysis of variance analysis. Pairwise comparisons between groups were
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
211
adjusted for multiple comparisons using Bonferroni’s method. Statistical analysis was performed using the SPSS statistical package (IBM, Armonk, NY, USA).
Results Apoptosis induced by para-NO-ASA is ROS-dependent Para-NO-ASA is known to have growth inhibitory effects in various cancer cell types, including colorectal cancer, and has been reported to regulate factors involved in ALL proliferation and survival [6,7]. In colorectal cancer, para-NO-ASA induces production of ROS, resulting in activation of the intrinsic death machinery [15]. Most recently, NO-ASA has been shown to have efficacy against chronic lymphocytic leukemia using a nude mouse xenograft model via inhibition of b-catenin [16]. Para-NOASA similarly induced cell death in ALL cells (Fig. 1A, B) in a time- and dose-dependent manner (Fig. 1B, C). This was associated with caspase activation (Fig. 1D) and could be inhibited by the caspase inhibitor Z-VAD, demonstrating caspase-dependent apoptosis (Fig. 1E). Intracellular ROS levels rose significantly in a dose-dependent manner in leukemic cells treated with para-NO-ASA (Fig. 2A, B). The free radical scavenger N-acetyl cysteine largely inhibited the accumulation of ROS in response to para-NO-ASA (Fig. 2C), and similarly suppressed para-NO-ASAinduced apoptosis (Fig. 2D). Although it is clear that ROS was important for paraNO-ASAinduced apoptosis, the failure to completely inhibit apoptosis is likely due to the incomplete blockade of ROS by N-acetyl cysteine (Fig. 2C). ROS are known to mediate cell death via activation of the MAPK signaling pathways [17], and these pathways have also been reported to mediate NO-ASAinduced apoptosis in colorectal cancer [18]. NO-ASA induced JNK and p38 MAPK phosphorylation in NALM6 cells in an ROS-dependent manner (Fig. 3A, B). However, inhibition of p38 MAPK resulted in only a small reduction in cell death and caspase-3 activation in NO-ASAtreated cells, while inhibition of JNK had no effect (Fig. 3C, D). This suggests that ROS-induced MAPK signaling plays a small but significant role in NO-ASAinduced apoptosis. Para-NO-ASA treatment attenuated NF-kB signaling in leukemic cell lines Para-NO-ASA is known to inhibit NF-kB and Wnt signaling in colorectal cancer cells [5,19] and Wnt signaling in chronic Figure 4. Para-NO-ASA does not prevent b-catenin stabilization, but inhibits constitutively active NF-kB in leukemic cells. (A) NALM6 cells were treated with control or Wnt3A-conditioned media in the presence or absence of 10 mM para-NO-ASA for 6 hours. Simultaneous Western blot of b-catenin and b-actin was performed, full-length and cleaved b-catenin is indicated. The blot is representative of two experiments. NALM6 cells (B, D, and E) or Reh and LK63 cells (C) were treated with 10 mM para-NO-ASA (NO-ASA) or vehicle (dimethyl sulfoxide [DMSO]) for
12 hours (B, C) or para-NO-ASA þ N-acetyl cysteine (E) or the indicated time (D). Total protein lysates were hybridized to 32P-labeled NF-kB probe and analyzed by electromobility shift assay. Where indicated, a 100-fold excess of unlabeled probe (Cold) was added during the hybridization step. Arrows indicate small homodimer (p50/p50), heterodimer (p50/ p65), and large homodimer (p65/p65) subunits of NF-kB complex. Data shown are representative of repeated experiments (n $ 2).
212
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
Figure 5. Potential mechanism for ROS-mediated inhibition of NF-kB activity. (A) IkBa expression following a 12-hour incubation with placebo (Control) or 10 mM para-NO-ASA (NO-ASA, 10 mM) as determined by flow cytometry. The isotype control (Iso Cont) is shown. A representative histogram from one of two experiments is shown. (B) ROCK1 expression in NALM6, LK63, and Reh cells after 12 hours incubation with 10 mM para-NO-ASA as determined by semi-quantitative reverse transcription polymerase chain reaction (upper panels) or Western blotting. Total ROCK1 protein was quantitated by densitometry with both the full-length and cleaved forms being included and shown as a ratio to b-actin. Data from one of two experiments are shown. (C) Levels of the reduced form of GSH, as determined by flow cytometry using MBC, in NALM6 cells cultured for the indicated times in the presence of 5 mM para-NO-ASA. Representative histograms from three experiments are shown. The mean 6 standard deviation (SD) of the percentage of cells with reduced GSH and increased Annexin V binding is indicated on the histograms (n 5 3). (D) Indicated cell lines were treated with specified concentrations of H2O2 for 24 hours and cell viability assessed using Annexin/propidium iodide (PI) staining. Mean 6 standard error of duplicates from representative experiments is shown (n $ 2). (E) The indicated cell lines were treated with specified concentrations of Fasudil for 24 hours and cell viability assessed using Annexin/PI staining. Mean 6 SD of quadruplicates is shown. (F) NALM6 cells or LK63 were treated with 20 mM Y27632 or 40 mM Fasudil (ROCK1 inhibitors) and/or indicated concentrations of H2O2 for 24 hours and viability assessed as in (D). Representative experiments are shown (n 5 7 for Y27632 and n 5 1 for Fasudil). APC 5 allophycocyanin; FITC 5 fluorescein isothiocyanate; MCB 5 monochlorobimane.
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
213
Figure 6. Inhibition of NF-kB is sufficient to induce caspase-dependent cell death in ALL cells. (A) ALL cell lines were treated with the NF-kB inhibitors Bay11 or caffeic acid phenethyl ester (CAPE) at the indicated doses and analyzed by flow cytometry using Annexin V and propidium iodide staining to assess viability. Data from one of three experiments are shown. (B) Partial reversal of cell death by the pan-caspase inhibitor Z-VAD-FMK. Mean 6 standard deviation of triplicates is shown. *p ! 0.05 compared to cells treated with the same NF-kB inhibitor in the absence of Z-VAD-FMK. Data from one of two experiments is shown.
lymphocytic leukemia cells [16]. NF-kB and Wnt signaling provide strong prosurvival signals [6], with NF-kB signaling also inducing resistance to chemotherapy in various hematological malignancies [20]. ALL cells express very low levels of b-catenin unless stimulated by Wnt proteins [6]. Treatment with para-NO-ASA did not reduce the accumulation of b-catenin in the nucleus induced by the addition of exogenous Wnt3a as assessed by immunofluorescence (data not shown), or total b-catenin levels (Fig. 4A). However, there was evidence of b-catenin cleavage with the appearance of a 70-kD fragment (Fig. 4A), consistent with reports in chronic lymphocytic leukemia [16]. Because b-catenin can be cleaved by caspases and para-NO-ASA induces caspase-dependent cell death, it is difficult to know whether the cleavage of b-catenin was the cause or consequence of apoptosis induced by exposure to para-NO-ASA. Analysis of gene expression revealed that para-NO-ASA did not
suppress expression of Wnt-regulated genes, including survivin, Bcl-2, MMP9, versican, fibronectin, and gremlin1 (Supplementary Figure E1; online only, available at www.exphem.org; and data not shown). This, together with the low baseline b-catenin levels, suggests that suppression of Wnt signaling in unlikely to be the cause of para-NOASAinduced cell death in ALL cells. In contrast, electromobility shift assay demonstrated high levels of endogenous NF-kB activity in ALL cell lines, which was dramatically reduced by para-NO-ASA (Fig. 4BE), suggesting that para-NO-ASA may contribute to apoptosis by turning off the survival cues provided by the NF-kB signaling complex. How para-NO-ASA suppresses NF-kB is not understood and generation of ROS is usually associated with increased NF-kB activity via IkB degradation [21]. IkB was still present at significant, albeit somewhat reduced levels (Fig. 5A) after para-NO-ASA treatment. Inhibition of ROS
214
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
partially restored NF-kB binding, suggesting that ROS generation contributed to the downregulation of NF-kB in ALL cells (Fig. 4D). ROS can potentially inhibit NF-kB activity by suppressing expression of ROCK1 or depletion of GSH [22,23]. ROCK1 can activate NF-kB by phosphorylation of the transactivation domain of RelA/p65 [24], while GSH maintains the cysteine in a reduced state favoring DNA binding [25]. ROCK1 was strongly downregulated in response to para-NO-ASA treatment at the messenger RNA level and to a lesser extent at the protein level (Fig. 5B). In contrast, ROCK2 expression was not altered (data not shown). GSH levels also declined in response to para-NO-ASA (Fig. 5C), although reduced GSH levels were only observed in cells committed to cell death, suggesting that this observation could be the result rather than the cause of cell death. However, consistent with a role for ROS in para-NO-ASAinduced ALL cell death, H2O2 was able to induce cell death in ALL cells in a dosedependent manner (Fig. 5D). Inhibition of ROCK1 with Y27632 had only a minor affect on ALL cell viability (data not shown). Fasudil induced dose-dependent cell death in all three cell lines (Fig. 5E). In addition, inhibition of ROCK1 with either Y27632 or Fasudil enhanced the effect of mild oxidative stress (Fig. 5F), demonstrating that inhibition of ROCK1 sensitizes ALL cells to oxidative stress. Inhibition of NF-kB signaling in leukemic cell lines is sufficient to induce apoptosis In order to examine the importance of NF-kB suppression in the induction of apoptosis, we treated ALL cell lines with the NF-kB inhibitors Bay11-7085 and caffeic acid phenethyl ester. Both Bay11-7085 and caffeic acid phenethyl ester induced dose-dependent cell death (Fig. 6A) consistent with recently reported findings [26]. Pan-caspase activation was apparent (data not shown) and cell death could be partially prevented by the addition of the pan-caspase inhibitor Z-VAD (Fig. 6B). This indicates that NF-kB suppression alone is sufficient for induction of apoptosis in ALL cells. Discussion In keeping with the reported actions of para-NO-ASA in other cancers [27], para-NO-ASA induced apoptosis in ALL cells. The anticancer effects of para-NO-ASA have been attributed to modulation of multiple signaling pathways, including b-catenin/T-cell factor, MAPK, and NF-kB [28]. In contrast to Jurkat cells [27] and chronic lymphocytic leukemia cells [16], Wnt signaling was not altered in ALL cells, with nuclear accumulation of b-catenin and expression of Wnt-regulated genes [6] (http://www.stanford.edu/% 7ernusse/wntwindow.html) being unaffected (data not shown). However, ROS generation was required for paraNO-ASAinduced apoptosis in ALL cells, consistent with previous data [15]. ROS can induce cell death via activation of MAPK signaling or induction of DNA damage [29,30]. However, specific inhibition of p38 MAPK and JNK proteins
demonstrated only a limited role for p38 MAPK, but not JNK, in para-NO-ASAinduced apoptosis and we were unable to detect evidence of DNA damage. ALL cells have constitutive activation of NF-kB [8,31], which can impart resistance to apoptosis [20]. Para-NOASA suppressed constitutive NF-kB activity, and specific inhibitors of NF-kBinduced apoptosis, demonstrating that suppression of NF-kB is sufficient to mediate apoptosis in ALL cells. This highlights the potential of inhibitors of NF-kB as therapeutic agents in ALL. This study is the first to document that para-NO-ASA inhibits NF-kB in leukemic cells. Interestingly, regulation of IkB was not responsible for suppression of NF-kB activity, and although the mechanism remains to be confirmed, our study has revealed that paraNO-ASA, via ROS generation, depleted cellular stores of GSH. Such depletion of GSH has been shown to suppress the transcriptional activity of NF-kB without influencing nuclear protein levels [25,32]. In addition, we observed suppression of ROCK1 expression in response to para-NOASA. Loss of ROCK1 activity either by genetic or pharmacological means can inhibit NF-kB activity in other cell types [23]. Inhibition of ROCK1 alone was sufficient to induce cell death and sensitized ALL cells to cell death induced by oxidative stress. Both of these mechanisms are consistent with observations in colorectal cells [33]. Overall, we have demonstrated that the NSAID, para-NOASA, is capable of inducing apoptotic cell death in ALL cells, raising the possibility of using selected NSAIDs as therapeutic agents for the treatment of pre-B ALL. Based on a better understanding of the mechanism of action, para-NO-ASA could be combined with conventional chemotherapy drugs or newer therapies targeted at similar pathways. This would require assessment in preclinical models of ALL. Acknowledgments The authors would like to thank Dr. Kumar Subramanian for assistance with the electromobility shift assay experiments and Dr. Karen Byth for assistance with statistical analysis. This work was supported by the National Health and Medical Research Council (NHMRC) (512431). N.K. was supported by scholarships from NHMRC, the Hawkesbury Canoe Classic and Cancer Institute NSW. L.B. was supported by an NHMRC CDA2. The work was funded by NHMRC grant no. 512431. L.J.B. was the principal investigator. N.I.K., A.C., R.B., and L.J.B. undertook the experimental work. L.J.B., N.I.K., and K.F.B. wrote the manuscript.
Conflict of interest disclosure No financial interest/relationships with financial interest relating to the topic of this article have been declared.
References 1. Nguyen K, Devidas M, Cheng S, et al. Factors influencing survival after relapse from acute lymphoblastic leukemia: a Children’s Oncology Group study. Leukemia. 2008;22:2142–2150.
N.I. Khan et al./ Experimental Hematology 2012;40:207–215 2. Tavernier E, Boiron J, Huguet F, et al. Outcome of treatment after first relapse in adults with acute lymphoblastic leukemia initially treated by the LALA-94 trial. Leukemia. 2007;21:1907–1914. 3. del Soldato P, Sorrentino R, Pinto A. NO-aspirins: a class of new antiinflammatory and antithrombotic agents. Trends Pharmacol Sci. 1999; 20:319–323. 4. Williams J, Borgo S, Hasan I, Castillo E, Traganos F, Rigas B. Nitric oxide-releasing nonsteroidal anti-inflammatory drugs (NSAIDs) alter the kinetics of human colon cancer cell lines more effectively than traditional NSAIDs: implications for colon cancer chemoprevention. Cancer Res. 2001;61:3285–3289. 5. Williams J, Nath N, Chen J, et al. Growth inhibition of human colon cancer cells by nitric oxide (NO)-donating aspirin is associated with cyclooxygenase-2 induction and beta-catenin/T-cell factor signaling, nuclear factor-kappaB, and NO synthase 2 inhibition: implications for chemoprevention. Cancer Res. 2003;63:7613–7618. 6. Khan NI, Bradstock KF, Bendall LJ. Activation of Wnt/beta-catenin pathway mediates growth and survival in B-cell progenitor acute lymphoblastic leukaemia. Br J Haematol. 2007;138:338–348. 7. Nygren M, Døsen G, Hystad M, Stubberud H, Funderud S, Rian E. Wnt3A activates canonical Wnt signalling in acute lymphoblastic leukaemia (ALL) cells and inhibits the proliferation of B-ALL cell lines. Br J Haematol. 2007;136:400–413. 8. Kordes U, Krappmann D, Heissmeyer V, Ludwig W, Scheidereit C. Transcription factor NF-kappaB is constitutively activated in acute lymphoblastic leukemia cells. Leukemia. 2000;14:399–402. 9. Miller A, Webb M, Copik A, et al. p38 Mitogen-activated protein kinase (MAPK) is a key mediator in glucocorticoid-induced apoptosis of lymphoid cells: correlation between p38 MAPK activation and sitespecific phosphorylation of the human glucocorticoid receptor at serine 211. Mol Endocrinol. 2005;19:1569–1583. 10. McGee M, Greene L, Ledwidge S, et al. Selective induction of apoptosis by the pyrrolo-1,5-benzoxazepine 7-[[dimethylcarbamoyl] oxy]-6-(2-naphthyl)pyrrolo-[2,1-d] (1,5)-benzoxazepine (PBOX-6) in Leukemia cells occurs via the c-Jun NH2-terminal kinase-dependent phosphorylation and inactivation of Bcl-2 and Bcl-XL. J Pharmacol Exp Ther. 2004;310:1084–1895. 11. Crazzolara R, Cisterne A, Thien M, et al. Potentiating effects of RAD001 (Everolimus) on vincristine therapy in childhood acute lymphoblastic leukemia. Blood. 2009;113:3297–3306. 12. Webb C, Bedwell C, Guth A, Avery P, Dow S. Use of flow cytometry and monochlorobimane to quantitate intracellular glutathione concentrations in feline leukocytes. Vet Immunol Immunopathol. 2006;112:129–140. 13. Khan NI, Cisterne A, Devidas M, et al. Expression of CD44, but not CD44v6, predicts relapse in children with B cell progenitor acute lymphoblastic leukemia lacking adverse or favorable genetics. Leuk Lymphoma. 2008;49:710–718. 14. Bendall LJ, Baraz R, Juarez J, Shen W, Bradstock KF. Defective p38 mitogen-activated protein kinase signaling impairs chemotaxic but not proliferative responses to stromal-derived factor-1alpha in acute lymphoblastic leukemia. Cancer Res. 2005;65:3290–3298. 15. Gao J, Liu X, Rigas B. Nitric oxide-donating aspirin induces apoptosis in human colon cancer cells through induction of oxidative stress. Proc Natl Acad Sci U S A. 2005;102:17207–17212. 16. Razavi R, Gehrke I, Gandhirajan RK, Poll-Wolbeck SJ, Hallek M, Kreuzer KA. Nitric oxide-donating acetylsalicylic acid induces apoptosis in chronic lymphocytic leukemia cells and shows strong antitumor efficacy in vivo. Clin Cancer Res. 2011;17:286–293.
215
17. Kamata H, Honda S, Maeda S, Chang L, Hirata H, Karin M. Reactive oxygen species promote TNFalpha-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell. 2005;120: 649–661. 18. Hundley T, Rigas B. Nitric oxide-donating aspirin inhibits colon cancer cell growth via mitogen-activated protein kinase activation. J Pharmacol Exp Ther. 2006;316:25–34. 19. Nath N, Kashfi K, Chen J, Rigas B. Nitric oxide-donating aspirin inhibits beta-catenin/T cell factor (TCF) signaling in SW480 colon cancer cells by disrupting the nuclear beta-catenin-TCF association. Proc Natl Acad Sci U S A. 2003;100:12584–12589. 20. Braun T, Carvalho G, Fabre C, Grosjean J, Fenaux P, Kroemer G. Targeting NF-kappaB in hematologic malignancies. Cell Death Differ. 2006;13:748–758. 21. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J. 1991;10:2247–2258. 22. Sahai E, Olson M, Marshall C. Cross-talk between Ras and Rho signalling pathways in transformation favours proliferation and increased motility. EMBO J. 2001;20:755–766. 23. Rodriguez P, Sahay S, Olabisi O, Whitehead I. ROCK I-mediated activation of NF-kappaB by RhoB. Cell Signal. 2007;19:2361–2369. 24. Anwar KN, Fazal F, Malik AB, Rahman A. RhoA/Rho-associated kinase pathway selectively regulates thrombin-induced intercellular adhesion molecule-1 expression in endothelial cells via activation of I kappa B kinase beta and phosphorylation of RelA/p65. J Immunol. 2004;173:6965–6972. 25. Ginn-Pease M, Whisler R. Optimal NF kappa B mediated transcriptional responses in Jurkat T cells exposed to oxidative stress are dependent on intracellular glutathione and costimulatory signals. Biochem Biophys Res Commun. 1996;226:695–702. 26. Meng X, Martinez MA, Raymond-Stintz MA, Winter SS, Wilson BS. IKK inhibitor bay 11-7082 induces necroptotic cell death in precursorB acute lymphoblastic leukaemic blasts. Br J Haematol. 2010;148: 487–490. 27. Nath N, Labaze G, Rigas B, Kashfi K. NO-donating aspirin inhibits the growth of leukemic Jurkat cells and modulates beta-catenin expression. Biochem Biophys Res Commun. 2005;326:93–99. 28. Rigas B, Williams J. NO-donating NSAIDs and cancer: an overview with a note on whether NO is required for their action. Nitric Oxide. 2008;19:199–204. 29. McCubrey J, Lahair M, Franklin R. Reactive oxygen species-induced activation of the MAP kinase signaling pathways. Antioxid Redox Signal. 2006;8:1775–1789. 30. Tikoo K, Lau S, Monks T. Histone H3 phosphorylation is coupled to poly-(ADP-ribosylation) during reactive oxygen species-induced cell death in renal proximal tubular epithelial cells. Mol Pharmacol. 2001;60:394–402. 31. Munzert G, Kirchner D, Ottmann O, Bergmann L, Schmid R. Constitutive NF-kappab/Rel activation in philadelphia chromosome positive (Phþ) acute lymphoblastic leukemia (ALL). Leuk Lymphoma. 2004; 45:1181–1184. 32. Matsumaru K, Ji C, Kaplowitz N. Mechanisms for sensitization to TNF-induced apoptosis by acute glutathione depletion in murine hepatocytes. Hepatology. 2003;37:1425–1434. 33. Williams J, Ji P, Ouyang N, Liu X, Rigas B. NO-donating aspirin inhibits the activation of NF-kappaB in human cancer cell lines and Min mice. Carcinogenesis. 2008;29:390–397.
215.e1
N.I. Khan et al./ Experimental Hematology 2012;40:207–215
Supplementary Figure E1. Wnt target genes are not altered after exposure to para-NO-ASA. NALM6 cells were treated with 10 mM para-NO-ASA for 12 hours, after which total RNA was prepared and reverse-transcribed into complementary DNA. Gene expression is normalized to dimethyl sulfoxidetreated (control) cells. Error bars indicate the standard deviation from quadruplicate assessments. mRNA 5 messenger RNA.
