Mol Biol Rep (2011) 38:4181–4184 DOI 10.1007/s11033-010-0538-8
Paraoxonase 1 192 and 55 polymorphisms in osteosarcoma Arzu Ergen • Onder Kılıcoglu • Harzem Ozger Bedia Agachan • Turgay Isbir
•
Received: 30 March 2010 / Accepted: 16 November 2010 / Published online: 23 November 2010 Ó Springer Science+Business Media B.V. 2010
Abstract Paraoxonase is an HDL-associated enzyme that plays a preventive role against oxidative stres. Previous studies suggested that involved an amino acid substitution at position 192 gives rise to two alloenzymes with a low activity (Q allele) and a high activity (R allele) towards paraoxon. There also exists a second polymorphism of the human PON1 gene affecting amino acid 55, giving rise to a leucine (L-allele) substitution for methionine (M-allele). PON1 gene polymorphisms were studied in 50 patients with osteosarcoma and 50 healthy controls. Paraoxonase genotypes were determined by PCR–RFLP. We found a reduction in the frequency of PON1 192 R allele in patients (P = 0.015). Besides, PON1 192 wild type QQ genotype (P = 0.015) and PON1 55 wild type L allele (P = 0.001) were higher in patients compared to healthy controls. PON1 192 QQ genotype was associated with osteosarcoma in multivariate logistic regression analysis. Our findings have suggested that PON1 192 wild type genotypes may be associated with a risk of developing osteosarcoma. Keywords Paraoxonase Osteosarcoma Risk Polymorphism
A. Ergen (&) B. Agachan Department of Molecular Medicine, Institute of Experimental Medicine, Istanbul University, 34390 Capa, Istanbul, Turkey e-mail:
[email protected] O. Kılıcoglu H. Ozger Department of Orthopaedics and Traumatology, Istanbul Faculty of Medicine, Istanbul University, Istanbul, Turkey T. Isbir Department of Medical Biology, Yeditepe University, Istanbul, Turkey
Introduction Carcinogenesis is associated with DNA damage and oxidative stress. Elevated oxidative stress has been found to mediate carcinogenesis by damaging biological molecules, including DNA [1, 2]. Human serum paraoxonase (PON1) is a polymorphic enzyme that catalyzes the organophosphate pesticides and nerve gases [3]. Besides, PON1 appears to contribute to the lipoprotein-mediated prevention of low density lipoprotein oxidation suggesting that it plays a role in the antiinflammatory effect of HDLs [4]. Therefore, serum paraoxonase has a protective effect against chronic exposure to these toxic environmental chemicals and the destruction of carcinogenic lipid–soluble radicals from lipid peroxidation [5]. Paraoxonase (PON1) is a member of a family of proteins that including PON2 and PON3, the genes of which are clustered on the long arm of human chromosome 7 (q21.22). Two polymorphisms are present in the PON1 coding sequence: a Gln (Q)/Arg (R) substitution at position 192 (rs662), and a Leu (L)/Met (M) substitution at position 55 [6, 7]. The Q/R polymorphism at position 192 significantly affects the catalytic efficiency of PON1. The L/M polymorphism at position 55 (rs854560) does not affect catalytic activity while PON1 55 M allele has been associated with low plasma PON1 levels. Several studies have focused on PON1 activities and genotypes in various diseases. For example, PON1 has been identified as an independent risk factor for atherosclerosis [8]. Serum PON1 activity was found to be significantly lower in gastric [9], pancreatic [10] and lung cancer [11] patients when compared with healthy controls. Also, A relation of the PON1 genotypes with the risk of breast [12, 13] prostate [14] and lung cancers [15], non-Hodgkin’s lymphoma [16]
123
4182
Mol Biol Rep (2011) 38:4181–4184
and multiple myeloma [17] has been shown. In this study, we examined the PON1 192 and PON1 55 genotypes in relation to the risk of developing osteosarcoma in Turkey.
(37°C, overnight) and the digested products were separated and identified as above. Allele L (leucine) did not contain the Hsp192II site, whereas M (methionine) contained the Hsp192II site giving rise to 126 and 44 bp products.
Materials and methods
Statistical evaluation
Patients
Statistical analyses, using the SPSS version 10.0, included the v2 test for genotype and allele frequency comparison. Differences in the distribution of PON1 192 PON 1 55 genotypes or alleles between cases and controls were tested using the v2 test, respectively. Fisher exact test was used if the number in any cell of the 2 9 2 contingency table was \5. Relative risk at 95% confidence intervals (CI) was calculated as the odds ratio (OR). Comparisons of haplotype frequencies between the patient and control groups were carried out using Haploview program [19]. Multivariate logistic regression analysis (Forward:LR) was performed in which study groups (patient vs. control) were taken as the dependent variable, genotypes and haplotypes were entered as independent variables. Values of P \ 0.05 were considered statistically significant.
The study group consisted of 50 patients (25 female and 25 male) with a diagnosis of osteosarcoma (mean age: 24.67 ± 10.02). The diagnoses were established with histological examination in all cases. The control group consisted of 50 healthy individuals (mean age: 27.91 ± 6.01; 27 female and 23 male) with a negative family history of neoplasia. All the sarcoma patients and control subjects were Caucasians to ensure homogeneity of ethnic background and to reduce genetic variability. They had an average socioeconomically status, and were referred to Istanbul University, Istanbul Faculty of Medicine, Department of Orthopaedics and Traumatology. The diagnosis of sarcoma was confirmed by clinical and laboratory examinations. Informed consent was taken from all groups. Six of the patients had lung metastases (12%).
Results PON1 192 and PON1 55 genotyping DNA was extracted from the leukocyte pellets by sodium dodecyl sulphate lysis, ammonium acetate extraction and ethanol precipitation [18]. Paraoxonase genotypes were determined following PCR protocols [6, 7]. For the 192 polymorphism sense primer 50 TATTGTTGCTGTGGGACCTGAG30 and antisense primer 50 CACGCTAAACCCAAATACATCTC30 which encompass the 192 polymorphic region of the human PON1 gene were used. For the 55 polymorphism sense primer 50 GAAGAGTGATGTATAGCCCCAG30 and antisense primer 50 TTTAATCCAGAGCTAATGAAAGCC30 were used. For the polymerase chain reaction (PCR), 25 ll total PCR mixtures were prepared: 100–200 ng DNA, 0.5 ll of each primers, 0.2 mM dNTP, 1.5 mM MgCl2 and 1.0 U Taq DNA polymerase. The PCR reactions began with 5 min 95°C denaturation followed by then 35 cycles of 1 min 95°C denaturation, 1 min 60°C annealing and 1 min 72°C elongation steps. PCR products were incubated with restriction endonuclease enzyme Alw1 (BspI) and agarose gel electrophoresis was performed. The A allele was previously determined to be 99 bp, and B allele as having two separated bands of 33 and 66 bp. For the PON1 55 polymorphism, PCR reaction and cycling was the same as above. The PCR product (170 bp) was digested with Hsp192II (Promega, USA) in the presence of BSA (0.1 lg/ll final concentration)
123
The mean age and sex distribution were similar in both groups. Distribution of PON1 192 and 55 genotypes in the study groups is shown in Table 1. There were statistically significant differences in PON1 192 (P = 0.04), But we did not observed any difference in PON1 55 (P = 0.181) between the controls and patients. There was a marked reduction in the frequency of PON1 192 R allele in patients (P = 0.015, v 5.911, OR 2.739, 95% Cl 1.20–6.23). Besides, PON1 192 wild type QQ genotype (P = 0.015, v Table 1 Genotype distribution of PON1 192 and PON1 55 gene polymorphisms in study groups PON 192 genotypes and alleles (n/%) Groups
QQ
RR
QR
Q
R
Patients 27 (54,0%)** 2 (4,0%) 21 (42,0%) 75 (75%) 25 (25%)* Controls 15 (30,0%)
2 (4,0%) 33 (66,0%) 63 (63%) 37 (37%)
PON 55 genotypes and alleles (n/%) Groups
LL
MM
Patients
24 (48%) 3 (6%)
LM
L
23 (46%) 71 (71%)*** 29 (29%)
Controls 21 (42%) 9 (18%) 20 (40%) 62 (62%) * ** ***
M
P = 0.015, v 5.911, OR 2.739, 95% Cl 1.20–6.23 P = 0.015, v 5.911, OR 0.365, 95% Cl 0.161–0.83 P = 0.001, v 10.981, OR 0.136, 95% Cl 0.037–0.50
38 (38%)
Mol Biol Rep (2011) 38:4181–4184
4183
Table 2 The frequencies of haplotypes of PON192/55 gene in patients and control subjects Number of haplotype
Haplotype associations
Frequency Overall
All patients
Control
v2
P value
0.0237
1
PON192Q:PON55 L
0.461
0.541
0.382
5.119
2
PON192Q:PON55 M
0.229
0.209
0.248
0.442
0.5061
3
PON192R:PON55 L
0.204
0.169
0.238
1.489
0.2224
4
PON192R:PON55 M
0.106
0.081
0.132
1.343
0.2465
Table 3 The results of multivariate logistic regression Sig.
Step 1
a
a
QQ (1)
0.044
Exp (B)
0.409
95% CI for EXP (B) Lower
Upper
0.171
0.977
L (1)
0.208
0.140
0.007
2,990
QL (1)
0.962
1,071
0.063
18,226
Variable (s) entered on step 1: PON 1 192 QQ
5.911, OR 0.365, 95% Cl 0.161–0.83) and PON1 55 wild type L allele (P = 0.001, v 10.981, OR 0.136, 95% Cl 0.037–0.50) were higher in patients compared to healthy controls. Patient group was in Hardy–Weinberg equilibrium for both of PON 1 192 and 55 genotypes (P = 0.39 and P = 0.40, respectively) but control group was not consistent with Hardy–Weinberg equilibrium for PON1 192 (P = 0.003) genotype. In addition to SNP analyses, haplotypes were evaluated for association with osteosarcoma (Table 2). Haplotype analysis confirmed the association of PON1 192/PON1 55 gene variants with bladder cancer and revealed that the frequencies of PON192Q:PON55 L haplotype was significantly different between patients and controls (P = 0.0237). While, PON1 192 Q, PON1 55 L haplotype was associated with osteosarcoma in univariate analysis, only PON1 192 QQ genotype was associated with this disease in multivariate logistic regression analysis (P = 0.044) (Table 3).
Discussion Oxidative stress and free radicals have been associated with an increased risk in various types of cancers [20, 21]. Paraoxonase conjugates the intermediates to excretable hydrophilic derivates and detoxifies of organophosphorus compounds (paraoxon) and carcinogenic lipid–soluble radicals from lipid peroxidation [5, 6]. The current study reports for the first time that PON1 polymorphisms are risk factors of in the development of
osteosarcoma.We observed that PON1 192 QQ genotype is a significant risk factor for osteosarcoma. Also, there was a marked reduction in the frequency of PON1 192 R allele in patients. Also, PON1 192 wild type QQ genotype and PON1 55 wild type L allele were higher in patients compared to healthy controls. As a similar result, Antognelli et al., found that PON192/QQ was associated with a significant increased risk for prostate cancer comparing with PON192/RR genotype [14]. In another study Lee et al., have shown that carriers of the PON1 192 QQ genotype have increased risk of lung cancer [15]. It was suggested in previous studies, that the Q to R substitution lead to the production of the enzyme against carcinogenic products of oxidative stress [14, 22]. This theory is confirmed by some previous studies showing that either individuals had a higher PON1 activity or had a higher frequency of R and L alleles [22, 23]. In contrast to our findings, Stevens et al., suggested that PON1 L55 M allele, might be associated with increased risk of breast cancer in postmenopausal women [24]. Rajaraman et al., did not find any relationship between brain tumours and PON1 genotypes [25]. In another study women carrying the PON1 55 L allele, compared with women with the AA genotype, showed an increased risk of ovarian epithelial carcinoma [26]. Our findings suggest that patients with the PON1 192 QQ genotype may have increased risk for developing osteosarcoma. However, this is the first study of PON1 in osteosarcoma with larger number of subjects, should be necessary.
References 1. Cejas P, Casado E, Belda-Iniesta C, De Castro J, Espinosa E, Redondo A, Sereno M, Garcı´a-Cabezas MA, Vara JA, Domı´nguez-Ca´ceres A, Perona R, Gonza´lez-Baro´n M (2004) Implications of oxidative stress and cell membrane lipid peroxidation in human cancer (Spain). Cancer Causes Control 15:707–719 2. Behrend L, Henderson G, Zwacka RM (2003) Reactive oxygen species in oncogenic transformation. Biochem Soc Trans 31: 1441–1444 3. Costa LG, Cole TB, Jarvik GP, Furlong CE (2003) Functional genomics of the paraoxonase (PON1) polymorphisms: effects on
123
4184
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
pesticide sensitivity, cardiovascular disease and drug metabolism. Annu Rev Med 54:371–392 Mackness MI, Mackness B, Durrington PN, Fogelman AM, Berliner J, Lusis AJ, Navab M, Shih D, Fonarow GC (1998) Paraoxonase and coronary heart disease. Curr Opin Lipidol 9(4): 319–324 Shih DM, Gu L, Xia YR, Navab M, Li WF, Hama S, Castellani LW, Furlong CE, Costa LG, Fogelman AM, Lusis AJ (1998) Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature 394:284–287 Humbert R, Adler DA, Disteche CM, Omiecinski CJ, Furlong CE (1993) The molecular basis of the human serum paraoxonase polymorphisms. Nat Genet 3:73–76 Adkins S, Gan KN, Mody M, LaDu BN (1993) Molecular basis for the polymorphic forms of human serum paraoxonase/arylesterase: glutamine or arginine at position 191, for the respective A or B allozymes. Am J Hum Genet 53:598–608 Ruiz J, Blanche H, James RW, Garin MC, Vaisse C, Charpentier G, Cohen N, Morabia A, Passa P, Froguel P (1995) Gln-Arg192 polymorphism of paraoxonase and coronary heart disease in type 2 diabetes. Lancet 346:869–872 Akcay MN, Yilmaz I, Polat MF, Akcay G (2003) Serum paraoxonase levels in gastric cancer. Hepatogastroenterology 50(2): cclxxiii–cclxxv Akcay MN, Polat MF, Yilmaz I, Akcay G (2003) Serum paraoxonase levels in pancreatic cancer. Hepatogastroenterology 50(2):ccxxv–ccxxvii Elkiran ET, Mar N, Aygen B, Gursu F, Karaoglu A, Koca S (2007) Serum paraoxonase and arylesterase activities in patients with lung cancer in a Turkish population. BMC Cancer 7:48 Stevens VL, Rodriguez C, Pavluck AL, Thun MJ, Calle EE (2006) Association of polymorphisms in the paraoxonase 1 gene with breast cancer incidence in the CPS-II Nutrition Cohort. Cancer Epidemiol Biomarkers Prev 15:1226–1228 Gallicchio L, McSorley MA, Newschaffer CJ, Huang HY, Thuita LW, Hoffman SC, Helzlsouer KJ (2007) Body mass, polymorphisms in obesity-related genes, and the risk of developing breast cancer among women with benign breast disease. Cancer Detect Prev 31:95–101 Antognelli C, Mearini L, Talesa VN, Giannantoni A, Mearini E (2005) Association of CYP17, GSTP1, and PON1 polymorphisms with the risk of prostate cancer. Prostate 63:240–251
123
Mol Biol Rep (2011) 38:4181–4184 15. Lee CH, Lee KY, Choe KH, Hong YC, Kim YD, Kang JW, Kim H (2005) Effects of oxidative DNA damage induced by polycyclic aromatic hydrocarbons and genetic polymorphism of the paraoxonase-1 (PON1) gene on lung cancer. J Prev Med Pub Health 38:345–350 16. Kerridge I, Lincz L, Scorgie F, Hickey D, Granter N, Spencer A (2002) Association between xenobiotic gene polymorphisms and non-Hodgkin’s lymphoma risk. Br J Haematol 118:477–481 17. Lincz LF, Kerridge I, Scorgie FE, Bailey M, Enno A, Spencer A (2004) Xenobiotic gene polymorphisms and susceptibility to multiple myeloma. Haematologica 89:628–629 18. Miller SA, Dykes DD, Polesky HS (1988) Simples salting out procedure for extracting DNA from human nucleated cells. Nucleic Acid Res 16:1215 19. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD 352 and haplotype maps. Bioinformatics 21:263–265 20. Ames BN (1983) Dietary carcinogens and anticarcinogens. Oxygen radicals and degenerative diseases. Science 221:1256–1264 21. Goldstein BD, Witz G (1990) Free radicals and carcinogenesis. Free Radic Res Commun 11:3–10 22. Ferre’ N, Camps J, Fernandez-Ballart J, Arija V, Murphy MH, Cerveco S, Biarnes E, Vilella E, Tous M, Joven J (2003) Regulation of serum paraoxonase activity by genetic, nutritional, and lifestyle factors in the general population. Clin Chem 49(9): 1491–1497 23. Mackness B, Durrington PN, Mackness MI (1998) Human serum paraoxonase. Gen Pharmacol 31(3):329–336 24. Stevens VL, Rodriguez C, Pavluck AL, Thun MJ, Calle EE (2006) Association of polymorphisms in the paraoxonase 1 gene with breast cancer incidence in the CPS-II nutrition cohort. Cancer Epidemiol Biomarkers Prev 15(6):1226–1228 25. Rajaraman P, Hutchinson A, Rothman N, Black PM, Fine HA, Loeffler JS, Selker RG, Shapiro WR, Linet MS, Inskip PD (2008) Oxidative response gene polymorphisms and risk of adult brain tumors. Neuro Oncol 10:709–715 26. Lurie G, Wilkens LR, Thompson PJ, McDuffie KE, Carney ME, Terada KY, Goodman MT (2008) Genetic polymorphisms in the paraoxonase 1 gene and risk of ovarian epithelial carcinoma. Cancer Epidemiol Biomarkers Prev 17(8):2070–2077
