Polar Biol (2011) 34:1501–1512 DOI 10.1007/s00300-011-1009-y
ORIGINAL PAPER
Phylogenetic diversity of Gram-positive bacteria cultured from Antarctic deep-sea sponges Yanjuan Xin · Manmadhan Kanagasabhapathy · Dorte Janussen · Song Xue · Wei Zhang
Received: 10 January 2011 / Revised: 25 March 2011 / Accepted: 30 March 2011 / Published online: 17 April 2011 © Springer-Verlag 2011
Abstract Gram-positive bacteria, speciWcally actinobacteria and members of the order Bacillales, are well-known producers of important secondary metabolites. Little is known about the diversity of Gram-positive bacteria associated with Antarctic deep-sea sponges. In this study, cultivationbased approaches were applied to investigate the Grampositive bacteria associated with the Antarctic sponges Rossella nuda, Rossella racovitzae (Porifera: Hexactinellida), and Myxilla mollis, Homaxinella balfourensis, Radiella antarctica (Porifera: Demospongiae). In total, 46 Grampositive strains were cultured. Phylogenetic analysis revealed that 24 strains were aYliated with the Actinobacteria, including six genera Streptomyces, Nocardiopsis, Pseudonocardia, Dietzia, Brachybacterium, and Brevibacterium. The other 22 strains were aYliated with the Firmicutes, and
among them two (V17-1 and V179-1) only shared 92–95% 16S rRNA gene sequence identity with the nearest type strain. To our knowledge, this is the Wrst report on the isolation of strains belonging to genera Dietzia and Brevibacterium from Antarctic sponges. All of the 46 strains were PCR screened for genes encoding polyketide synthases (PKS), and a selection of 36 isolates were used in subsequent bioassay analyses. Eighty-eight percentage of the isolates that possess a PKS gene were active against at least one test organism. The study conWrms the existence of diverse bacteria in Antarctic sponges and their potential for producing active compounds.
Electronic supplementary material The online version of this article (doi:10.1007/s00300-011-1009-y) contains supplementary material, which is available to authorized users.
Introduction
Y. Xin · M. Kanagasabhapathy · S. Xue · W. Zhang (&) Marine Bioproducts Engineering Group, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, 457, Zhongshan Road, Dalian 116023, China e-mail:
[email protected] Y. Xin Graduate School of the Chinese Academy of Sciences, Chinese Academy of Sciences, Beijing 100039, China W. Zhang Flinders Centre for Marine Bioprocessing and Bioproducts, and Department of Medical Biotechnology, School of Medicine, Flinders University, Adelaide, SA 5042, Australia D. Janussen Section Marine Invertebrates I, Senckenberg Research Institute and Natural Museum, 60325 Frankfurt/Main, Germany
Keywords Gram-positive bacteria · PKS · Antarctic porifera · Siliceous sponges · 16S rRNA
The Antarctic marine ecosystem is a unique, mostly pristine and extreme environment that remains largely unexplored, and the majority of microbial research eVort has focused on Antarctic sediment, sea-ice and seawater communities (Murray et al. 1998; Gordon et al. 2000; Brown and Bowman 2001; Li et al. 2006). Sponges are dominant components of the Antarctic benthos and play a key role in community dynamics (Dayton 1989; Barthel et al. 1991; Barthel and Tendal 1994; Cattaneo-Vietti et al. 1999; Cerrano et al. 2000a; Janussen and Tendal 2007). Recent estimates of species richness in the Antarctic put the total number of sponge (Porifera) species at ca. 530 (420 Demospongiae, 49 Calcarea, 61 Hexactinellida; McClintock et al. 2005; Brandt et al. 2007). Many sponge–microbe associations have been described from tropical and temperate zones, and these involve a diverse range of heterotrophic
123
1502
bacteria, cyanobacteria, facultative anaerobes, unicellular algae, and archaea (Webster and Hill 2001; Webster et al. 2001a, b; Hentschel et al. 2002). To date, few studies have investigated the microbial ecology of Antarctic or deep-sea sponges (Bavestrello et al. 2000; Cerrano et al. 2000b; Webster et al. 2004; Mangano et al. 2009). Webster et al. (2004) investigated the archaeal, bacterial, and eukaryotic communities associated with the Antarctic demosponges Kirkpatrickia varialosa, Latrunculia apicalis, Homaxinella balfourensis, Mycale acerata, and Sphaerotylus antarcticus using genetic techniques. The results revealed that the bacterial communities present in these Antarctic sponges primarily clustered within the Gamma and Alpha Proteobacteria and the Cytophaga/Flavobacterium of the Bacteroidetes group (Webster et al. 2004). Mangano et al. (2009) studied antagonistic interactions existing among cultivable bacteria associated with the Antarctic sponges Anoxycalyx joubini and Lissodendoryx nobilis. Gram-positive bacteria, speciWcally actinobacteria and members of the order Bacillales, are well-known producers of important secondary metabolites (Goodfellow et al. 1983; Priest 1989). This group of bacteria has recently been detected as substantial components of bacterial communities in marine environments, and some of them fall into distinct “marine” clusters (Mincer et al. 2002; Gontang et al. 2007; Stevens et al. 2007). In this study, we assessed the diversity of a Gram-positive bacterial community using cultivation-based approaches. Furthermore, the presence of polyketide synthase (PKS) genes was screened using degenerate primers to understand the capacity of these bacteria to potentially synthesize diverse, bioactive natural products.
Materials and methods Sampling area and sponge collection During two Antarctic expeditions, ANT XXII/3 (ANDEEP III, 2005) and ANT XXIII/8 (2006/07), with the RV “Polarstern” in the Weddell Sea, diverse collections of Porifera were caught by agassiz trawl (AGT; Linse et al. 2007), bottom trawl (BT), or epibenthic sledge (EBS; Janussen and Tendal 2007). Detailed information on sponge sampling at the diVerent stations of these expeditions is given by Janussen (2006, 2008). Specimens of the hexactinellid sponges Rossella nuda Topsent, 1901 (V132, depth c. 350 m, SMF 10698), Rossella racovitzae Topsent, 1901 (V179, depth c. 170 m, SMF 10699), and the demosponges Myxilla mollis Ridley and Dendy, 1889 (V17a, depth c. 1040 m), Radiella antarctica (Plotkin and Janussen, 2008; V103a, depth c. 4,790 m, SMF 10563), and Homaxinella balfourensis (V52,
123
Polar Biol (2011) 34:1501–1512
depth c. 150 m, SMF 10697) were collected at diVerent localities of the Weddell Sea, Antarctica, from depths between 150 and 4,790 m. Immediately upon collection, samples of the sponges were excised with sterile scalpels and frozen separately in sterile plastic bags at ¡20°C. The samples were kept at this temperature during their transfer to the DICP in Dalian, China. Remaining sponge samples were deposited at the Forschungs institute and Natural Museum Senckenberg, Frankfurt am Main, Germany (inventory SMF-numbers given above). Media and isolation of bacteria For bacterial isolation, ten diVerent types of media were selected from the literature for the cultivation of spongeassociated bacteria. HVA medium consisted of 0.5 g humic acid, 0.5 g MgSO4, 1.7 g KCl, 0.02 g CaCl2, 0.5 g Na2HPO4, 18 g agar, 20 g NaCl, and 1 l of distilled water (Hayakawa and Nonomura 1987). HVG medium, which was based on HVA, contained of 0.5 g humic acid, 0.5 g MgSO4, 1.7 g KCl, 0.02 g CaCl2, 0.5 g Na2HPO4, 18 g gellan gum, 20 g NaCl, and 1 l of distilled water (Suzuki et al. 1998). RaYnose–histidine agar (RH) consisted of 5 g of raYnose, 1 g of L-histidine, 0.5 g of MgSO4, 0.01 g of FeSO4, 20 g of NaCl, and 1 l of distilled water (Webster et al. 2001a). TSA medium consisted of 1.5 g peptone, 0.25 g tryptone, 0.5 g glucose, 1.25 g K2HPO4, 2 ml composite vitamin (0.5 mg/ml), 20 g NaCl, 18 g agar, and 1 l of distilled water (Governal et al. 1991). M11 medium consisted of 18 g agar and 1 l of natural seawater (Mincer et al. 2002). BHI medium consisted of 22 g brain–heart infusion, 18 g agar, and 1 l of natural seawater (Schaal 1977). M1 medium consisted of 10 g soluble starch, 4 g yeast extract, 2 g peptone, 18 g agar, and 1 l of natural seawater (Mincer et al. 2002). M2 medium consisted of 6 ml 100% glycerol, 1 g arginine, 1 g K2HPO4, 0.5 g MgSO4, 18 g agar, and 1 l of natural seawater (Mincer et al. 2002). M8 medium consisted of 4 g yeast extract, 15 g soluble starch, 1 g K2HPO4, 0.5 g MgSO4, 20 g NaCl, 18 g agar, and 1 l of water (Webster et al. 2001a). Difco marine agar 2216 medium was also used. For isolating actinobacteria, the media were supplemented with a Wnal concentration of 10 g/ml cycloheximide and 25 g/ml nystatin to limit fungal growth, and 10 g/ml nalidixic acid to inhibit growth of Gram-negative bacteria (Montalvo et al. 2005). All media contained Difco agar or gellan gum (18 g l¡1) at pH 7.0. To isolate sponge-associated bacteria, the exposed surface tissues of individual specimens were removed with a sterile scalpel blade, the inner tissue were rinsed three times in autoclaved artiWcial seawater to remove transient and loosely attached bacteria. The washed inner tissue were then cut into pieces measuring ca. 1 cm3 under sterile condition and thoroughly homogenized in a sterile mortar with
Polar Biol (2011) 34:1501–1512
1503
10 volumes of sterile seawater (Hentschel et al. 2002). A 10-fold dilution series was made and plated in triplicate on agar plates. The inoculated plates were incubated at 28°C for 2–4 weeks. Strain culture and DNA extraction All actinobacterial isolates were inoculated onto freshly prepared agar media (the medium on which colonies were initially isolated), and the inoculated plates were incubated for 2–4 weeks at 28°C. All actinobacterial isolates were also cultured on agar media (the medium on which colonies were initially isolated), either prepared with 80% seawater or fresh water in order to determine whether seawater inXuenced bacterial growth. Strains that grew on the medium prepared with seawater but not on the medium prepared with distilled water were considered as strains requiring seawater for growth. For DNA extraction, the strains were cultured in trypticase soy broth (TSB) for 4 days, and the total genomic DNA was extracted from each strain as described (Lee et al. 2003). Oligonucleotide primers and PCR ampliWcation The oligonucleotide primers (Table 1) used in this study was synthesized by TaKaRa (China). Nearly full-length 16S rRNA gene sequences were ampliWed from genomic DNA by polymerase chain reaction (PCR) using primers F8 (Weisburg et al. 1991) and R1492 (Reysenbach et al. 1992). The PCR mixture consisted of 25 l of 2 £ G + C buVer (5 mM Mg2+), 8 l of dNTP mixture (2.5 M each), 1 l of each primer (20 M), 1 l of template DNA, and 0.5 l of LA Taq DNA polymerase (5 U/l) (TaKaRa, China) in a Wnal volume of 50 l. PCR was performed in a thermal cycler (Biometra, Germany) using an initial denaturation at 95°C for 5 min, followed by 30 cycles at 94°C for 1 min, 55°C for 1 min, 72°C for 2 min, and a Wnal extension at 72°C for 7 min (Lee et al. 2003). For PKS genes, the PCR mixture consisted of 25 l of 2 £ G + C buVer (5 mM Mg2+), 8 l of dNTP mixture (2.5 M each),
1 l LA Taq DNA polymerase (5 U/l) (TaKaRa, China), 1 l forward primer (10 M), 1 l reverse primer (10 M), 1 l of template DNA, and 5% DMSO in a Wnal volume of 50 l. After denaturation at 95°C for 1 min, ampliWcation was performed with 30 cycles of 35 s at 94°C, 40 s at 55°C, 2 min at 72°C for PKS-I, and 1 min at 72°C for PKS-II, followed by a Wnal extension at 72°C for 8 min (Metsä-Ketelä et al. 1999; Ayuso-Sacido and Genilloud 2005). Sequencing and phylogenetic analysis The PCR products of all bacterial strains were puriWed using the Agarose Gel DNA Fragment Recovery Kit (TaKaRa Biotech. Co., Ltd., China). The puriWed PCR products were ligated into PMD18-T Vector, transformed into CaCl2-competent Escherichia coli JM109, and sequenced by TaKaRa Biotech. Co., Ltd., China. The sequences were edited using PHYDIT (Chun 1995), and an NCBI BLAST search was performed to identify the nearest neighbor to the ampliWed sequence. The partial sequences (»680 bp in length) were aligned with actinobacterial 16S rRNA gene, the data retrieved from the NCBI website to create a homology matrix using CLUSTALW (Thompson et al. 1997). The phylogenetic trees were inferred using the neighbor-joining method (Saitou and Nei 1987), and tree topologies were evaluated by bootstrap analyses based on 1,000 replications with PHYLIP (Felsenstein 1993). Bioassay screening Actinobacteria and Bacilli have been shown to protect several diVerent plants to various degrees from soil-borne fungal pathogens (Merriman et al. 1977). In order to evaluate marine bacteria for their potential use as agricultural pesticides, antimicrobial assays were performed with three test microorganisms: Erwinia carotovora 236, Xanthomonas campestris 1043, and Xanthomonas oryzae 1047 using disk diVusion assays. Fermentations of puriWed strains Wrst involved the generation of a seed culture in TSB prepared with 3% NaCl. The seed culture (7 ml) was grown with
Table 1 Oligonucleotide primers used in this study Primer name
Sequences (5⬘–3⬘)
Target genes
Length of the target gene fragments (bp)
F8 R1492
GAGAGTTTGATCCTGGCTCAG
16S rRNA
1,300–1,450
CGGCTACCTTGTTACGAC
16S rRNA
K1F
TSAAGTCSAACATCGGBCA
PKS-I
M6R
CGCAGGTTSCSGTACCAGTA
PKS-I
IIPF6
TSGCSTGCTTCGAYGCSATC
PKS-II
IIPR6
TGGAANCCGCCGAABCCGCT
PKS-II
Reference
Weisburg et al. 1991 Reysenbach et al. 1992
1,200–1,400
Ayuso-Sacido and Genilloud 2005 Ayuso-Sacido and Genilloud 2005
600–700
Metsä-Ketelä et al. 1999 Metsä-Ketelä et al. 1999
123
1504
shaking in a 20-ml glass tube for 7 days. Following this initial growth stage, 2 ml of the seed culture was transferred to a 500-ml Erlenmeyer Xask containing either 100 ml of marine 2216 (for bacilli) or ISP-2 medium (4 g glucose, 4 g yeast extract, 10 g malt extract, 1 l water, pH 7.2) (for actinobacteria). These Xasks were incubated with shaking (220 rpm) at 30°C for 7–10 days (depending on average cell density). One hundred milliliters of culture was extracted by shaking at 200 rpm/min for 30 min in the presence of 50 ml EtOAc. The ethyl acetate fractions were concentrated by rotary evaporation at 37°C and subsequently resolved in MeOH (2 ml). The crude extracts were used for antimicrobial assays. Assay disks were prepared by adding 30 l of the methanolic solution to a paper disk and evaporating the solvent in a sterile cabinet. Overnight cultures of each test organism in TSB medium were diluted to an OD600 of 0.02–0.05 and 200 l of the resulting suspension was spread evenly on TSB agar plates. The dried disks were immediately placed onto the agar plates. The zone of inhibition was recorded after the agar plates had been incubated for 24 h at 30°C. Nucleotide sequence accession numbers 16S rRNA gene sequences reported in the paper have been deposited in the GenBank database (http://www.ncbi.nlm. nih.gov/GenBank/index.html) under the accession numbers EU554276, EU554277, EU554279, EU554311, EU554312, EU554270, and EU873247 to EU873286.
Results Selective isolation A total of 46 bacteria were cultivated from the Wve Antarctic sponge species, two Hexactinellida, and three Demospongiae. Most of the strains were recovered on HVG and RH plates (Table 2). All the isolates were Gram-positive, and none of them has an absolute requirement of seawater for their growth. BLAST searching and phylogenetic analysis The 16S rRNA genes of the 46 isolates were partially sequenced. A BLAST analysis was carried out via GenBank BLASTn search tool (http://www.ncbi.nlm.nih.gov), which revealed that 24 isolates were aYliated with the Actinobacteria (the high G + C Gram-positive bacteria), and 22 isolates were aYliated with the Firmicutes (the low G + C Gram-positive bacteria). The actinobacterial group included strains most closely related to members of six genera: Streptomyces, Nocardiop-
123
Polar Biol (2011) 34:1501–1512
sis, Pseudonocardia, Dietzia, Brachybacterium, and Brevibacterium. The dominant actinobacteria were members of genus Streptomyces, which were broadly distributed in four out of Wve Antarctic sponges (Fig. 1). Cultivable rare actinobacteria from our Antarctic sponges and strains from diVerent demosponges from other oceans (Rhabdastrella globostellata, Pseudoceratina clavata, Suberites zeteki, Aplysina aerophoba, Rhopaloeides odorabile, Hymeniacidon sinapium, Stelletta tenuis, Sponge sp., Iotrochota sp., and Haliclona sp.) (Suberites zeteki: revised Suberites aurantiacus) formed six groups (Fig. 2). Isolates V132-7 and V179-8 were closely aYliated with a salt-tolerant strain Brevibacterium sp. SC9 and formed an independent cluster within Group I. Isolates V17-16 and V17-17 were closely aYliated with Nocardiopsis dassonvillei and formed Group II along with other actinobacteria from sponges. The genus Nocardiopsis was shown to be phylogenetically coherent and to represent a distinct lineage within the radiation of the order Actinomycetales. Isolates (V179-7, V132-6) from the two closely related hexactinellid sponges, Rossella racovitzae and R. nuda were closely related to the previously described cold-adapted bacteria Dietzia sp. ice-oil-79 from Antarctic sea-ice at low temperatures, and formed Group III along with other actinobacteria from demosponges. Isolates V17-15 and V52-7 were closely aYliated with Pseudonocardia antarctica type strain (AJ 576010) from the marine environment, and clustered into Group IV along with other marine sponge actinobacteria. Isolates of the Firmicutes were further clustered into three subgroups: Bacillus (n = 13), Virgibacillus (n = 3), and uncultured bacterial clones (n = 6, Fig. 1). The phylogenetic analysis revealed that strains V179-1 and V17-1 were most closely related to the type strains of Paraliobacillus ryukyuensis strain 015-7 (NR_028642) and Sporosarcina globispora strain 785 (NR_029233) with 92 and 95% similarity, respectively, and may be new species. Further classiWcation and characterization of these strains are currently underway. Strains V52-4 and V52-5 were closely related to uncultured Staphylococcus sp. clone 607 with 100% similarity. Strains V52-2 and V17-2 were closely related to uncultured bacterial clone AFEL3_aaa16h10 and clone HY1_d05_1, respectively, with 100% similarity. Cultivable bacilli from Antarctic sponges and other sponges (Rhabdastrella globostellata, Pseudoceratina clavata, Suberites aurantiacus, Rhopaloeides odorabile, and Candidaspongia Xabellata) formed Wve groups (Fig. 3). Seven isolates from three demosponge species, Myxilla mollis (V17-3, V17-4, V17-5, and V17-6), Homaxinella balfourensis (V52-6), and Radiella antarctica (V103-3, V103-4), clustered together with 99% identity to each other and formed Group V along with other bacilli from the demosponge Suberites aurantiacus. Three isolates from the hexactinellid Rossella racovitzae (V179-3) and the demosponges
Polar Biol (2011) 34:1501–1512
1505
Table 2 Preliminary classiWcation of cultivable Gram-positive bacteria from the marine sponges, and the presence of PKS genes Isolate codes
The nearest type strain
GenBank acc. no
V132-4
Streptomyces krainskii strain QL077
FJ862046
V17-7
Streptomyces krainskii strain QL077
FJ862046
V179-4
HQ439905
V17-8
Streptomyces sampsonii strain S151A Streptomyces albidoXavus TBG-S13A5
FJ600729
V17-9
Streptomyces albidoXavus TBG-S13A5
V17-10
Streptomyces limosus strain P5
Identity (%)
PKSI
PKSII
Selective medium
99
+
+
HVG
100
+
¡
RH
99
¡
+
RH
98
¡
+
RH
FJ600729
99
¡
+
RH
HQ268538
99
+
¡
RH
V103-5
Streptomyces limosus strain E961
GU383214
98
+
+
BHI
V179-5
Streptomyces gougerotii NBRC13043
AB249982
99
+
+
RH
V103-6
Streptomyces gougerotii NBRC13043
AB249982
99
¡
+
HVG
V103-7
Streptomyces gougerotii NBRC13043
AB249982
99
+
+
HVG
V17-11
Streptomyces variabilis strain 174059
EU841659
99
+
+
RH
V17-12
Streptomyces pactum strain 173848
EU593609
99
+
¡
RH
V179-6
Streptomyces platensis strain 173403
EU841696
98
¡
+
HVG
V17-13
Streptomyces bacillaris NBRC13487
AB184439
99
+
+
RH
V17-14
Streptomyces bacillaris strain cfcc3101
FJ792550
99
+
+
RH
V132-5
Streptomyces anulatus strain 173826
EU570444
99
+
+
HVG
V52-7
Pseudonocardia carboxydivorans
FJ532384
99
¡
+
HVG
V17-15
Pseudonocardia carboxydivorans
FJ532384
100
+
+
HVA
V17-16
Nocardiopsis dassonvillei strain JPL-3
AY030320
99
¡
+
M8
V17-17
Nocardiopsis dassonvillei strain JPL-3
AY030320
99
+
+
M2
V179-7
Dietzia maris strain W5047
FJ588199
99
+
+
HVG
V132-6
Dietzia natronolimnaea strain W5044
FJ588194
99
+
+
HVG HVG
V132-7
Brevibacterium iodinum strain 15728
FJ656260
98
+
+
V179-8
Brachybacterium paraconglomeratum
EU660345
98
+
¡
HVG
V17-4
Bacillus aquimaris strain G2-11
GQ927152
99
¡
+
2216E
V17-5
Bacillus aquimaris strain G2-11
GQ927152
99
+
+
2216E
V17-3
Bacillus aquimaris strain G2-11
GQ927152
99
+
+
TSA
V17-6
Bacillus aquimaris strain G2-11
GQ927152
99
+
+
2216E
V103-3
Bacillus aquimaris strain G2-11
GQ927152
99
¡
+
2216E
V103-4
Bacillus aquimaris strain G2-11
GQ927152
99
¡
+
M1
V52-6
Bacillus aquimaris strain G2-11 Bacillus Wrmus strain PAN MC15
GQ927152
99
+
¡
2216E
HQ285922
99
+
+
2216E
V132-3 V132-2
Bacillus jeotgali strain YKJ-10
NR_025060
99
¡
+
M8
V103-2
Bacillus pumilus strain MB7
HQ858063
99
+
+
2216E
V179-3
Bacillus thuringinesis strain JAM-GG01
AB553285
98
+
+
2216E
V103-1
Bacillus thuringinesis strain JAM-GG01
AB553285
99
+
+
2216E
V52-3
Bacillus cereus strain 5YW6
GU991861
99
+
+
M1
V52-4
Staphylococcus caprae strain 35538
NR_024665
99
¡
+
2216E
V52-5
Staphylococcus epidermidis 12228
AE015929
99
¡
+
M11
V17-1
Sporosarcina globispora strain 785
NR_029233
95
+
+
2216E
V17-2
Bacillus psychrodurans strain 24934
EF101552
98
+
+
2216E
V179-1
Paraliobacillus ryukyuensis strain 015-7
NR_028642
92
+
+
2216E
V52-2
Terribacillus saccharophilus strain 589
AB243847
99
+
+
2216E
V179-2
Virgibacillus dokdonensis strain R548
HM179224
98
+
+
TSA
V132-1
Virgibacillus dokdonensis strain R548
HM179224
99
¡
+
M2
V52-1
Virgibacillus picturae strain GSP52
AY505535
99
+
+
2216E
123
1506
Polar Biol (2011) 34:1501–1512
Fig. 1 Phylogenetic relationships determined from the 16S rRNA gene sequences of Grampositive bacteria isolated from Antarctic sponges Myxilla mollis (V17), Rossella nuda (V132), Rossella racovitzae (V179), Radiella antarctica (V103) and Homaxinella balfourensis (V52). The isolates sequenced as a part of this study are labeled (Arial black) with the sponge number, isolate number, and NCBI accession number. Bootstrap values calculated from 1,000 resampling using neighbor-joining are shown at the respective nodes when the calculated values were 50% or greater. BiWdobacterium biWdum (S83624) was used as an out group
Radiella antarctica (V103-1) and Homaxinella balfourensis (V52-3) clustered together with 98% identity to each other and formed Group II along with other bacilli from the demosponge Suberites aurantiacus. Detection, distribution, and analysis of PKS-I and PKS-II In order to provide evidence of potential chemical diversity among these bacteria in terms of natural product drug discovery, two sets of degenerate primers targeting genes encoding polyketide synthases (PKS-I and PKS-II) were used to screen the biosynthetic potential of the 46 isolates.
123
PKS-I and PKS-II PCR products were detected in 70 and 85% of the isolates, respectively (Table 2). The PCR amplicons of PKS were further conWrmed by cloning and sequencing, and partial sequences have been submitted to Genbank (Accession number EU873246, FJ042498FJ042501). Bioassay screening Altogether, 88% of the culture extracts (32 out of 36) showed an activity against at least one of the test organisms (Supplementary Material).
Polar Biol (2011) 34:1501–1512
1507
Fig. 2 Neighbor-joining phylogenetic tree from the analysis of 16S rRNA gene sequences of cultivable rare actinobacterial isolates associated with Antarctic sponges. Cultivable rare actinobacterial strains presented here from other sponges are from several references (Hentschel et al. 2001; Webster et al. 2001a; Kim et al. 2005; LaW et al. 2005; Jiang et al. 2007, 2008; Zhang et al. 2008; Zhu et al. 2008). Cultivable rare actinobacterial isolates are labeled (bold) by using the sponge name and isolate number followed by the NCBI accession number. Numbers above branches indicate bootstrap values of neighbor- joining analysis (>50%) from 1,000 replicates. Actinobacterial isolates sequenced as a part of this study are labeled (Arial black) with the sponge name, isolate number and NCBI accession number
Discussion In recent years, marine sponges have attracted signiWcant interest, primarily for two reasons: (1) they form close associations with a wide variety of microorganisms, and (2) they are a rich source of biologically active secondary metabolites (Taylor et al. 2007). Studies using 16S rRNA community analysis have shown that marine sponges contain remarkably diverse microbial communities. These include many novel bacteria found so far only within sponges (Hentschel et al. 2002; Montalvo et al. 2005). The present study employed culture-dependent methods to assess the diversity of Gram-
positive bacteria within the sponges collected at deep-sea stations in the Antarctic Weddell Sea. In total, 46 Gram-positive strains were cultured, of which two (V179-1 and V17-1) are considered to be new species based on the sharing of 92 and 95% 16S rRNA gene sequence identity with the previously published type strains. Strains V17-1 and V17-2 may be new taxon together with other sponges derived uncultured bacterial clones sequences (Fig. 3, Group III). So far, no closely related cultivable bacteria have been found based on 16S rRNA BLAST searches in GenBank. A previous study has revealed that homologous sequences of uncultivable
123
1508
Polar Biol (2011) 34:1501–1512
Fig. 3 Neighbor-joining phylogenetic tree from analysis of 16S rRNA gene sequences of cultivable Bacillus isolates associated with Antarctic sponges. Cultivable Bacillus strains from other sponges are from several references (Burja and Hill 2001; Webster et al. 2001a; LaW et al. 2005; Zhu et al. 2008). Cultivable Bacillus isolates are labeled (bold) by using the sponge name and isolate number followed by the NCBI accession number. Numbers above branches indicate bootstrap values of neighbor- joining analysis (>50%) from 1,000 replicates. Bacillus isolates sequenced as a part of this study are labeled (Arial black) with the sponge name, sponge number, isolate number, and NCBI accession number
bacteria do exist in diVerent sponge species (Hentschel et al. 2002) detected using culture-independent methods. A detailed study is being carried out for characterization and classiWcation of a group of isolates belonging to this new taxon. These results indicate that considerably diverse Gram-positive microbial populations can be cultured from marine siliceous sponges, including abyssal taxa such as the recently described species Radiella antarctica (Plotkin and Janussen 2008). The results also reinforce the concept that relatively simple cultivation techniques, in addition to a variety of culture media, can be used successfully to isolate many as-yet-undescribed species (Connon and Giovannoni 2002; Janssen et al. 2002; Maldonado et al. 2005; Gontang et al. 2007).
123
Actinobacteria were originally isolated from terrestrial environments and now have been frequently isolated from diverse marine environments (e.g., seawater and marine sediments). So far, the cultivable actinobacteria from marine sponges are related to genera of Actinobiospora, Arthrobacter, Brachybacteria, Gordonia, Janibacter, Knoellia, Kocuria, Microbacterium, Micrococcus, Rhodococcus, Nocardia, Streptomyces, Nocardiopsis, Micromonospora, Cellulosimicrobium, Prauseria, Pseudonocardia, Saccharomonospora, Lapillicoccus, Terrabacter, Phycicoccus, and Salinospora (Hentschel et al. 2001; Webster et al. 2001a; Kim et al. 2005; LaW et al. 2005; Montalvo et al. 2005; Zhang et al. 2006; Muscholl-Silberhorn et al. 2008; Kennedy et al. 2009; To Isaacs et al. 2009; Radwan
Polar Biol (2011) 34:1501–1512
et al. 2010; Sun et al. 2010; Tabares et al. 2011). Our study adds two more genera (Dietzia and Brevibacterium) to the above-mentioned list of cultivable actinobacteria from marine sponges. Some actinobacterial strains from Antarctic sponges displayed an association with those from other marine sponges and formed sponge-speciWc clusters (Fig. 2, Groups II and VI). Most of actinobacterial strains (89%) were isolated from raYnose-histidine agar plates, a medium designed for the isolation of rare streptomycetes (Vickers et al. 1984), and humic acid vitamin agar, a medium described by Hayakawa and Nonomura (1987; Table 2). Humic acid vitamin agar (HVA) contains soil humic acid as the sole source of carbon and nitrogen and yields a large number of actinomycete colonies on isolation plates. Gellan gum, a polysaccharide produced by Pseudomonus elodea, is used for plant tissue culture as a solidifying agent because it stimulates growth. Suzuki et al. examined the eVect of this solidifying agent on spore formation in Actinobispora yunnanensis IFO 15681 and found that gellan gum plus calcium chloride signiWcantly stimulated the formation of spores and aerial mycelium (Suzuki et al. 1998). In our study, it is interesting that most of actinobacterial strains were recovered from these two relatively simple nutrient media. The results demonstrated that simple nutrient media and extended incubation conditions could be used to isolate taxonomically diverse bacteria including novel members of families belonging to the subclass Actinobacteridae (Sait et al. 2002; Joseph et al. 2003). Firmicutes appear to be more prominent members of the marine sediment, possibly because of their ability to produce endospores. In a recent study, a surprisingly high diversity of Firmicutes was found in marine sediments of the Republic of Palau (Gontang et al. 2007). In contrast to sequences aYliated with Actinobacteria, our sequences aYliated with the Firmicutes were much less diverse. Sequences of almost all bacterial strains of this group clustered within the class Bacilli. Bacilli have been isolated from several sponges but have only been reported to be the dominating genus (60%) of the cultivable bacteria in the marine sponge Halichondria panicea (ImhoV and Stoehr 2003; LaW et al. 2005; Zhu et al. 2008). In Group V (Fig. 3), we have a group of closely related bacteria from the three demosponge species Radiella antarctica, Homaxinella balfourensis, and Myxilla mollis. In Group III, we have two closely related species, both from the demosponge Homaxinella balfourensis. In Groups I, II, and III, we have Rossella species clustering together with diVerent demosponges, and our study demonstrated that the Antarctic sponge bacteria also cluster with bacteria from sponges of other oceans. This is an interesting point that may indicate the Gram-positive bacteria are rather unspecialized with respect to their sponge hosts. Along with other previ-
1509
ous reports, the results from our study seem to support that some of these strains from two sponge classes, Demospongiae and Hexactinellida, form sponge-speciWc clusters across diVerent Poriferan taxa (Fig. 3, Groups II, V). The potential new species within the Bacillales conWrmed previous observations that marine sponges, including deep-sea taxa, harbor so far undescribed diversity within these groups (Webster et al. 2001a; Montalvo et al. 2005). The orders Actinomycetales and Bacillales are the source of almost 50% of the known bioactive microbial metabolites discovered to date including many well-known antibiotics (Bérdy 2005). The present study provided a fundamental understanding of the diversity of the cultured Gram-positive bacteria in the Antarctic siliceous sponges. It will be ideal if these inoculated plates were also incubated at a more suitable temperature for cold water isolates. It is also necessary to carry out detailed molecular analysis, e.g., using 16S rRNA clone library and Xuorescent in situ hybridization analysis (FISH), to conWrm the isolation results and reveal the true diversity of the microbial community associated with the Antarctic sponges. The strategy of prescreening for PKS can be used to assist in the discovery of natural bacterial product diversity (Pathom-aree et al. 2006; Gontang et al. 2010), which often reXects bacterial genetic diversity. Using a degenerate primers strategy, positive PCR products for PKS gene fragments were retrieved from more than half of the isolates. The successful retrieval of PKS genes from the isolates does not necessarily imply a speciWc relation with bioactivity (Supplementary Material). Nevertheless, the strategy of prescreening with PCR primers, which target genes potentially encoding enzymes for the biosynthesis of bioactive compounds, is an eVective approach for detecting novel and useful secondary metabolites (Ketela et al. 2002; Courtois et al. 2003; Liu et al. 2003; Ginolhac et al. 2004; Pathomaree et al. 2006; Gontang et al. 2010). In order to evaluate the feasibility of screening the extracts of marine bacteria for their potential use as agricultural pesticides, three test microorganisms Erwinia carotovora 236, Xanthomonas campestris 1043, and Xanthomonas oryzae 1047 were used to perform the assay. In our study, it is interesting to Wnd that 88% of the isolates which possess a PKS gene were active against at least one test organism. In conclusion, Antarctic sponges of the classes Demospongiae and Hexactinellida are a rich and novel source of Gram-positive bacteria and, potentially, natural products. Some actinobacterial isolates from Antarctic sponges were closely related to actinomycetes identiWed from other marine sponges and formed sponge-speciWc clusters. It appears that only a few of the herein studied microbal taxa are species-speciWc with respect to their Poriferan hosts, most of the investigated bacteria can be found within
123
1510
diVerent species of both Demospongiae and Hexactinellida. Although culture-dependent approaches have well-known biases (Nold et al. 1996; Laiz et al. 2003; Tamaki et al. 2005), the present study further conWrms that these methods are an eVective way to detect certain groups of marine bacteria. In addition, cultured strains can be subject to taxonomic characterization, and their physiology, ecology, and biotechnological potential can be explored. Acknowledgments DJ thanks the Deutsche Forschungsgemeinschaft (DFG) for Wnancial support to her research project on the Phylogeny and diversiWcation history of Antarctic Porifera (JA 1063/14-1, 2).
References Ayuso-Sacido A, Genilloud O (2005) New PCR primers for the screening of NRPS and PKS-I systems in actinomycetes: detection and distribution of these biosynthetic gene sequences in major taxonomic groups. Microb Ecol 49:10–24 Barthel D, Tendal OS (1994) Antarctic hexactinellida. In: Wägele JW, Sieg J (eds) Synopses of the Antarctic benthos, vol 6. Koeltz ScientiWc Books, Koenlgstein, p 154 Barthel D, Gutt J, Tendal OS (1991) New information on the biology of Antarctic deep-water sponges derived from underwater photography. Mar Ecol Prog Ser 69:303–307 Bavestrello G, Arillo A, Calcinai B, Cattaneo-Vietti R, Cerrano C, Gaino E et al (2000) Parasitic diatoms inside antarctic sponges. Biol Bull 198:29–33 Bérdy J (2005) Bioactive microbial metabolites. J Antibiot 58:1–26 Brandt A, Brix S, Brökeland W, Cedhagen T, Choudhury M, Cornelius N, Danis B, Mesel I De, Diaz R, Gillan D, Hilbig B, Howe J, Janussen D, Kaiser S, Linse K, Malyutina M, Brandao S, Pawlowski J, Raupach M, Gooday A, vanreusel A (2007) The Southern Ocean deep sea: Wrst insights into biodiversity and biogeography. Nature 447:307–311 (+Suppl.) Brown MV, Bowman JP (2001) A molecular phylogenetic survey of sea-ice microbial communities (SIMCO). FEMS Microbiol Ecol 35:267–275 Burja AM, Hill RT (2001) Microbial symbionts of the Australian Great Barrier Reef sponge, Candidaspongia Xabellate. Hydrobilolgia 461:41–47 Cattaneo-Vietti R, Bavestrello G, Cerrano C, Gaino E, Mazzella L, Pansini M, Sarà M (1999) The role of sponges in the Terra Nova ecosystem. In: Faranda F, Guglielmo L, Ianora A (eds) Ross Sea ecology italiantartide expeditions (1987–1995). Springer, New York, pp 539–549 Cerrano C, Arillo A, Bavestrello G, Calcinai B, Cattaneo-Vietti R, Penna A (2000a) Diatom invasion in the antarctic hexactinellid sponge Scolymastra joubini. Polar Biol 23:441–444 Cerrano C, Bavestrello G, Calcinai B, Cattaneo-Vietti R, Sarà A (2000b) Asteroids eating sponges from Tethys Bay, East Antarctica. Antarctic Sci 12:425–426 Chun J (1995) Computer-assisted classiWcation and identiWcation of actinomycetes. Ph.D Thesis, Univ Newcastle, Newcastle upon Tyne, UK Connon SA, Giovannoni SJ (2002) High-throughput methods for culturing microorganisms in very-low-nutrient media yield diverse new marine isolates. Appl Environ Microbiol 68:3878–3885 Courtois S, Cappellano CM, Ball M, Francou FX, Normand P, Helynck G, Martinez A, Kolvek SJ, Hopke J, Osburne MS, August PR, Nalin R, Guerineau M, Jeannin P, Simonet P, Pernodet JL (2003) Recombinant environmental libraries provide access to
123
Polar Biol (2011) 34:1501–1512 microbial diversity for drug discovery from natural products. Appl Environ Microbiol 69:49–55 Dayton PK (1989) Interdecadal variation in an Antarctic sponge and its predators from oceanographic climate shifts. Science 245:1484– 1486 Felsenstein J (1993) PHYLIP (Phylogeny inference package), version 3.5c. Department of Genetics, University of Washington, Seattle, WA, USA Ginolhac A, Jarrin C, Gillet B, Robe P, Pujic P, Tuphile K, Bertrand H, Vogel TM, Perriere G, Simonet P, Nalin R (2004) Phylogenetic analysis of polyketide synthase I domains from soil metagenomic libraries allows selection of promising clones. Appl Environ Microbiol 70:5522–5527 Gontang EA, Fenical W, Paul R, Jensen PR (2007) Phylogenetic diversity of gram-positive bacteria cultured from marine sediments. Appl Environ Microbiol 73:3272–3282 Gontang EA, Gaudêncio SP, Fenical W, Jensen PR (2010) Sequencebased analysis of secondary-metabolite biosynthesis in marine actinobacteria. Appl Environ Microbiol 76:2487–2499 Goodfellow M, Williams ST, Mordarski M (1983) Introduction to and importance of actinomycetes. In: Goodfellow M, Mordarski M, Williams ST (eds) The biology of the actinomycetes. Academic Press Inc., London, pp 1–6 Gordon DA, Priscu J, Giovannoni S (2000) Origin and phylogeny of microbes living in permanent Antarctic lake ice. Microb Ecol 39:197–202 Governal RA, Yahya MT, Gerba CP, Shadman F (1991) Oligotrophic bacteria in ultra-pure water systems: media selection and process component evaluations. J Ind Microbiol Biotechnol 8:223–227 Hayakawa M, Nonomura H (1987) Humic acid-vitamin agar, a new medium for the selective isolation of soil actinomycetes. J Ferment Technol 65:501–509 Hentschel U, Schmid M, Wagner M, Fieseler L, Gernert C, Hacker J (2001) Isolation and phylogenetic analysis of bacteria with antimicrobial activities from the Mediterranean sponges Aplysina aerophoba and Aplysina cavernicola. FEMS Microbiol Ecol 35:305–312 Hentschel U, Hopke J, Horn M, Friedrich AB, Wagner M, Hacker J (2002) Molecular evidence for a uniform microbial community in sponges from diVerent oceans. Appl Environ Microbiol 68:4431– 4440 ImhoV JF, Stoehr R (2003) Sponge-associated bacteria: general overview and special aspects of bacteria associated with Halichondria panicea. In: Mueller WEG (ed) Sponges (Porifera). Springer, Heidelberg, pp 35–57 Janssen PH, Yates PS, Grinton BE, Taylor PM, Sait M (2002) Improved culturability of soil bacteria and isolation in pure culture of novel members of the divisions Acidobacteria, Actinobacteria, Proteobacteria, and Verrucomicrobia. Appl Environ Microbiol 68:2391–2396 Janussen D (2006) Collection of Porifera (sponges) during ANDEEP III. Rep Polar Mar Res 533:174–178 Janussen D (2008) Diversity of sponges west and east of the Antarctic Peninsula. Rep Polar Mar Res 569:41–48 (hdl:10013/epic.28679) Janussen D, Tendal OS (2007) Diversity and distribution of porifera in the bathyal and abyssal Weddell Sea and adjacent areas. DeepSea Res II 54(16/17):1864–1875 Jiang SM, Sun W, Chen MJ, Dai SK, Zhang L, Liu YH, Lee KJ, Li X (2007) Diversity of culturable actinobacteria isolated from marine sponge Haliclona sp. Antonie van Leeuwenhoek 92:405–416 Jiang SM, Li X, Zhang L, Sun W, Dai SK, Xin LW, Liu YH, Lee KJ (2008) Cutlurable actinobacteria isolated from marine sponge Iotrochota sp. Mar Biol 153:945–952 Joseph SJ, Hugenholtz P, Sangwan P, Osbone CA, Janssen PH (2003) Laboratory cultivation of widespread and previously uncultured soil bacteria. Appl Environ Microbiol 69:7210–7215
Polar Biol (2011) 34:1501–1512 Kennedy J, Baker P, Piper C, Cotter PD, Walsh M, Mooij MJ, Bourke MB, Rea MC, O’Connor PM, Ross RP, Hill C, O’Gara F, Marchesi JR, Dobson ADW (2009) Isolation and analysis of bacteria with antimicrobial activities from the marine sponge Haliclona simulans collected from Irish waters. Mar Biotechnol 11:384–396 Ketela MM, Halo L, Manukka E, Hakala J, Mantsala P, Ylihonko K (2002) Molecular evolution of aromatic polyketides and comparative sequence analysis of polyketide ketosynthase and 16S ribosomal DNA genes from various Streptomyces species. Appl Environ Microbiol 68:4472–4479 Kim TK, Garson MJ, Fuerst JA (2005) Marine actinomycetes related to the ‘Salinospora’ group from the Great Barrier Reef sponge Pseudoceratina clavata. Environ Microbiol 7(4):509–518 LaW FF, Garson MJ, Fuerst JA (2005) Culturable bacterial symbionts isolated from two distinct sponge species (Pseudoceratina clavata and Rhabdastrella globostellata) from the Great Barrier Reef display similar phylogenetic diversity. Microb Ecol 50:213–220 Laiz L, Pinãr G, Lubitz W, Saiz-Jimenez C (2003) Monitoring the colonization of monuments by bacteria: cultivation versus molecular methods. Environ Microbiol 5:72–74 Lee YK, Kim HW, Liu CL, Lee HK (2003) A simple method for DNA extraction from marine bacteria that produce extracellular materials. J Microbiol Methods 52:245–250 Li SK, Xiao X, Yin XB, Wang FP (2006) Bacterial community along a historic lake sediment core of Ardley Island, west Antarctica. Extremophiles 10:461–467 Linse K, Brandt A, Bohn J, Danis B, De Broyer C, Ebbe B, Heterier V, Janussen D, López González PJ, Schüller M, Schwabe E, Thomson MRA (2007) Macro- and megabenthic assemblages in the bathyal and abyssal Weddell Sea (Southern Ocean). Deep-Sea Res II 54(16/17):1848–1863 Liu W, Ahlert J, Gao Q, Pienkowski EW, Shen B, Thorson JS (2003) Rapid PCR ampliWcation of minimal enediyne polyketide synthase cassettes leads to a predictive familial classiWcation model. Proc Natl Acad Sci 100:11959–11963 Maldonado LA, Stach JEM, Pathom-aree W, Ward AC, Bull AT, Goodfellow M (2005) Diversity of cultivable Actinobacteria in geographically widespread marine sediments. Antonie Van Leeuwenhoek 87:11–18 Mangano S, Michaud L, Caruso C, Brilli M, Bruni V, Fani R, Giudice AL (2009) Antagonistic interactions between psychrotrophic cultivable bacteria isolated from Antarctic sponges: a preliminary analysis. Res Microbiol 160:27–37 McClintock JB, Amsler CD, Baker BJ, Rob WMVS (2005) Ecology of Antarctic marine sponges: an overview. Integr Comp Bilo 45:359–368 Merriman PR, Price RD, Baker FK, Kollmorgen JF, Piggott T, Ridge ED (1977) EVect of Bacillus and Streptomyces spp. applied to seed. In: Bruehl E (ed) Biology and control of soil-borne plant pathogens. American Phytopathological Society, St. Paul, pp 130–133 Metsä-Ketelä M, Salo V, Halo L, Hautala A, Hakala J, Mäntsälä P, Ylihonko K (1999) An eYcient approach for screening minimal PKS genes from Streptomyces. FEMS Microbiol Lett 180:1–6 Mincer TJ, Jensen PR, KauVman CA, Fenical W (2002) Widespread and persistent populations of a major new marine actinomycete taxon in ocean sediments. Appl Environ Microbiol 68:5005–5011 Montalvo NF, Mohamed NM, Enticknap JJ, Hill RT (2005) Novel actinobacteria from marine sponge. Antonie van Leeuwenhoek 87:29–36 Murray AE, Preston CM, Massana R, Taylor LT, Blakis A, Wu K (1998) Seasonal and spatial variability of bacterial and archaeal assemblages in the coastal waters near Anvers Island, Antarctica. Appl Environ Microbiol 64:2585–2595 Muscholl-Silberhorn A, Thiel V, ImhoV JF (2008) Abundance and bioactivity of cultured sponge-associated bacteria from the Mediterranean Sea. Microb Ecol 55:94–106
1511 Nold SC, Kopczynski ED, Ward DM (1996) Cultivation of aerobic chemoorganotrophic proteobacteria and gram-positive bacteria from a hot spring microbial mat. Appl Environ Microbiol 62:3917–3921 Pathom-aree W, Nogi Y, SutcliVe IC, Ward AC, Horikoshi K, Bull AT, Goodfellow M (2006) Dermacoccus abyssi sp. nov., a piezotolerant actinomycete isolated from the Mariana Trench. Int J Syst Evol Microbiol 56:1233–1237 Plotkin AS, Janussen D (2008) Polymastiidae and Suberitidae (Porifera: Demospongiae: Hadromerida) of the deep Weddell Sea, Antarctic. Zootaxa 1866:95–135 Priest FG (1989) Products and applications. In: Harwood CR (ed) Bacillus. Plenum Press, New York, pp 293–320 Radwan M, Hanora A, Zan J, Mohamed NM, Abo-Elmatty DM, AbouEl-Ela SD, Hill RT (2010) Bacterial community analyses of two Red Sea sponges. Mar Biotechnol 12:350–360 Reysenbach A-L, Giver LJ, Wickham GS, Pace NR (1992) DiVerential ampliWcation of rRNA genes by polymerase chain reaction. Appl Environ Microbiol 58:3417–3418 Sait M, Hugenholtz P, Janssen PH (2002) Cultivation of globally distributed soil bacteria from phylogenetic lineages previously only detected in cultivation-independent surveys. Environ Microbiol 4:654–666 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Schaal KP (1977) Nocardia, actinomadura and streptomyces. In: Seligson D, von Graevenitz A (eds) CRC handbook series in clinical laboratory science, section E, clinical microbiology. CRC Press, Cleveland, pp 131–158 Stevens H, BrinkhoV T, Rink B, Vollmers J, Simon M (2007) Diversity and abundance of gram positive bacteria in a tidal Xat ecosystem. Environ Microbiol 9:1810–1822 Sun W, Dai SK, Jiang SM, Wang GH, Liu GH, Wu HB, Li X (2010) Culture-dependent and culture-independent diversity of Actinobacteria associated with the marine sponge Hymeniacidon perleve from the South China Sea. Antonie van Leeuwenhoek 98:65–75 Suzuki S, Takahashi K, Okuda T, Komatsubara S (1998) Selective isolation of Actinobispora on gellan gum plates. Can J Microbiol 44:1–5 Tabares P, Pimentel-Elardo SM, Schirmeister T, Hünig T, Hentschel U (2011) Anti-protease and immunomodulatory activities of bacteria associated with Caribbean sponges. Mar Biotechnol. doi:10.1007/s10126-010-9349-0 Tamaki H, Sekiguchi Y, Hanada S, Nakamura K, Nomura N, Matsumura M, Kamagata Y (2005) Comparative analysis of bacterial diversity in freshwater sediment of a shallow eutrophic lake by molecular and improved cultivation-based techniques. Appl Environ Microbiol 71:2162–2169 Taylor MW, Mohamed NM, Enticknap JJ, Hill RT (2007) Spongeassociated microorganisms: evolution, ecology, and biotechnological potential. Microbiol Mol Biol Rev 71:295–347 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The Clustal X windows interface: Xexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res 24:4876–4882 To Isaacs L, Kan J, Nguyen L, Videau P, Anderson MA, Wright TL, Hill RT (2009) Comparison of the bacterial communities of wild and captive sponge Clathria prolifera from the Chesapeake Bay. Mar Biotechnol 11:758–770 Vickers JC, Williams ST, Ross GW (1984) A taxonomic approach to selective isolation of streptomycetes from soil. In: Ortiz-Ortiz L, Bojalil LF, YakoleV V (eds) Biological, biochemical and biomedical aspects of actinomycetes. Academic Press, Orlando, pp 553–561 Webster NS, Hill RT (2001) The culturable microbial community of the Great Barrier Reef sponge Rhopaloeides odorabile is dominated by an alpha-Proteobacterium. Mar Biol 138:843–851
123
1512 Webster NS, Wilson K, Blackall LL, Hill RT (2001a) Phylogentic diversity of the bacterial communities associated with the marine sponge, Rhopaloeides odorabile. Appl Environ Microbiol 67:434–444 Webster NS, Watts JEM, Hill RT (2001b) Detection and phylogenetic analysis of novel crenarchaeote and euryarchaeote sequences from a Great Barrier Reef sponge. Mar Biotech 3:600–608 Webster NS, Negri AP, Munro MMHG, Battershill CN (2004) Diverse microbial communities inhabit Antarctic sponges. Environ Microbiol 6:288–300 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA ampliWcation for phylogenetic study. J Baceriol 173:697–703
123
Polar Biol (2011) 34:1501–1512 Zhang HT, Lee YK, Zhang W, Lee HK (2006) Culturable actinobacteria from the marine sponge Hymeniacidon perleve: isolation and phylogenetic diversity by 16S rRNA gene-RFLP analysis. Antonie van Leeuwenhoek 90:159–169 Zhang HT, Zhang W, Jin Y, Jin MF, Yu XJ (2008) A comparative study on the phylogenetic diversity of culturable actinomycetes isolated from Wve marine sponge species. Antonie van Leeuwenhoek 93:241–248 Zhu P, Li QZ, Wang GY (2008) Unique microbial signatures of the alien Hawaiian marine sponge Suberites zeteki. Microb Ecol 55:406–414
