The Spine Journal 14 (2014) 455–468
Basic Science
Physiological testosterone levels enhance chondrogenic extracellular matrix synthesis by male intervertebral disc cells in vitro, but not by mesenchymal stem cells Alessandro Bertolo, PhDa, Martin Baur, MDb, Niklaus Aebli, MD, PhDc,d, Stephen J. Ferguson, PhDe, Jivko Stoyanov, PhDa,f,* a
Biomedical Laboratories, Swiss Paraplegic Research, G.A. Zaech Strasse 4, 6207 Nottwil, Switzerland b Cantonal Hospital of Lucerne, Spitalstrasse 16, 6000 Lucerne, Switzerland c Swiss Paraplegic Centre, Zaechstrasse 1, 6207 Nottwil, Switzerland d School of Medicine, Griffith University, University Drive, 4131 Meadowbrook Qld, Brisbane, Queensland, Australia e Institute for Biomechanics, Schafmattstrasse 30, 8093 ETH Zurich, Switzerland f Institute for Surgical Technology and Biomechanics, University of Bern, Stauffacherstrasse 78, 3014 Bern, Switzerland Received 4 June 2013; revised 11 September 2013; accepted 17 October 2013
Abstract
BACKGROUND CONTEXT: Testosterone (T) is a hormone and regulator involved in the processes of development of the organism (ie, promoting development of bone and muscle mass). Although T effects on the mesenchyme-derived muscle, bone, and adipose tissues are well studied, T effects on intervertebral disc (IVD) have not been reported. PURPOSE: The aim was to test the following hypothesis: if a physiological concentration of T (~30 nM) can improve in vitro chondrogenesis of human IVD cells and mesenchymal stem cells (MSCs). STUDY DESIGN/SETTING: Human IVD cells and MSCs were differentiated to chondrogenic lineage on gelatin scaffolds for 4 weeks, in the presence or absence of T. METHODS: Chondrogenesis was assessed by cell viability, by measuring gene expression with quantitative polymerase chain reaction and extracellular matrix (ECM) accumulation with immunoblotting, immunohistochemical, and biochemical methods. RESULTS: Supplementation of T to chondrogenic culture did not affect viability. In male IVD cells, T had a beneficial impact on chondrogenesis, particularly in nucleus pulposus cells, demonstrated by an increased expression of aggrecan, collagen type I, and especially collagen type II. Conversely, T had no effects on chondrogenesis of female IVD cells or MSCs from both genders. A gene expression array of transforming growth factor b/bone morphogenetic protein signaling cascade showed that in male IVD cells, T promoted a stable general but nonsignificant increase in gene expression. Furthermore, aromatase inhibitor anastrazole repressed the effect of T on ECM expression by IVD cells. The results suggest that T increased ECM accumulation in male IVD cells in combination with its conversion to estradiol by the enzyme aromatase. CONCLUSIONS: We demonstrated that T effectively enhances in vitro chondrogenesis in male IVD cells, rising the interest in the possible role of sex hormones in IVD degeneration. Nevertheless, T does not affect chondrogenic differentiation of female IVD cells and MSCs from both genders. Ó 2014 Elsevier Inc. All rights reserved.
Keywords:
Intervertebral disc cells; Mesenchymal stem cells; Chondrogenesis; Aromatase; Testosterone and threedimensional cultures; Sex hormones
FDA device/drug status: Not applicable. Author disclosures: AB: Nothing to disclose. MB: Nothing to disclose. NA: Nothing to disclose. SJF: Nothing to disclose. JS: Nothing to disclose. 1529-9430/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.spinee.2013.10.018
* Corresponding author. Biomedical Laboratories, Swiss Paraplegic Research, G.A. Z€ach Strasse 4, CH-6207 Nottwil, Switzerland. Tel.: (41) 41-939-6635; fax: (41) 41-939-6640. E-mail address:
[email protected] (J. Stoyanov)
456
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
Introduction Back pain (BP) is one of the most prevalent health problems in industrialized countries, leading to productivity losses for the economy and generating additional costs to support the treatment of affected individuals [1,2]. Traumatic injuries, poor posture, smoking, and, last but not least, genetics [3,4] are all variables linked with BP. In certain cases, BP is caused by degeneration of the intervertebral discs (IVDs), the largest avascular and anervous tissues of the body, which comprise three distinct tissues: an inner gel-like nucleus pulposus (NP) surrounded by the fibro-cartilaginous annulus fibrosus (AF) and cartilaginous end plates. The etiology of disc degeneration is complex, but the occurrence of IVD degeneration is strongly associated with age: 97% of individuals 50 years or older have degenerated discs [5]. During degeneration, the homeostatic mechanisms maintaining the biochemical composition and biomechanical structure of the IVD are altered, leading eventually to mechanical failure of the extracellular matrix (ECM). Such failure is facilitated by a misregulation of the balance between anabolic and catabolic processes, that is, the expression of the major structural molecules comprised in the IVD, such as collagens and proteoglycans [6], and their turnover catalyzed by matrix metalloproteinases (MMPs) [7]. A general loss of collagens and proteoglycans results in a loss of fixed negative charges from the NP, gradual dehydration of the IVD, and a consequent decrease in disc height [8]. Aging is also well known to reduce testosterone (T) synthesis and its concentration in the circulatory system in both men and women [9]. Testosterone, as a steroid hormone, belongs to the group of androgens and binds to the androgen receptor (AR), which is a nuclear transcription factor, regulating transcriptional activation of several downstream pathways [10]. Androgen receptor has been localized in human mesenchymal stem cells (MSCs) [11,12], although there is no evidence if it is expressed also by IVD cells. Not only does T play a key role in the development of male reproductive tissues, it also promotes increased muscle and bone mass synthesis and accumulation [13]. The concentration of T circulating in the blood is directly correlated with muscular mass [14], whereas T supplementation decreased fat mass in older men with low T levels [15]. Very few studies report effects of T on cartilaginous tissues, for example the absence of T induced apoptosis and decreased proliferation and the total number of chondrocytes was studied in castrated rabbits [16], but T stimulated the growth of chondrocyte cell layers in organ culture of mice mandibular condyles, as well as the local production of insulinlike growth factor (IGF-I) and IGF-I receptor [17]. In parallel, it has been shown that human articular chondrocytes are also affected by the female sex hormone b-estradiol (E2), which promoted DNA synthesis, sulfate incorporation, and alkaline phosphatase activity in female-derived chondrocytes [18]. As articular chondrocytes have a similar morphology
and gene expression profile a IVD cells, our hypothesis was that IVD might experience similar effects of the sex hormones. Therefore, we supplemented cell cultures with T at concentrations equivalent to upper physiological levels found in male blood, expecting that it may stimulate anabolic IVD activity, and may correlate with an improvement of the disc homeostasis by promoting the expression of desired ECM proteins, such as aggrecan and collagen type II. In the present study, we also investigated the effects of T on the regulation of in vitro ECM accumulation during chondrogenic differentiation of IVD cells in comparison with MSCs, a main candidate for IVD regeneration therapies, derived from donors of both sexes. Cells were differentiated in threedimensional cultures, and cell viability and chondrogenesis were assessed by quantification of gene and protein expression, including glycosaminoglycan accumulation.
Materials and methods IVD cell isolation and cell expansion IVD cells were isolated from degenerated human disc tissue (n510, Table 1) obtained during full or partial discectomy, with patient consent and approval by the ethics committee of Canton Lucerne. IVD cells were divided into groups depending on the origin of tissue: AF, NP, or mixed disc (MD), when disc degeneration did not allow precise discrimination between tissues. Disc fragments were digested in 0.05% collagenase (Sigma-Aldrich, St. Louis, MO, USA), 5% fetal bovine serum (FBS), penicillin (100 units/ mL)/streptomycin (100 mg/mL) in Dulbecco’s modified Eagle’s medium (DMEM)/F12þGlutaMAX (all Gibco) for 6 hours at 37 C. After incubation, cell suspensions were filtered through a 100-mm cell strainer (TPP, Faust Lab, Schaffhausen, Switzerland), centrifuged at 1 g, and the pellets were washed with 1 phosphate-buffered saline (PBS). IVD cells were expanded in culture for 20 days (two to three passages) as a monolayer in DMEM/F12þGlutaMAX, Table 1 Demographic details of intervertebral disc donors (average age541 years) Sample
Sex
Donor’s age, y
Thompson grading scale
Type of operation
MD MD MD AF AF AF NP NP NP NP
F M M M F M F F M M
32 50 37 25 57 45 34 39 47 46
IV III V IV II III II II IV III
DDD, L5–S1 Trauma, L2–L3 DDD, L5–S1 DDD, L5–S1 Trauma, Th10–Th11 DDD, L5–S1 Trauma, Th12–L1 Trauma, C4–C5 DDD, C5–C6–C7 DDD, L5–S1
AF, annulus fibrosis; DDD, disc degeneration disease; L, lumbar vertebrae; MD, mixed disc (no distinction between AF and NP); NP, nucleus pulposus; S, sacral vertebrae; Th, thoracic vertebrae.
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
supplemented with 10% FBS, penicillin (100 units/mL)/ streptomycin (100 mg/mL) (all Gibco; Grand Island, NY, USA), 2.5 mg/mL amphotericin B (Applichem, Darmstadt, Germany), and 5 ng/mL recombinant basic fibroblast growth factor (bFGF) (Peprotech, Rocky Hill, NJ, USA) at 37 C in a humid atmosphere containing 5% CO2, with media changed three times a week. Cells used in this study were expanded for no more than three passages in culture. MSC isolation and culture Fresh bone marrow (BM) samples were obtained from the iliac crest of the donors during surgery, with informed consent and approval by the ethics committee of canton Lucerne. MSCs were isolated from BM of 10 patients (5 men and 5 women; average age: 3469 years). The BM aspirates were diluted twofold in 3.8% sodium citrate and PBS, and filtered through a 100-mm cell strainer (Falcon; BD Bioscience, San Jose, CA, USA). Mononuclear cells were separated by Ficoll gradient centrifugation (density 1.077 g/ mL; GE Healthcare, Madison, WI, USA) in a Leucosep tube (Greiner, Monroe, NC, USA) at 800g for 20 minutes, washed with PBS, centrifuged again at 210g for 10 minutes, resuspended in PBS and counted using trypan blue dye in a single-use Neubauer chamber (C-Chip Typ Neubauer; Zeiss, Jena, Germany). Cells were placed in a tissue culture flask (TPP) in nonhematopoietic stem cell media (Miltenyi, Bergisch Gladbach, Germany) at 37 C in a humid atmosphere containing 5% CO2. After 2 days, nonadherent cells were discarded, whereas adherent cells were cultured in DMEM/F12þGlutaMAX, supplemented with 10% FBS, penicillin (100 units/mL)/streptomycin (100 mg/mL), 2.5 mg/mL amphotericin B, and 5 ng/ml bFGF with medium changed three times a week. Cells used in this project were expanded for no more than four passages in culture. Construct preparation and chondrogenic culture The scaffold used in this project was a sponge-shaped medical device made of gelatin–partially hydrolyzed collagen (Spongostan; Ferrosan/Pfizer, St Louis, MO, USA) [19]. From this material, cubes with 3-mm side length were cut and used as a support for cellular growth. At 90% confluence, cells were harvested by dissociation with 0.025% trypsin, and resuspended in PBS at 4106 cells/mL density; 18 mL cell suspension (equivalent to ~72,000 cells) was pipetted on the construct and completely absorbed by it. IVD and MSC cell constructs were kept at room temperature for 30 minutes to allow cells to anchor to the matrix, before the careful addition of media to the 6-well plate. The resulting cell matrix constructs were maintained for 28 days in control, and chondrogenic and chondrogenic media supplemented with 10 ng/mL (34.7 nM) testosterone (CT10; Sigma, St. Louis, MO, USA), 30 nM b-Estradiol (E2; Sigma), or 30 nM dihydrotestosterone (DHT; Sigma). Different concentrations of T were also tested (10 ng/mL, 100 ng/mL, and 1000 ng/mL) and results are presented in
457
Supplementary Fig. 1. Chondrogenic medium consisted of Advanced DMEM/F12þGlutaMAX (Gibco), supplemented with 2.5% FBS, 40 ng/mL dexamethasone (Applichem), 50 mg/mL ascorbate-2-phosphate (Sigma), 100 U/mL penicillin/100 mg/mL streptomycin, 2.5 mg/mL amphotericin B, 1 insulin (10 mg/mL)–Transferrin (5.5 mg/mL)–Selenium (0.67 ng/mL)–X Supplement (ITS-X; Gibco), and 10 ng/mL transforming growth factor-b1 (TGF-b1; Peprotech). Aromatase inhibitor anastrazole (100 nM; Sigma) was added to chondrogenic medium with and without T. Negative controls were maintained in Advanced DMEM/ F12þGlutaMAX, supplemented with penicillin/streptomycin, amphotericin B, FBS, ascorbate-2-phosphate, and ITS. The media was replaced three times per week. Cell viability assay To investigate the proportion of live and dead cells after 7, 14, and 28 days in different culture conditions, constructs containing cells were incubated for 2 hours with 0.05% collagenase, 0.3% pronase E (Sigma-Aldrich), 5% FBS, and penicillin (100 units/mL)/streptomycin (100 mg/mL) in DMEM/F12þGlutaMAX at 37 C. After digestion of the constructs, cells were centrifuged at 250 g for 10 minutes, resuspended in PBS, counted, and the ratio of live and dead cells was determined using trypan blue dye in a Neubauer chamber (C-Chip Typ Neubauer; Zeiss). Detection of AR by immunofluorescence The localization of AR was carried out in MSCs and IVD cells cultured for 24 hours on eight-chamber slides (Nalge Nunc International) with or without testosterone (10 ng/ mL). Cells were fixed for 20 minutes in PBSþ4% paraformaldehyde (Applichem), washed with PBS, followed by blocking with PBS containing 1 mg/mL bovine serum albumin (BSA), 10% FBS, and 0.1% Triton (Applichem) for 1 hour. After blocking, cells were incubated with polyclonal rabbit anti-AR antibody (N-20; Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a blocking mix overnight at 4 C. Fluorescence labeling was performed with anti-rabbit secondary antibody linked to TRITC (sc-3841; Santa Cruz Biotechnology). The slides were counterstained with 40 ,6diamidino-2-phenylindole (DAPI) and were examined under a fluorescence microscope (Olympus, Tokyo, Japan). RNA isolation, cDNA synthesis, and real-time PCR RNA was isolated from IVD cell and MSC constructs at days 7, 14, and 28 and then stored at –80 C as follows: cell constructs were previously disaggregated and homogenized in cell lysis buffer using a Dispomix homogenizer (Axonlab, Baden, Germany) and Aurum Total Mini Kit (Bio-Rad, Hercules, CA, USA), following the manufacturers’ instructions with modification of adding 2 mL polyacryl carrier (LucernaChem, Lucerne, Switzerland) to the lysis buffer. Total RNA (500 ng/sample) was used for synthesis of cDNA (VILO
458
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
cDNA Synthesis Kit; Bio-Rad). Complementary DNA (cDNA) was diluted 1:10 with PCR-grade water and the resulting cDNA template (5 mL) was mixed with the PCR reaction solution (IQ SYBR Green Supermix; Bio-Rad) containing 0.25-mM specific primers as described in Table 2. Specific products were amplified in triplicate in a final volume of 25 mL in 96-well plates (Bio-Rad) using quantitative PCR (qPCR) (CFX96 Real Time System; Bio-Rad). Real-time PCR was carried out with the following settings: denaturation 95 C, 3 minutes (one cycle); 95 C, 15 seconds; 64 C, 20 seconds; and 72 C, 20 seconds (40 amplification cycles), followed by melting curve analysis. Gene expression differences were determined using the 2DDCt method and the results were normalized to the expression of 60S gene. Human TGFb/bone morphogenetic protein (BMP) signaling-specific RT2 profiler PCR array (PAHS-035; SA Bioscience Co. Qiagen, Valencia, CA, USA) was used to quantify 84 genes related to the TGFb/BMP-mediated signal transduction pathway, including members of the TGFb
superfamily of cytokines and their receptors crucial for chondrogenic differentiation. At day 28, RNA was isolated from IVD cells undergoing chondrogenic differentiation in presence or absence of T, 500 ng/sample RNA was used to synthesize cDNA and subjected to PCR array analysis. Raw data were analyzed using PCR Array Data Analysis software (Qiagen), and fold changes in relative gene expression were presented after normalization to five housekeeping genes (GAPDH, B2M, Actin, RPL13A, and HPRT1). Histological and immunohistological analysis Constructs were harvested following 28 days of culture in chondrogenic and CT10 media, embedded in OCT compound (Sysmex Digitana, Kobe, Japan) for 30 minutes, and then frozen at 80 C. Constructs were subsequently cryosectioned at 20-mm thickness using a cryostat (CM 1850; Leica). Histological detection of sulfated glycosaminoglycan (GAG) accumulation was carried out by alcian blue staining.
Table 2 Human genes used in quantitative reverse transcriptase polymerase chain reaction Gene Housekeeping gene 60S Chondrogenic differentiation markers Aggrecan Collagen type I Collagen type II MMPs MMP1 MMP13 TGFb/BMP signaling pathway LTBP4 C-Fos JUN Chordin GDF5 Nucleus pulposus markers Keratin 19 PAX1 Androgen-related genes Androgen Receptor Aromatase
Primer nucleotide sequence, 50 / 30 F - GAGGCCCCTACCACTTCC R - CCTCGCTTGGTTTTGTGG F - AGGCTATGAGCAGTGTGAACG R - GCACGCCATAGGTCCTGA F - CCTCCTGGCTCTCCTGGT R - AGGGAGACCGTTGAGTCCAT F - GAAGTGCTGGTGCTCGTG R - GGCCTCTCCTTGCTCACC F - ACGAATTTGCCGACAGAGAT R - GTCCTTGGGGTATCCGTGTA F - CCAGTCTCCGAGGAGAAACA R - AAAAACAGCTCCGCATCAAC F - TGTTCCCCCACGAACTTCT R - AGAACGGGGCTAGCAGGT F - ACTACCACTCACCCGCAGAC R - CCAGGTCCGTGCAGAAGT F - CCAAAGGATAGTGCGATGTTT R - CTGTCCCTCTCCACTGCAAC F - CCAGCCAGGAGGACACAC R - GTGCCCACGTTCAGGAAG F - GCTTTATTGACAAAGGGCAAGA R - GGGCACTAATGTCAAACACG
Amplicon, bp 82
125 106 125
95 88
69 75 62 99 75
F - GCCACTACTACACGACCATCC R - CAAACTTGGTTCGGAAGTCAT F - GCAATGACCTTCAAGCATCC R - GGCAGTCCGTGTAAGCTACTG
126
F - GCCTTGCTCTCTAGCCTCAA R - GGTCGTCCACGTGTAAGTTG F - GAATATTGGAAGGATGCACAGACT R - GGGTAAAGATCATTTCCAGCATGT
103
91
293
bp, base pair; GDF5, growth differentiation factor 5; F, forward; MMP, matrix metalloproteinase; R, reverse; TGFb/BMP, transforming growth factor beta/bone morphogenetic protein.
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
459
Sections were stained overnight with 0.4% alcian blue (Fluka; Sigma) dissolved in 0.01% H2SO4 (Applichem) and 0.5 M guanidine hydrochloride (Fluka). Next, sections were washed for 30 minutes in 40% dimethyl sulfoxide and 0.05 M MgCl2 (both from Applichem). Finally, sections were mounted with 70% glycerol and examined by light microscopy. Immunohistochemical analysis was used to detect aggrecan and collagen type I and type II accumulation. Endogenous peroxidase was quenched by 3% H2O2 in PBS at room temperature for 10 minutes, and washed with PBS. Before incubation, sections for immunodetection with antiaggrecan antibody were predigested with chondroitinase ABC (0.25 U/mL, Sigma-Aldrich) in 0.1 M Tris-HCl and 0.03 M acetate buffer, pH 6.5, for 3 hours at 37 C. Nonspecific background was blocked with PBS containing 1 mg/mL BSA, 10% FBS, and 0.1% Triton (Applichem) for 30 minutes. Sections were incubated overnight at 4 C with monoclonal mouse antiaggrecan antibody (969D4D11; Biosource), mouse anticollagen type I antibody (M-38; Development Studies Hybridoma Bank, University of Iowa, Iowa City, IA, USA), and monoclonal mouse anticollagen type II antibody (II-II6B3; Development Studies Hybridoma Bank) in blocking solution. After washing with PBS, all sections were incubated with a secondary biotinylated goat anti-mouse antibody (B0529; Sigma), and then with streptavidin-horseradish peroxidase (HRP) (S2438; Sigma) for 45 minutes at room temperature. Aggrecan and collagen type I and type II were visualized by reaction with 0.075% solution of 3-amino-9-ethylcarbazole (Applichem) in 0.01% H2O2. Sections were mounted with 70% glycerol (Applichem) and examined by light microscopy. Glycosaminoglycan accumulation and DNA assays Glycosaminoglycan accumulation was quantified with alcian blue binding assay after 6 hours of digestion of three constructs per sample at 60 C with 125 mg/mL papain (Sigma-Aldrich) in 5 mM L-cysteine-HCl (Fluka), 5 mM Na-citrate, 150 mM NaCl, and 5 mM EDTA (all AppliChem). Glycosaminoglycan accumulation was determined by binding to alcian blue, and absorption was measured at 595 nm and quantified against chondroitin sulfate (Sigma-Aldrich) reference standards [20]. Total double-stranded DNA was measured for each sample after papain digestion, as previously described. The amount of DNA was determined using SYBR green (LuBioScience, Toepferstrasse, Switzerland) fluorescent assay (absorption measured at 535 nm), quantified by referring to calf thymus DNA (Sigma-Aldrich) standards. Collagen type II immunoblot analyses Total protein content was isolated from both IVD cells and MSCs (control, chondrogenic, and CT10 groups) during RNA extraction by collecting the lysis and washing flowthrough using a Total RNA Mini Kit (Bio-Rad). After precipitation overnight at 80 C, the samples were centrifuged at
Fig. 1. (Top) Images of the intervertebral disc (IVD) cell constructs (top row) and mesenchymal stem cell (MSC) constructs (bottom row) in negative control, chondrogenic, and CT10 differentiation cultures at day 28 (entire scale bar is 2 mm). (Middle) Cell constructs from each type of culture were enzymatically digested and the number of cells per construct (IVD cells, upper graph; MSCs, lower graph) was determined over a period of 28 days (n510, the number of cells per construct is represented as mean6standard deviation [SD]). (Bottom) DNA quantification of IVD cell and MSC constructs at day 28 (n510, DNA content is represented as mean6SD).
14,000 g for 15 minutes, the protein pellets were washed twice in 70% ethanol, and then resuspended in CelLytic M Cell Lysis Reagent (Sigma-Aldrich). Protein extracts were fractionated by Mini-Protean TGX 4% to 15% polyacrylamide gels (4561083, Bio-Rad), and electrophoretically transferred to a nitrocellulose membrane (Bio-Rad). The nitrocellulose membranes were incubated with mouse monoclonal antibodies against collagen type II (1:400, II-II6B3; Development Studies Hybridoma Bank), and housekeeping
460
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
Fig. 2. Androgen receptor (AR) presence (red fluorescence) in intervertebral disc (IVD) cells (Top) and mesenchymal stem cells (MSCs) (Bottom) cultured without (top row) or with 10 ng/mL testosterone (bottom row) was determined by immunocytochemistry. Nuclear translocation of the cytoplasmic AR occurs in the presence of testosterone in IVD cells and MSCs cultured for 24 hours in monolayer, and 40 ,6-diamidino-2-phenylindole (DAPI) counterstain was used to localize the nuclei. (Entire scale bar is 120 mm).
gene actin (1:100, JLA20-s; Development Studies Hybridoma Bank). Blocked membranes were probed with primary antibodies diluted in 5% milk (Applichem) for 2 hours,
followed by HRP-conjugated mouse secondary antibody (1:1000; Bethyl) diluted in PBS, for 1 hour at room temperature. Membranes were developed with EZ-ECL-Kit
Fig. 3. Gene expression according to gender of collagen type I (COL1), collagen type II (COL2), and aggrecan (ACAN) by intervertebral disc (IVD) cell (Top) and mesenchymal stem cell (MSC) constructs (Bottom) after 28 days of culture in negative control and CT10 media. (Gene expression was normalized to 60S and compared with expression in chondrogenic medium, data represented as a mean6standard deviation, *p!.05; IVD cells: 6 male and 4 female, MSCs: 5 male and 5 female).
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
(LucernaChem). The results were normalized to the relative amount of actin. Statistical analysis Data were expressed as the mean6standard deviation. The nonparametric Mann-Whitney–Wilcoxon U test for dependent variables was used to compare gene expression, DNA quantification, and GAG accumulation, because analysis of variance would assume normal distribution of the data, which cannot be guaranteed in this data set. For all tests, p!.05 was considered significant. Data analysis was performed with SPSS 14.0 for Windows (SPSS Inc., Chicago, IL, USA).
Results Cell morphology, cell number, and viability of IVD cells and MSC constructs After 28 days in chondrogenic, chondrogenic plus T (CT10), and negative control media, IVD cells and MSCs seeded in gelatin scaffolds had a similar size and shape (Fig. 1, Top). Decreased translucency and increased reflection of light suggested a more compact and dense consistency in the constructs cultured in chondrogenic and CT10 media. The number of cells per construct was time dependent and strongly influenced by the type of culture (Fig. 1, Middle). At day 7, the range of IVD cell numbers per construct was between approximately 50,000 cells (control medium), approximately 75,000 cells (CT10 medium), and approximately 100,000 cells (chondrogenic medium). Within 4 weeks, cell number in the negative control culture was practically unchanged, whereas cells in both chondrogenic and CT10 cultures more than doubled their numbers by day 28. MSC constructs in chondrogenic and CT10 media had initially a similar number of cells retained, and only slightly lower in control medium. After 4 weeks, the number of cells retained by MSC constructs in control medium decreased further to 50,000 cells, whereas in chondrogenic and CT10 cell media, the number remained constant. Viability for both IVD cells and MSCs was analyzed and the percentage of viable cells (~95%), was similar for each type of culture over the 4-week time course (data not shown). Similarly, DNA quantification of IVD cell and MSC constructs at day 28 confirmed previous observations (Fig. 1, Bottom): at the end of the differentiation period, IVD cells were largely more than MSCs and the presence of T did not influence the number of cells retained. Testosterone induces nuclear translocation of AR Immunofluorescence microscopy was used to detect the expression of AR protein in IVD cells and MSCs (Fig. 2). In the control expansion culture, AR receptor localization was mostly restricted in the cytoplasm. Conversely, after
461
24 hours of incubation with culture medium supplemented with 10 ng/mL T, a large fraction of AR was translocated to the nucleus of the cells. Cells were counterstained with DAPI to reveal the respective position of the nuclei. Interestingly, both IVD cells and MSCs had heterogeneous levels of AR protein in the cytoplasm, which translocated fully to the nuclei of IVD cells or partially to the nuclei in of MSCs. After 28 days in chondrogenic and CT10 cultures, gene expression of AR was analyzed in IVD cells and MSC constructs. AR expression was not affected by T, and did not differ according to gender (Supplementary Fig. 2A) and IVD tissue type (Supplementary Fig. 2B).
Gene expression analysis of IVD cells and MSCs cultured in presence of T, depending on gender After 28 days in culture, quantitative real-time PCR was used to assess expression of the most important ECM molecules of the IVD, namely aggrecan (ACAN) and collagen type I (COL1) and type II (COL2) by IVD cells (Fig. 3,
Fig. 4. Gene expression of collagen type II (COL2) (Top), collagen type I (COL1) (Middle), and aggrecan (ACAN) (Bottom) by male intervertebral disc cell constructs after 28 days of culture in control and CT10 media, according to tissue source: mixed disc (MD), nucleus pulposus (NP), and annulus fibrosus (AF). (Gene expression was normalized to 60S and compared with expression in chondrogenic medium, data represented as a mean6standard deviation, *p!.05; MD n52, NP n52, AF n52).
462
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
Fig. 5. T effects on extracellular matrix (ECM) accumulation was determined by immunohistochemistry, Western blot, and glycosaminoglycan (GAG)/DNA ratio. Immunohistochemistry microphotographs (Top) of sections of male mesenchymal stem cell (MSC) and intervertebral disc (IVD) cell (mixed disc [MD] cells) constructs cultured in chondrogenic and CT10 media for 28 days (on the left as negative control, sections of MSC constructs in control media). Collagen type II, type I, and aggrecan accumulation was depicted by positive red-colored signal, and on the bottom of the panel, deposition of proteoglycan-rich ECM was proved by alcian blue staining (entire scale bar is 160 mm). Collagen type II Western blot (Middle) was performed on proteins isolated from male IVD cells (MD cells) and MSC construct after 28 days in culture, and normalized to actin. At days 7, 14, and 28, the accumulation of GAG (Bottom) according to gender by MSC and IVD cell constructs in chondrogenic and CT10 media was measured and normalized to the content of DNA (values represent the mean6standard deviation; n510).
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
463
Fig. 6. Volcano plot (A) of reverse transcriptase polymerase chain reaction array was used to quantify the expression of 84 genes (B) ontologically related to transforming growth factor beta/bone morphogenetic protein signaling pathway in intervertebral disc (IVD) cell constructs of four male donors (mixed disc and nucleus pulposus cells) at day 28. The relative expression levels for each gene in chondrogenic versus CT10 sample were plotted against each other in the volcano plot. Significant differences (p!.05) were plotted as dots above the horizontal line, whereas more than twofold expression changes would lie outside the two vertical lines. LTBP4 (C), C-Fos (D), JUN (E), Chordin (F), and GDF5 (G) were validated in IVD cell constructs cultured in CT10 media and averaged according to gender. (Relative expression normalized to 60S and compared with expression in chondrogenic medium, data are represented as mean6 standard deviation, *p!.05; n510: 6 male and 4 female).
Top) and MSCs (Fig. 3, Bottom). Expression of IVD cells derived from male donors cultured in CT10 medium and normalized to the chondrogenic group showed a significant 2.1-fold increased level of COL1 (p#.05), 2.6-fold increase of COL2 (p#.05), and 1.8-fold increase of ACAN (p#.05), whereas cells derived from female donors did not show a significant difference. In negative control medium, male IVD cell expression of COL1 and ACAN was reduced to approximately 30% of the expression in chondrogenic medium and female IVD cell COL1 and ACAN expression dropped down to 10%. In the same group, COL2 expression was practically undetectable in both male and female cells. In MSCs, gene expression levels of COL1, COL2, and ACAN were not affected by supplementation of T to chondrogenic cultures, independently of gender. Further, we wanted to investigate if T may change the expression of MMPs, enzymes deputed to degrade ECM. Gene expression levels of MMP1 and MMP13 were not significantly changed between chondrogenic and CT10 groups in both IVD cells and MSCs (data not shown). Gene expression analysis of IVD cells grown in the presence of testosterone, depending on disc tissue type After 28 days, quantitative real-time PCR was used to assess mRNA expression of ECM molecules by IVD cells, with different tissue origin (Fig. 4): AF, NP, and MD.
Compared with the chondrogenic culture, T supplementation promoted a further fourfold increase in COL2 expression level in the NP group (p#.05) (Fig. 4, Top), twofold in the MD group (p#.05), and 1.5-fold in the AF group. NP cells also demonstrated the higher expression induction by T of COL1 (twofold increase, p#.05), as well as MD cells (Fig. 4, Middle), and 1.5-fold increase in the AF group. MD and NP cells expressed the highest level of ACAN (approximately twofold increase, p#.05) in CT10 medium, whereas the AF group was unchanged (Fig. 4, Bottom). Gene expression of the NP marker keratin 19 increased in NP cells in the presence of T (p#.05), compared with AF and MD cells (Supplementary Fig. 3A), and this effect was observed only for male cells (p#.05) (Supplementary Fig. 2B). On the other hand, expression of PAX1, another NP marker tested, showed no changes among disc tissue type and between genders (Supplementary Fig. 3C, D). Testosterone positively modulates chondrogenic protein markers in IVD cells, but not in MSCs The localization of collagen type II and type I and aggrecan in MSC and IVD cell construct sections was determined by immunostaining after 28 days in culture (Fig. 5, Top). In IVD cell constructs, collagen type II accumulation was undoubtedly higher when cultured in CT10 medium compared with chondrogenic medium, whereas the amount
464
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
of collagen type I and aggrecan staining showed similar intensity between the groups. Interestingly, collagen type II and type I and aggrecan accumulation was visibly higher in the inner part of MSC constructs compared with IVD cell constructs, but there were no differences in staining between chondrogenic and CT10 cultures. In negative control medium, MSC constructs showed, as expected, no accumulation of collagen type II, but only collagen type I and, to a lesser extent, aggrecan. Western blot on protein extracts of IVD cell and MSC constructs confirmed the higher accumulation of COL2 in the presence of T in IVD cells, and no changes in MSCs (Fig. 5, Middle). Proteoglycan (GAG) accumulation was evaluated by histological staining of construct sections and quantified by alcian blue precipitation reaction (Fig. 5, Bottom). MSC constructs accumulated more proteoglycan compared with IVD cell constructs. Histologically, chondrogenic and CT10 groups appeared to have similar proteoglycan staining in both MSC and IVD cell construct sections. The detailed quantitative GAG precipitation analysis of IVD cell constructs showed that cells in CT10 accumulated almost 25% more GAG than cells in chondrogenic cultures in male and 35% more than female cells; however, both did not reach significance, whereas no differences were present at day 7 or day 14.
were expressing higher levels of aromatase compared with AF and MD cells (Fig. 7, Bottom). Comparison of the effects on chondrogenic protein markers of T, estrogen, and DHT in IVD cell constructs After 28 days in culture, the effects of T, estrogen (E), and DHT on IVD cell constructs were assessed by immunostaining (Fig. 8A), Western blot (Fig. 8B), and gene expression (Fig. 8C–E). T promoted higher accumulation of collagen type II and less extent of collagen type I in IVD cell constructs, without altering accumulated aggrecan. Anastrazole (A), an aromatase cytochrome P450 inhibitor (encoded by the CYP19 gene), blocked T conversion to E
Testosterone influences expression of TGFb/BMP pathway genes Because expression and accumulation of the most extracellular molecules of the disc are under the control of the TGFb/BMP pathway, we studied how this pathway was affected by T, using a specific qPCR array containing 84 genes, the expression of which is related to the TGFb/ BMP pathway (Fig. 6, Top, and a list of genes in Fig. 6, Middle). The relative volcano plot showed a modest but stable upregulation of gene expression levels in CT10 cultures compared with the chondrogenic group, demonstrated by a right shift of the data points. The response of five genes specifically upregulated only in male-derived IVD cells was further validated by reverse transcriptase PCR (RT-PCR): latent TGFb binding protein 4 (LTBP4) showed 1.5-fold induction (p#.05), C-Fos showed 1.8-fold induction (p#.05), C-Jun showed 1.5-fold induction, Chordin showed 1.5-fold induction, and growth differentiation factor-5 (GDF5) showed 1.8-fold induction (p#.05). Gene expression levels of aromatase in IVD cells and MSCs Aromatase gene expression was greater in IVD cells compared with MSCs (Fig. 7, Top). In IVD cells, aromatase levels were higher in male donor cells compared with female (p#.05), whereas no differences according to gender were seen in MSCs. The expression of aromatase was not affected by supplementation of T to cultures and NP cells
Fig. 7. After 28 days of culture, gene expression of aromatase by intervertebral disc (IVD) cell and mesenchymal stem cell (MSC) constructs under chondrogenic (Ch) and CT10 conditions, was grouped according to sex (Top). IVD cell constructs were grouped depending on tissue source (Bottom): annulus fibrosus (AF), mixed disc (MD), and nucleus pulposus (NP). (Gene expression was normalized to 60S, and represented as a mean6standard deviation and compared with expression in chondrogenic medium, *p!.05; IVD cell: 6 males and 4 males, MSCs: 5 males and 5 females; AF n52, MD n52, NP n52).
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
465
Fig. 8. At day 28, immunohistochemical staining (A) and gene expression analysis were used to compare the effects of chondrogenic cultures supplemented with testosterone (CT10), testosterone and aromatase inhibitor anastrazole (TA), b-estradiol (E), and dihydrotestosterone (DHT) on male intervertebral disc (IVD) cell constructs. Accumulation of collagen type II and type I, and aggrecan is depicted in red on sections of IVD cell constructs (mixed disc cells) cultured in different media (entire scale bar is 160 mm). Collagen type II Western blot (B) was performed on proteins isolated from male IVD cell constructs after 28 days in culture, and normalized to actin. The protein extracts used were negative control (1), chondrogenic (2), chondrogenicþA (3), chondrogenicþT (4), and chondrogenicþTA (5). Gene expression of collagen type II (C), collagen type I (D), and aggrecan (E) by male IVD cell constructs was evaluated in control and chondrogenic cultures supplemented with either anastrazole (ChþA), T (CT10), T and anastrazole (ChþTA), b-estradiol (ChþE), or dihydrotestosterone (ChþDHT). (Relative expression normalized to 60S and compared with chondrogenic medium, data are represented as a mean6standard deviation, *p!.05; male IVD cell n56).
in IVD cells and canceled the beneficial effects observed with T alone by reducing collagen type II and type I accumulation to levels observed in standard chondrogenic culture. On the other hand, E reduced the accumulation of collagen type I and aggrecan, in comparison with chondrogenic cultures, without visible effects on collagen type II. DHT induced higher accumulation of collagen type I in IVD cell constructs, and promoted a moderate increase in collagen type II and aggrecan accumulation. Quantitative real-time PCR showed that the expression of COL2, COL1, and ACAN by IVD cell constructs cultured with E and DHT was similar to the chondrogenic group, and only T induced significant increases in the gene expression (p#.05). These data, as well as collagen type II Western blot, confirmed the already observed inhibition of
the positive effects of T by A. As a control, chondrogenic cultures of IVD cell constructs supplemented with only A did not show notable differences in gene expression.
Discussion In this study, we tested if there would be a place for T supplementation in association with future tissue engineering approaches for IVD regeneration, based on the speculation that T deficiency might be a factor involved in IVD degeneration. For this purpose, we used three-dimensional cultures of human IVD cells derived from degenerated tissue and BM-derived MSCs as an in vitro model system to investigate the effects of 10 ng/mL T on chondrogenesis.
466
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
This T concentration was chosen as an upper physiological value in young men, normal range 2.5 to 11.0 ng/mL (the normal range in women being an order of magnitude lower). We demonstrated by immunohistochemistry that T had an immediate biological effect on the IVD cells isolated from male donors and induced nuclear translocation of the AR. In our study, confirmed at transcriptional (quantitative RT-PCR) and translational (immunohistochemistry and Western blot) levels, T promoted chondrogenesis by upregulating the mRNA and protein expression in IVD cells of key ECM components of the disc, namely aggrecan and collagen type I and type II, and did not regulate expression of the common MMP1 and MMP13. There were no significant differences in cell response to T based on the grade of degeneration of the origin disc tissue, comparing IVD cells between mild (Thompson grades II–III) and severe (Thompson grades IV–V) degeneration grades (Supplementary Fig. 4). Also for MSCs, we demonstrated that T neither stimulates nor inhibits chondrogenic differentiation. Gender-specific effects on chondrogenesis of T have been reported before with controversial results: in rat chondrocyte culture, T increased the percentage of collagen production in male cells only [21], but in human progenitor chondrocytes, T increased collagen type I and type II gene expression only in female-derived cells [22]. There are various possible underlying mechanisms that may lead to these effects. Sex hormones, including T, in the body are extensively studied and have effects far beyond the sexual function. On the biochemical, cellular, and organism levels, T plays a complex role and, apart from being important for sexual function, it is involved in the regulation of bone density, adipose tissue distribution, mood, energy, and psychological well-being [23]. Furthermore, T modulates the immune response and its immunomodulatory potential has been described for the treatment of atherosclerosis [24]. Testosterone replacement therapy reduces the proinflammatory cytokines tumor necrosis factor a and interleukin-1b while increasing the anti-inflammatory cytokine interleukin-10 [25]. The same cytokines have been detected in the degenerated IVD [26], implying that in vivo treatment of degenerate IVDs could act not only on improved ECM deposition, but also on modulation of the inflammatory state. This beneficial influence of T on IVD cells, which we observed, would make biological sense in vivo in terms of relation between IVD degeneration and sex hormonal levels. As known, IVD degeneration is strongly age related [5], but some cases of IVD degeneration in men have been reported already in the second decade of life, and the number of IVD degeneration cases of young aged-matched individuals was slightly but significantly more frequent in men compared with women [5,27]. Consequently, young men are more inclined to IVD degeneration rather than age-matched women, but it is unknown if the degeneration difference is because of environmental factors, such as increased mechanical stress and physical injuries or metabolic reasons, for example, because these men had lower
levels of T. Remarkably, the demographics of IVD degeneration is reversed in the elderly; in a radiographic study of 55-year-old subjects and older, IVD space narrowing was more prevalent in postmenopausal women than in men [28] and male propensity for more severe IVD degeneration was no longer evident by the age of 60 years [5]. This difference reported between ages in disc degeneration susceptibility has been associated with alteration in the hormonal balance. Sex hormones regulate the different stages of aging, with a faster progressive loss in estrogens in women (menopause) and slower loss of T in men [9]. Indeed, lower estrogen release in the blood, which occurs with menopause, has also been connected to IVD degeneration [29]. Total lumbar IVD height was significantly lower in untreated menopausal women compared with both premenopausal and hormone-treated postmenopausal women [30]. Gruber et al. [31] showed that human AF cells express estrogen receptor-b and estrogen (17-b-estradiol) stimulated in vitro cell proliferation of AF cell cultures. No such study has been done for T but the estradiol link may be indicative of some explanation of our results. Testosterone is converted into 17-b-estradiol by the aromatase CYP19, which
Fig. 9. Proposed mechanism of testosterone (T) on male-derived intervertebral disc cells. T is metabolized by cells in three ways: (1) it might be converted to dihydrotestosterone (DHT) by the enzyme SRD5A1, (2) internalized in its original form, or (3) converted to b-estradiol (E) by aromatase. In the cytoplasm, T and DHT bind to androgen receptor (AR) and E binds to estrogen receptor (ESR1). We propose that the binding of T to cytoplasmic AR promotes its translocation to the nucleus, and in association with conversion of T to E, enhances extracellular matrix (ECM) production via the transcription-inducing complex c-FOS/c-JUN, which is also part of the SMAD independent pathway of transforming growth factor beta (TGFb) signaling. BMP, bone morphogenetic protein; TGF-b1R, TGFb1 receptor.
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
could link our results with the sex hormone changes described previously, but in this study we did not measure the rate of conversion of T to 17-b-estradiol. Older studies in cartilage hint against such a conclusion: chondrocytes from women were stimulated by 17-b-estradiol treatment [18] but cartilage volume in the knee showed no association when T levels increased [32], suggesting that, if chondrocytes have aromatase activity at all, possibly not enough T was converted to 17-b-estradiol; however, until now no studies of T and IVD have been published. In our study, by blocking aromatase activity with anastrazole, we were able to show a significant decrease of anabolic ECM producing activity in male-derived IVD cells, suggesting stimulation by 17-b-estradiol. However, by adding synthetic 17-b-estradiol, in the absence of T, the activity observed with T was not achieved. Because anastrazole by itself (in absence of T) did not inhibit chondrogenesis, we may conclude that the observed stimulation by T is achieved only by a T/17-b-estradiol balance, a specific ratio that needs to be studied further. We hypothesized also which molecular mechanism might underlay the beneficial effects of T on IVD ECM accumulation (Fig. 9); by (1) inducing directly AR or (2) indirectly via SRD5A1 reductase (converting T to DHT) followed by their nuclear localization, or (3) via estrogen receptor (aromatase convert T to 17-b-estradiol). In our study, we did not observe a repression of the TGFb, on the contrary there was a low but persistent level of upregulation of approximately 70 of 84 genes related to the TGFb/ BMP pathway. The opposite has been reported for human prostate cells, where the TGFb signaling pathway was repressed by AR signaling thorough interaction with SMAD3 [33], suggesting that in different cells, AR may work on different promoters. The TGFb signaling pathway is central for the increased ECM deposition in IVD cells and TGFb1 is a growth factor commonly used in chondrogenic differentiation of cells in vitro, so considering our data we have to accept that it is either the general low-level stimulation of this pathway that is responsible for the enhanced chondrogenesis or that AR may promote its biological functions in IVD cells through a different pathway. In addition, neither AR nor SRD5A1 were expressed specifically in the cell groups responding more efficiently to T (ie, malederived IVD cells, especially NP cells). An alternative hypothesis we tested was that T is converted by aromatase to 17-b-estradiol, which binds to estrogen receptor-1. In our study, aromatase was specifically expressed to a higher extent in male-derived IVD cells and NP cells compared with MSCs and AF cells. We know that 17-b-estradiol might promote overexpression of Jun and Fos, which form the transcription factor activator protein-1 (AP-1) [34], a heterodimeric transcription factor already linked to the TGFb signaling pathway [35]. Indeed, our results confirmed upregulation of Jun and Fos in the presence of T, proposing AP-1 to be responsible of the mechanism elicited by T to improve ECM synthesis of IVD cells in vitro.
467
On the other hand, the same positive effects on chondrogenesis were not achieved with BM-derived MSCs, which we included in our study because these cells have a high proliferative capacity [36] and the ability to differentiate into several cell types [37], including chondrocytes [38] and possibly IVD cells, and because of their potential for cellbased therapies of degenerated IVD [19]. The absence of significant changes might be because of the diverse grade of commitment of cells, the fully differentiated intervertebral cells responding in a different way compared with the MSCs, or because MSCs have higher (compared with IVD cells) expression of ECM and might have reached their in vitro optimum, whereas the IVD cells have further potential that can be stimulated by adding T. It has been shown that T inhibits adipogenic differentiation in vitro [39] and stimulates myogenic differentiation [40] and muscle cell growth [41]. Together, these findings lead to the conclusion that T has other possible effects on MSC differentiation, such as driving them toward the myogenic lineage, a possibility not investigated in our study. In conclusion, we demonstrated that normal-to-high T levels stimulated the accumulation of ECM during in vitro chondrogenic differentiation of three-dimensional cultures of male-derived IVD cells, but not in MSCs. These findings are in line with the relevance of decreasing androgen levels in aging individuals, and support the hypothesis that not only estrogens but also androgens, might be linked to the incidence of IVD degeneration. Our data also does not exclude the involvement of an additional pathway activated by T [42]. Therefore, the study opens the way for further research of a new therapeutically attractive option: the use of the well-studied and readily available T molecule to enhance ECM synthesis by human disc cells for preventive and regenerative treatment of degenerated IVDs.
Acknowledgments This work was supported by the Swiss Paraplegic Foundation and Swiss National Foundation Grant CR3I3_140717/1.
Appendix Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.spinee.2013.10.018. References [1] Wenig CM, Schmidt CO, Kohlmann T, Schweikert B. Costs of back pain in Germany. Eur J Pain 2009;13:280–6. [2] Wieser S, Horisberger B, Schmidhauser S, et al. Cost of low back pain in Switzerland in 2005. Eur J Health Econ 2011;12:455–67. [3] Pye SR, Reid DM, Adams JE, et al. Influence of weight, body mass index and lifestyle factors on radiographic features of lumbar disc degeneration. Ann Rheum Dis 2007;66:426–7.
468
A. Bertolo et al. / The Spine Journal 14 (2014) 455–468
[4] Videman T, Saarela J, Kaprio J, et al. Associations of 25 structural, degradative, and inflammatory candidate genes with lumbar disc desiccation, bulging, and height narrowing. Arthritis Rheum 2009;60:470–81. [5] Miller JA, Schmatz C, Schultz AB. Lumbar disc degeneration: correlation with age, sex, and spine level in 600 autopsy specimens. Spine 1988;13:173–8. [6] Antoniou J, Steffen T, Nelson F, et al. The human lumbar intervertebral disc: evidence for changes in the biosynthesis and denaturation of the extracellular matrix with growth, maturation, ageing, and degeneration. J Clin Invest 1996;98:996–1003. [7] Crean JK, Roberts S, Jaffray DC, et al. Matrix metalloproteinases in the human intervertebral disc: role in disc degeneration and scoliosis. Spine 1997;22:2877–84. [8] Dabbs VM, Dabbs LG. Correlation between disc height narrowing and low-back pain. Spine 1990;15:1366–9. [9] Liu PY, Pincus SM, Takahashi PY, et al. Aging attenuates both the regularity and joint synchrony of LH and testosterone secretion in normal men: analyses via a model of graded GnRH receptor blockade. Am J Physiol Endocrinol Metab 2006;290:E34–41. [10] Mangelsdorf DJ, Thummel C, Beato M, et al. The nuclear receptor superfamily: the second decade. Cell 1995;83:835–9. [11] Mantalaris A, Panoskaltsis N, Sakai Y, et al. Localization of androgen receptor expression in human bone marrow. J Pathol 2001;193: 361–6. [12] Gupta V, Bhasin S, Guo W, et al. Effects of dihydrotestosterone on differentiation and proliferation of human mesenchymal stem cells and preadipocytes. Mol Cell Endocrinol 2008;296:32–40. [13] Mooradian AD, Morley JE, Korenman SG. Biological actions of androgens. Endocr Rev 1987;8:1–28. [14] Sinha-Hikim I, Artaza J, Woodhouse L, et al. Testosterone-induced increase in muscle size in healthy young men is associated with muscle fiber hypertrophy. Am J Physiol Endocrinol Metab 2002;283:E154–64. [15] Snyder PJ, Peachey H, Hannoush P, et al. Effect of testosterone treatment on body composition and muscle strength in men over 65 years of age. J Clin Endocrinol Metab 1999;84:2647–53. [16] Irie T, Aizawa T, Kokubun S. The role of sex hormones in the kinetics of chondrocytes in the growth plate. A study in the rabbit. J Bone Joint Surg Br 2005;87:1278–84. [17] Maor G, Segev Y, Phillip M. Testosterone stimulates insulin-like growth factor-I and insulin-like growth factor-I-receptor gene expression in the mandibular condyle—a model of endochondral ossification. Endocrinology 1999;140:1901–10. [18] Kinney RC, Schwartz Z, Week K, et al. Human articular chondrocytes exhibit sexual dimorphism in their responses to 17beta-estradiol. Osteoarthritis Cartilage 2005;13:330–7. [19] Bertolo A, Mehr M, Aebli N, et al. Influence of different commercial scaffolds on the in vitro differentiation of human mesenchymal stem cells to nucleus pulposus-like cells. Eur Spine J 2012;21:S826–38. [20] Bjornsson S. Simultaneous preparation and quantitation of proteoglycans by precipitation with alcian blue. Anal Biochem 1993;210: 282–91. [21] Schwartz Z, Nasatzky E, Ornoy A, et al. Gender-specific, maturationdependent effects of testosterone on chondrocytes in culture. Endocrinology 1994;134:1640–7. [22] Koelling S, Miosge N. Sex differences of chondrogenic progenitor cells in late stages of osteoarthritis. Arthritis Rheum 2010;62: 1077–87. [23] Burger HG. Androgen production in women. Fertil Steril 2002;77: S3–5. [24] Malkin CJ, Pugh PJ, Jones RD, et al. Testosterone as a protective factor against atherosclerosis—immunomodulation and influence
[25]
[26]
[27]
[28]
[29] [30]
[31]
[32]
[33]
[34]
[35]
[36]
[37] [38]
[39]
[40]
[41]
[42]
upon plaque development and stability. J Endocrinol 2003;178: 373–80. Malkin CJ, Pugh PJ, Jones RD, et al. The effect of testosterone replacement on endogenous inflammatory cytokines and lipid profiles in hypogonadal men. J Clin Endocrinol Metab 2004;89:3313–8. Ahn SH, Cho YW, Ahn MW, et al. mRNA expression of cytokines and chemokines in herniated lumbar intervertebral discs. Spine 2002;27:911–7. Takatalo J, Karppinen J, Niinimaki J, et al. Prevalence of degenerative imaging findings in lumbar magnetic resonance imaging among young adults. Spine 2009;34:1716–21. de Schepper EI, Damen J, van Meurs JB, et al. The association between lumbar disc degeneration and low back pain: the influence of age, gender, and individual radiographic features. Spine 2010;35:531–6. Wang YX, Griffith JF. Effect of menopause on lumbar disk degeneration: potential etiology. Radiology 2010;257:318–20. Baron YM, Brincat MP, Calleja-Agius J, Calleja N. Intervertebral disc height correlates with vertebral body T-scores in premenopausal and postmenopausal women. Menopause Int 2009;15:58–62. Gruber HE, Yamaguchi D, Ingram J, et al. Expression and localization of estrogen receptor-beta in annulus cells of the human intervertebral disc and the mitogenic effect of 17-beta-estradiol in vitro. BMC Musculoskelet Disord 2002;3:4. Hanna FS, Bell RJ, Cicuttini FM, et al. The relationship between endogenous testosterone, preandrogens, and sex hormone binding globulin and knee joint structure in women at midlife. Semin Arthritis Rheum 2007;37:56–62. Chipuk JE, Cornelius SC, Pultz NJ, et al. The androgen receptor represses transforming growth factor-beta signaling through interaction with Smad3. J Biol Chem 2002;277:1240–8. Silbiger S, Lei J, Neugarten J. Estradiol suppresses type I collagen synthesis in mesangial cells via activation of activator protein-1. Kidney Int 1999;55:1268–76. Avouac J, Palumbo K, Tomcik M, et al. Inhibition of activator protein 1 signaling abrogates transforming growth factor beta-mediated activation of fibroblasts and prevents experimental fibrosis. Arthritis Rheum 2012;64:1642–52. Colter DC, Sekiya I, Prockop DJ. Identification of a subpopulation of rapidly self-renewing and multipotential adult stem cells in colonies of human marrow stromal cells. Proc Natl Acad Sci U S A 2001;98: 7841–5. Jiang Y, Jahagirdar BN, Reinhardt RL, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41–9. Yoo JU, Barthel TS, Nishimura K, et al. The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg Am 1998;80:1745–57. Singh R, Artaza JN, Taylor WE, et al. Testosterone inhibits adipogenic differentiation in 3T3-L1 cells: nuclear translocation of androgen receptor complex with beta-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription factors. Endocrinology 2006;147:141–54. Singh R, Bhasin S, Braga M, et al. Regulation of myogenic differentiation by androgens: cross talk between androgen receptor/betacatenin and follistatin/transforming growth factor-beta signaling pathways. Endocrinology 2009;150:1259–68. Sinha-Hikim I, Taylor WE, Gonzalez-Cadavid NF, et al. Androgen receptor in human skeletal muscle and cultured muscle satellite cells: up-regulation by androgen treatment. J Clin Endocrinol Metab 2004;89:5245–55. Heinlein CA, Chang C. The roles of androgen receptors and androgen-binding proteins in nongenomic androgen actions. Mol Endocrinol 2002;16:2181–7.
