Polymorphic Microsatellite Markers Transferable Across Capsicum Species

Plant Mol Biol Rep (2010) 28:285–291 DOI 10.1007/s11105-009-0151-y

Polymorphic Microsatellite Markers Transferable Across Capsicum Species Ayse Gul Ince & Mehmet Karaca & Ahmet Naci Onus

Published online: 15 October 2009 # Springer-Verlag 2009

Abstract Pepper (Capsicum annuum L.) is one of the most important crops in the family Solanaceae. However, the number of polymorphic molecular loci detected in this important crop is far behind that of other cultivated plant species. In the present study, a total of 45 microsatellite primer pairs were developed using Capsicum expressed sequence tags databases. Microsatellite primer pairs were tested using several species of Capsicum and several genera in the family Solanaceae including tomato, potato, eggplant, and tobacco. Results indicated that microsatellite primer pairs amplified genomic targets of C. annuum L., Capsicum baccatum L., Capsicum chacoense L., Capsicum chinense L., Capsicum frutescens L., and Capsicum pubescens Ruiz et Pavon, indicating species transferability within Capsicum. Further analyses revealed that amplicons of these primer pairs segregated 1:2:1 or 3:1 Mendelian fashions in 38 F2 individuals of pepper. It was also noted that markers derived from sequences containing dinucleotide repeats were generally more polymorphic at the intraspecific level than sequences containing trinucleotide repeats. All the microsatellite primer pairs developed in this study will be useful for marker-assisted selection and mapping studies in pepper. Keywords EST-microsatellites . Cross-amplification . Touch-down PCR Abbreviations EST Expressed sequence tag SSRs Simple sequence repeats A. G. Ince : M. Karaca (*) : A. N. Onus Faculty of Agriculture, Department of Field Crops, Akdeniz University, Antalya 07059, Turkey e-mail: [email protected]

Td-PCRs TRA 1.5

Touch-down polymerase chain reactions Tandem Repeats Analyzer 1.5

Introduction Pepper (Capsicum annuum L.) is one of the most important crops in the family Solanaceae, along with tomato, potato, eggplant, petunia, and tobacco. The production of pepper for spice, vegetable, and other uses increases every year. Pepper is annually cultivated on more than 1.7 million hectares in the world, and its production is more than 26 million tons with an average yield of 1,529.6 kg/ha (Anonymous 2007). Although, pepper is an important crop, the number of polymorphic molecular loci detected is far behind from many other cultivated plant species (Sanwen et al. 2001; Portis et al. 2007; Minamiyama et al. 2006; Ince et al. 2009). Microsatellites or also known as simple sequence repeats (SSRs) are stretches of DNA consisting of exact or inexact tandemly repeated short motifs of 1–6 bp in length. Microsatellites are ideal DNA markers since they are highly polymorphic between individuals and highly abundant dispersing evenly throughout the genomes. Microsatellites are also inherited in a codominant fashion, fast and easy to assay by polymerase chain reactions using two unique primer pairs flanking the tandem repeats called microsatellite domain. Moreover, microsatellites can serve as sequence-tagged sites for anchoring in genetic maps (Karaca et al. 2002; Minamiyama et al. 2006; Ince et al. 2009). The standard procedure for developing microsatellites involves the construction of a small-insert genomic library, the subsequent hybridization with tandemly repeated oligonucleotides and the sequencing of candidate clones,

286

thus, making the process time-consuming and laborintensive. Moreover, primer pairs flanking the genomic microsatellite domain do not cross-amplify in related species, thus, requiring separate development of primer pairs for each species under study (Saha et al. 2003; Minamiyama et al. 2006). An alternative strategy for development of microsatellite primer pairs arises from increasing information available in genomic DNA and expressed sequence tags (EST) databases using in silico studies. Due to the rapid increase in the sequence information available, the generation of ESTmicrosatellites becomes an attractive alternative to complement existing genomic microsatellite collections (Thiel et al. 2003; Portis et al. 2007; Ince et al. 2008). Last two decades witnessed dramatically increase in ESTs in a variety of organisms including pepper. For instance the number of pepper ESTs were 31,414 (Ince et al. 2008), but current number of ESTs increased to 116,924 in GenBank. However, the low level of polymorphisms and null amplicons are two main drawbacks of EST-microsatellites. Several previous studies indicated that considered amount of EST-based primer pairs produced larger amplicons, and these amplicons were not polymorphic within related genotypes or species. It is speculated that these larger products have intron(s) between the primer flanking regions, resulting in a product that is too large (Strand et al. 1997; Ku et al. 2000; Wu et al. 2006). Also a considerable amount of EST-SSR primer pairs completely failed (null amplicons) or led to the weak amplification of background signals leading to the exclusion from further analysis (Thiel et al. 2003; Guo et al. 2006; Cristancho and Escobar 2008). In the present study, we developed 45 microsatellite primer pairs and tested using several species of Capsicum and several genera in the family Solanaceae. The ratio of polymorphisms within C. annuum (intraspecific) and between several Capsicum species (interspecific) was studied and found that microsatellite primer pairs developed in this study would be extremely useful for pepper breeding and mapping studies.

Materials and Methods

Plant Mol Biol Rep (2010) 28:285–291

minimum overlap of 50 bp and 95% identity match. Sequences of contigs and singletons obtained using Sequencer software were analyzed using the Tandem Repeats Analyzer 1.5 (TRA 1.5) program (Bilgen et al. 2004) to identify microsatellite-containing sequences. Microsatellites in the present study were considered to contain motifs that were between two and six nucleotides in length. The minimum motif length criteria were defined as being six repeats for dinucleotides and five repeats for all higher-order motif length according to Thiel et al. (2003). Inexact repeats and compound repeats were determined according to Karaca et al. (2005a). Microsatellite primer pairs flanking the microsatellite domains were designed using PRIMER3 software (Rozen and Skaletsky 2000). Plant Materials Accessions of pepper and lines, and other plants used in the present study, were grown in several pots in a greenhouse under the regular agronomical conditions. Accessions consisted of BP225 (C. annuum L.), BYE6788 (C. annuum L.), Heiser 6106 (C. annuum L.), C13 (C. annuum L.), SA219 (Capsicum baccatum L.), SA426 (Capsicum chacoense L.), SA184 (C. chacoense L.), BP605 (Capsicum chinense L.), SA36 (Capsicum frutescens L.), SA218 (C. frutescens L.), and BP541 (Capsicum pubescens Ruiz et Pavon). Detailed information on Capsicum accessions used in the present study can be obtained in Ince et al. (2009). Two lines of C. annuum L. [Demre Sivrisi (DS) and PM687, (PM)], DS × PM (F1 hybrid), 38 F2 plants obtained from selfed DS × PM, a local variety of eggplant (Solanum melongena L.), tobacco (Nicotiana tabacum L.), potato (Solanum tuberosum L.), and tomato (Solanum lycopersicum L.) were also used. DNA Extraction Bulked leaf samples of three to six plants for each accession, line, and other genera were used for DNA extraction studies. Three to four leaves from each 38 F2 individual were collected, brought to the laboratory, and powdered using liquid nitrogen. DNA extraction, quality, and quantity of the extracted DNAs were performed according to Karaca et al. (2005b).

In silico Studies We used a total of 20,738 C. annuum L. ESTs consisting of 9.93 Mb from the SOL Genomics Network (Mueller et al. 2005). These ESTs had been obtained from leaf, flower bud, anther, placenta, young fruit, early root, and hairy root libraries. ESTs were assembled into contiguous sequences (contigs) using Sequencher software (Gene Codes, Ann Arbour, MI). Contig assembly parameters were set to

Amplification of Genomic DNAs Using Touch-Down Polymerase Chain Reactions Amplifications of microsatellite domains (amplicons) were performed using three types of touch-down polymerase chain reactions (Td-PCRs) which were carried out in a 25μl reaction volume containing 120 ng of genomic DNAs as templates, 0.5µM of each microsatellite primer pair (listed

Plant Mol Biol Rep (2010) 28:285–291

in Table 1), 80 mM Tris–HCl (pH8.8), 19 mM (NH4)2SO4, 0.009% Tween-20 (w/v), 0.28 mM each dNTP, 3 mM MgCl2, and 2 U of Taq DNA polymerase (Bioron). Td-PCRs were carried out in a 96-well Px2 Thermal Cycler (Thermo Hybaid) with the following three types of touch-down amplification profiles (Table 1): 3-min hold at 94°C, followed by a ten cycle of pre-PCR consisting of 20 s at 94°C for denaturing, 30 s at 60°C or 30 s at 64°C or 30 s at 66°C for annealing, and 1 min at 72°C for primer extension reaction. Annealing temperature was reduced to 0.5°C per cycle for the first ten cycles. The PCR amplification was then continued for 30 more cycles at a constant 55°C (Td-PCR type A) or 59°C (Td-PCR type B) or 61°C (Td-PCR type C) in annealing temperature, and the rest of the pre-PCR parameters were kept unchanged. At the end of the PCRs, samples were kept for 10 min at 72°C for final extension reaction. After Td-PCRs completed, 5 µl DNA-loading buffer consisting of 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol FF, and 40% (w/v) sucrose in sterile water were added to each amplified reaction, and 8–12µl of this mixture were loaded on 3%, 4%, 5% (w/v) high resolution agarose gels (Serva) containing 0.5 μg/ml ethidium bromide and electrophoresed at 5 V/cm at constant voltage for 8–12 h in the presence of 1× Tris Borate EDTA buffer consisting of 89 mM Tris–Borate, 2 mM EDTA (pH8.3). After electrophoresis, amplicons were visualized and photographed on a UV transilluminator for further analysis.

Results and Discussion A total of 20,738 C. annuum L. ESTs were assembled into 7,009 singletons (7,009 ESTs specific to a library), 896 contigs consisting of ESTs specific to a library, and 2,088 contigs consisting of ESTs from different libraries. A total of 7,905 sequences (7,009 ESTs and 896 contigs) were analyzed, and 387 microsatellites were identified. A total of 300 microsatellite primer pairs (called as AGi which is acronym formed from the initials of the first author of this study) were designed using PRIMER3 software (Rozen and Skaletsky 2000). Primer pairs for the remaining microsatellites could not be designed due to the fact that (1) microsatellite was too close to the cloning to the site of the EST, (2) calculated annealing temperature of the primer pair differed more than 1°C, and (3) the flanking sequences were not unique. Among the 300 microsatellite primer pairs, 127 were commercially synthesized, and 80 of which were used in the present study. All the 80 AGi primer pairs were tested using DS genomic DNA and DS leaf complementary DNA (cDNA; Ince and Karaca 2009) as template. Twenty AGi primer pairs produced larger products in genomic DNA templates while the size of amplicons

287

of cDNA templates was as expected based on the EST data. Sequencing analyses indicated that the size differences of amplified products between the cDNA and genomic DNA were purely due to the presence of large intron(s) within the sequences of the amplified products of genomic DNA (data not shown). Six AGi primer pairs could not amplify genomic DNA (null alleles), but they amplified cDNA template. Analyses also showed that nine AGi primer pairs amplified weak or/and many background signals. These 35 primer pairs were not useful in genetic studies of pepper, and therefore, they were not reported in the present study. Previous studies also indicated that considerable amount of EST-based primer pairs produce larger amplicons or/and completely failed or led to the weak amplification of background signals leading to the exclusion from further analysis (Thiel et al. 2003; Wu et al. 2006; Cristancho and Escobar 2008). Forty-five AGi primer pairs (listed in Table 1) amplified both cDNA and genomic DNA templates. All the primer pairs listed in Table 1 were tested for polymorphisms at intraspecific (Fig. 1 a, b, h) and at interspecific levels (Fig. 1 c, d, g). As shown in Table 1, 14 AGi microsatellite primer pairs produced polymorphic amplicons between the two closely related C. annuum L. lines. The ratio of polymorphism between these lines was 32.11% (14 out of 45). This level of polymorphism was considerably higher than found in other studies. For instance, Min et al. (2008), using microsatellite primer pairs, observed 4.3% polymorphism between two C. annuum varieties. In the present study, 34 AGi microsatellite primer pairs amplified polymorphic amplicons between DS and SA218. This corresponded to 75.55% (34 out of 45) polymorphism between Capsicum species. This interspecific polymorphism was also higher in comparison to the study of Yi et al. (2006), in which using a total of 850 microsatellite primer pairs, they reported 18.7% polymorphisms between C. annuum and C. chinense. In the present study, further investigation was undertaken to determine whether the AGi microsatellite primer pairs could amplify genomic DNAs of other species of Capsicum (Fig. 1 d, e). Results indicated that AGi microsatellite primer pairs could amplify genomic DNAs of BP225, BYE6788, C13, Heiser 6106, SA219, SA218, SA426, SA184, BP605, BP541, and SA36. The success of cross-species amplification suggested that these microsatellite primer pairs are useful for studies in a broad range of Capsicum species. For example, these primer pairs could be used in production of speciesspecific and accession-specific DNA markers and to identify genetic relationship among the other species of Capsicum (Ince et al. 2009). Relationships among species of Capsicum have not been conducted using microsatellite markers.

Forward primer (5′→3′)

TGTCCCAACTTTCACCTGCT CTTGTTGGTGAGGGTTGATTC GGTTTTGGTGGTTGTTTTCC CGGTCACTGGAACTAACAACCT TGATGCTGCTGAACTTAGAAAC GAGGCTTTTTAGCAGGGTGA CTTCATCTTCAACGCTCCTT TCACAGAACAACGGGAAAAA

GCCGTTGAGAGAGATGAGAC GCAAAAAGCGAATCCTACCA TCGTGCGTCTATTGCTCTG CAAAACTTGACCGCTTCCTC CGAGGCTTTTCTTCCCTATC TCCGACCTGTTATGGGATTT CGGGTCGTAGTCAAGAACAAG TGATGAAGGTGGTGGTGAAG CTCATCAACCCACCTTCATCA CTCACAACTTCGGCTCTT CCAATCGTCAAACAACAACCT TATCATCAGCCCTCCTCGTC CCGACCTGTTATGGGATTTC CAGTGTGCGATTTTCAACA CTTTGCTTTGTCCATTTTCG TTGGAACCGAACCCTAAT TATCGGGGAGAAACGAAA GCCGAAAGTGAAAGTTGAGC

GACTTGCTGTCGTTTGTTGG GCTGCTGGAATGGGATTG TTGGTTTCAATTTTATTTCTCCATT AGTCCTTGCCGATGTTGAAG GGGAAGAGAAATTGTGAAAGCA TTCCGAGATTGACACACTGG TTCCTTCACACCCACAACC TGAGGAGACAAACTTCAACTGG GTCCTTGCCGATGTTGAAG

Primer ID

AGi003 AGi004 AGi005 AGi007 AGi008 AGi009 AGi012 AGi015

AGi021 AGi023 AGi027 AGi029 AGi030 AGi031 AGi033 AGi038 AGi042 AGi043 AGi045 AGi048 AGi052 AGi054 AGi055 AGi056 AGi058 AGi061

AGi068 AGi069 AGI080 AGi086 AGi096 AGi098 AGi100 AGi101 AGi104

GGGAGAGAGGATAAGGATTGTG TCAGGGCAAGGATTGAAAGA GAAAGATTAAAAACCTGGGTGCT GCAGCAGCAGTTAACCATGA ATGCCAACAATGGCATCCTA AGCAACTTCAGCAGCAACC ACTTTCTTGGCTTTACCACCAG GATGAGGACAAAACCAAGGACT CAAAGCAGTGAAAAATGAGTGC

AGGGACTGACACGACCAA TGCGAAATCCATCACAAAGA TCCATCCATAACATCGGGTA CTCGGACCTTTAGAACAGCAG GCCCGTTTGATTTCTTTGA AGCGGGTTGAGAGAGTTGAG CCTCTCAACCAAGCCAAACT TGTGTGTGAAGGAGATTTAGCC TTTTCGGAGACGGAGCAG AGGCTCTTCAGCACACTT AGGAGGAGGAGGGAGAGATG CCTTACCCGTTTACCCACATC AGCGGGTTGAGAGAGTTGAG GGAGCAGAGAGGGTGAGA TCTGGTCTTCTTGGGAATCA CTTCTCGTCCCTCTTCTTCT GGGAAGGGTTATTTGCCTA GAATCCCATCCCGTCTCC

GGGGTTTTCTTCTACCTCCTGA CAGCAGAAGGCACAGGTTC GAGTTTGTGGCTGCTGACC CCAACGCTACTGATGTGTGG CTGAATCCGCCTCTGTTG GCAGACAACTTCGCATCTACA TTGCTTCACTATGCTACACACTC GGCGATAACCTTGCCTGA

Reverse primer (5′→3′)

Table 1 List of pepper microsatellite primer pairs (AGi) and related information

[TTG]8 [AT]8[TG]10 [CAT]7 [CTG]5 [CAT]7 [AGA]12 [TTC]10 [TCA]14 [CTG]13

[TTTA]4 [CAA]7 [TTTA]4 [ATCA]4 [CA]11 [AGA]7 [CAA]9 [GAAGAG]4[TGA]7 [AAC]7 [GT]10 [CAA]7 [TTC]7 [AGA]7 [TTC]7 [AAAACA]5 [AGA]9 [TA]19 [CTTCTA]4

[CTTC]4 [AT]12 [TGCAAA]4 [AATT]4 [AT]10 [GATT]5 [AAAAAT]4 [AAAG]4

Motif

60 60 60 60 60 60 60 60 60

342 379 112 180 160 274 400 122 181 399

295 285 337 327 294 284 310 344 216 250 290 280 262 294 265 268 181 215 184 251 240 230 290

165 271 281 295 306 258 248 209 165 271 190

60 60 66 60 60 60 60 60 60 60 60 60 60 60 60 60 66 60 66 60 60 64 60 60 60 60

DS (bp)

Profile

M M M P P P M P P

P M M M P M P M P M M M M M P M M M

M M M M M M M M

WS

342 379 112 185 135 275 400 122 164 395

295 285 337 327 294 284 310 354 216 240 290 280 262 289 265 268 181 215 184 256 240 230 290

165 271 281 295 306 258 248 209 165 271 190

PM (bp)

P P P P P P P P P

P P P M P P P P P P P M P P P M M M

P P P M P P P P

BS

240 165

180 285

337 374 100 170 125 280 400 130 170 385

295 347 327 284 310 338 226 250 285 275 262 282 260 273 181 225 190 262 240 225 290

165 275 285 306 380 214 265 200

SA (bp)

288 Plant Mol Biol Rep (2010) 28:285–291

Allele sizes are given in approximate base pairs

CGGTCACTGGACTCTGATGTT GTAAGGGCAAACAGCAGCAG GATGATGCTGATGGTGGAGT TAGCCTCTTCCTGTAGTTCC TGGCTTTGGAGTTGGAGTTG TGACCAAGTGACGCAAAC TGGAGACCTGAGCCATTG TATTCAGGGGAGGTGAGAAA TTATCAACTCCAAACCCCTTAG TTGACAGGAGTTGAGTAATAGATGG CTGCCCTCCTCAACCCTAA CGTAGACCGACCCACTTGTC AGGGCAAGAGTGTTAGATGTTTC CGTCTTTCACTTGTCTTTTG TGCTCTATTTATCCTTGCGAACC CGTTGAAAAGAGGAAAAAGG AACACGCCAAGAAAATCATC GACGAGGGGATTATGTAGCA GAACTGGGCTGTCCCTATCT ACTGGAAGACCAAGAGAGGTG AGi111 AGi112 AGi113 AGi115 AGi116 AGi120 AGi121 AGi124 AGi126 AGi127

Profile touch-down amplification profiles, A amplification starts at 60°C annealing, B amplification starts at 64°C annealing, C amplification starts at 66°C annealing; DS Demre Sivrisi (Capsicum annuum L.), PM PM687 (C. annuum L.), SA SA218 (Capsicum frutescens L.), WS within species (intraspecific), BS between species (interspecific), M monomorphic allele, P polymorphic allele

332 249 205 388 118 200 162 317 196 101 60 60 60 60 60 60 60 60 60 60

P M M P M M P P M M

337 249 205 396 388 118 200 170 310 196 101

P P P M M M P M M P

327 239 195 388 118 200 155 317 196 105

289

[CT]13 [ATC]16 [CAA]14 [TCA]10 [CCAAAG]4 [TTTTC]4 [CA]15 [AT]14 [TGA]22 [AT]16

DS (bp) Forward primer (5′→3′) Primer ID

Table 1 (continued)

Reverse primer (5′→3′)

Motif

Profile

WS

PM (bp)

BS

SA (bp)

Plant Mol Biol Rep (2010) 28:285–291

In order to investigate whether AGi microsatellite primer pairs could amplify genomic DNAs of several genera in the family Solanaceae, eggplant, tobacco, potato, and tomato were used. Based on randomly selected 12 AGi primer pairs, our results indicated that these primer pairs could amplify genomic DNAs of eggplant, tobacco, potato, and tomato, indicating that AGi primer pairs are useful in comparative studies and genome rearrangements in the family Solanaceae (Fig. 1 f). Further studies were undertaken to investigate whether amplicons of AGi microsatellite primer pairs segregate in the Mendelian fashion. A total of ten AGi microsatellite primer pairs were used in the amplification studies of 38 F2 individual plants obtained from selfed DS × PM F1 hybrids. Based on the chi-square values, which were not statistically significant, result indicated that the F2 individuals segregated as per the expected Mendelian ratio of 3:1 or 1:2:1 (Karaca et al. 2002). As shown in Fig. 1 h, amplicons of AGi030 primer pairs amplified alleles segregating 1:2:1 (codominant) ratio. In the present study, polymorphism at intra- and interspecific levels was also studied based on ten AGi primer pairs for dinucleotide and 22 for trinucleotide microsatellites using a total of eight templates (Table 2). Results indicated that amplicons (markers) derived from sequences containing dinucleotide repeats were generally more polymorphic at the intraspecific level than sequences containing trinucleotide repeats, while dinucleotide and trinucleotide repeats had higher level of polymorphisms at interspecific level. The higher level of polymorphism at the interspecific level found in the present study was probably due to the fact that plant materials used were very diverse (Ince et al. 2009). Further studies indicated that microsatellites with compound repeats were less polymorphic at intraspecific level but were more polymorphic at interspecific level. Results of the present study indicated that there existed a relationship between repeat number and ratio of polymorphism detected. Dinucleotide and trinucleotide microsatellites with more than ten repeat units revealed higher level of polymorphism than those with less than ten repeat units (Table 2). Based on the findings of the present study, it was suggested that researchers developing new sets of ESTs-based microsatellites should select microsatellites with higher number of repeats. Recent studies indicated that integrated map of Capsicum consisted of 805 markers (map distance of 1,858 cM) in interspecific populations and 745 markers (map distance of 1,892 cM) in intraspecific populations (Lee et al. 2009). However, the use of microsatellites in Capsicum-mapping studies is still limited; therefore, new polymorphic microsatellites reported in the present study could be used in intra- and interspecific mapping and genetic studies in Capsicum.

290

Plant Mol Biol Rep (2010) 28:285–291

Fig. 1 Touch-down PCR amplified microsatellite loci (AGi). Panel a: Lanes 1 to 4 are PCR size marker (200 bp), DS (181 bp), PM (164 bp), and DS × PM F1 hybrid (181 and 164 bp) produced with AGi101 primer pair. Panel b: Lanes 1 to 7 are amplicons of F2 individual DNAs (262, 258 and 248 bp) amplified with AGi008 primer pair. Panel c: Lanes 1 to 3 are DS (216 bp), PM (216 bp), and SA218 (226 bp) amplified with AGi031 primer pair. Panel d: Lanes 1 to 3 are DS (344 bp), PM (354 bp), and SA218 (338 bp) amplified with AGi030 primer pair. Panel e: Lanes 1 to 3 are DS (112 bp), PM (112 bp), SA218 (110 bp) amplified with AGi080, and lanes 4 to 6 are

DS (180 bp), PM (185 bp), SA218 (170 bp) amplified with AGi086 primer. Panel f: Lanes 1 to 7 are DS (181 bp), PM (164 bp), DS × PM F1 (181 and 164 bp), eggplant (162 bp), tobacco (164 bp), potato (164 bp), and tomato (162 bp) amplified with AGi101 primer pair. Panel g: Lanes 1 to 8 are BP225 (165 bp), BYE6788 (180 bp), C13 (177 bp), SA219 (174 bp), SA426 (172 bp), SA184 (170 bp), BP605 (167 bp), and SA36 (170 bp) amplified with AGi101 primer pair. Panel h: Lanes 1 to 38 are F2 individual plants showing segregating alleles of 354 and 344 bp amplified with AGi030 primer pair

Conclusion

reported low level of polymorphisms in C. annuum L., results of the present study indicated that EST-based microsatellite primer pairs produced higher level of polymorphism within and between the species of Capsicum. Most of the amplicons of the primer pairs appeared as a single copy in the genome, alleviating the multiple band problems which are common in genomic-based microsatellites. The use of microsatellite primer pairs developed in pepper genetic mapping studies will be beneficial since these amplicons

In the present study, it was confirmed that ESTs obtained from databases were a good source for the development of microsatellite primer pairs for pepper. Differing from that of the genomic DNA microsatellites, the development of ESTmicrosatellite primer pairs did not require time-consuming studies and were cheaper to develop using huge publicly available EST databases. Although several previous studies

Table 2 Comparison of dinucleotide and trinucleotide microsatellites at the intra- and interspecific level using a total of 32 primer pairs Repeat number units

Types of microsatellites Dinucleotides

Trinucleotides

PL (%)a (intraspecific)b

PL (%)a (interspecific)c

PL (%)a (intraspecific)b

PL (%)a (interspecific)c

≤10 ≥11

0 (n=3)d 57.2 (n=7)d

33.3 (n=3)d 71.4 (n=7)d

31.3 (n=6)d 50 (n=16)d

68.8 (n=6)d 83.3 n=16)d

Overall

40 (n=10)d

70 (n=10)d

31.4 (n=22)d

72.3 n=22)d

a The percent polymorphism (PL) was determined using the following formula: PL (%)=P/N×100, where P is the number of accessions or lines with at least one polymorphic marker, and N is total number of accessions or lines b Based on the amplifications patterns of Demre Sivrisi (C. annuum L.), PM687 (C. annuum L.), Heiser 6106 (C. annuum L.), and BP225 (C. annuum L.) c

Based on the amplifications patterns of SA36 (C. frutescens L.), SA219 (C. baccatum L.), SA426 (C. chacoense Hunz.), and BP541 (C. pubescens Ruiz et Pavon)

d

Number of primer pairs used

Plant Mol Biol Rep (2010) 28:285–291

are the part of functional genome, indicating that in the longer term, development of allele-specific markers for the genes controlling agronomic traits will be important for advancing the science of plant breeding. Acknowledgments This work was supported in part by the Scientific and Technological Research Council and Akdeniz University Coordination Unit of Scientific Research Projects. The authors thank two anonymous referees for contributing valuable information to this manuscript.

References Anonymous (2007) Food and Agriculture Organization of the United Nations. Available via [email protected] Bilgen M, Karaca M, Onus AN, Ince AG (2004) A software program combining sequence motif searches with keywords for finding repeats containing DNA sequences. Bioinformatics 20:3379– 3386. doi:10.1093/bioinformatics/bth410 Cristancho M, Escobar C (2008) Transferability of SSR markers from related Uredinales species to the coffee rust Hemileia vastatrix. Genet Mol Res 7:1186–1192 Guo W, Wang W, Zhou B (2006) Cross-species transferability of G. arboreum-derived EST-SSRs in the diploid species of Gossypium. Theor Appl Genet 112:1573–1581. doi:10.1007/s00122006-0261-y Ince AG, Karaca M (2009) The MAGi RNA extraction method: highly efficient and simple procedure for fresh and dry plant tissues. J Sci Food Agric 89:168–176. doi:10.1002/jsfa.3428 Ince AG, Karaca M, Bilgen M, Onus AN (2008) Digital differential display tools for mining microsatellite containing organism, organ and tissue. Plant Cell Tiss Organ Cult 94:281–290. doi:10.1007/s11240-008-9372-2 Ince AG, Karaca M, Onus AN (2009) Development and utilization of diagnostic DAMD-PCR markers for Capsicum accessions. Genet Resour Crop Evol 56:211–221. doi:10.1007/s10722-008-9356-4 Karaca M, Saha S, Jenkins JN, Zipf A, Kohel R, Stelly DM (2002) Simple sequence repeat (SSR) markers linked to the Ligon Lintless (Li1) mutant in cotton. J Hered 93:221–224 Karaca M, Bilgen M, Onus AN, Ince AG, Elmasulu SY (2005a) Exact tandem repeats analyzer (E-TRA) for DNA sequence mining. J Genet 84:49–54. doi:10.1007/BF02715889 Karaca M, Ince AG, Elmasulu SY, Onus AN, Turgut K (2005b) Coisolation of genomic and organelle DNAs from 15 genera and 31 species of plants. Anal Biochem 343:353–355. doi:10.1016/j. ab.2005.03.021 Ku HM, Vision T, Liu J, Tanksley SD (2000) Comparing sequenced segments of the tomato and Arabidopsis genomes: large-scale duplication followed by selective gene loss creates a network of

291 synteny. Proc Natl Acad Sci 97:9121–9126. doi:10.1073/ pnas.160271297 Lee HR, Bae IH, Park SW, Kim HJ, Min WK, Han JH, Kim KT, Kim BD (2009) Construction of an integrated pepper map using RFLP, SSR, CAPS, AFLP, WRKY, rRAMP, and BAC end sequences. Molecules and Cells 27:21–37. doi:10.1007/s10059009-0002-6 Min WK, Han JH, Kang WH, Lee HR, Kim BD (2008) Reverse random amplified microsatellite polymorphism reveals enhanced polymorphisms in the 3′ end of simple sequence repeats in the pepper genome. Mol Cells 26:250–257 Minamiyama Y, Tsuro M, Hirai M (2006) An SSR-based linkage map of Capsicum annuum. Mol Breeding 18:157–169. doi:10.1007/ s11032-006-9024-3 Mueller LA, Solow TH, Taylor N, Skwarecki B, Buels R, Binns J, Lin C, Wright MH, Ahrens R, Wang Y, Herbst EV, Keyder ER, Menda N, Zamir D, Tanksley SD (2005) The SOL Genomics Network: a comparative resource for Solanaceae biology and beyond. Plant Physiol 138:1310–1317. doi:10.1104/pp. 105.060707 Portis E, Nagy I, Sasvari Z, Stagel A, Barchi L, Lanteri S (2007) The design of Capsicum spp. SSR assays via analysis of in silico DNA sequence, and their potential utility for genetic mapping. Plant Sci 172:640–648. doi:10.1016/j.plantsci.2006.11.016 Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, pp 365–386 Saha S, Karaca M, Jenkins JN, Zipf AE, Reddy OUK, Pepper AE, Kantety R (2003) Simple sequence repeats as useful resources to study transcribed genes of cotton. Euphytica 130:355–364. doi:10.1023/A:1023077209170 Sanwen H, Baoxi Z, Milbourne D, Cardle L, Guimei Y, Jiazhen G (2001) Development of pepper SSR markers from sequence databases. Euphytica 117:163–167 Strand AE, Leebens-Mack J, Milligan BG (1997) Nuclear DNA-based markers for plant evolutionary biology. Mol Ecol 6:113–118. doi:10.1046/j.1365-294X.1997.00153.x Thiel T, Michalek W, Varshney RK, Graner A (2003) Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet 106:411–422. doi:10.1007/s00122-0021031-0 Wu F, Mueller LA, Crouzillat D, Pe´tiard V, Tanksley SD (2006) Combining bioinformatics and phylogenetics to identify large sets of single-copy orthologous genes (COSII) for comparative, evolutionary and systematic studies: a test case in the Euasterid plant clade. Genetics 174:1407–1420. doi:10.1534/ genetics.106.062455 Yi G, Lee JM, Lee S, Choi D, Kim BD (2006) Exploitation of pepper EST-SSRs and an SSR-based linkage map. Theor Appl Genet 114:113–130. doi:10.1007/s00122-006-0415-y