Prevalence on beef carcasses of Mycobacterium avium subsp. paratuberculosis DNA

International Journal of Food Microbiology 124 (2008) 291–294

Contents lists available at ScienceDirect

International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

Short communication

Prevalence on beef carcasses of Mycobacterium avium subsp. paratuberculosis DNA W.J. Meadus a, C.O. Gill a,⁎, P. Duff b, M. Badoni b, L. Saucier b a b

Agriculture and Agri-Food Canada, Lacombe Research Centre, 6000 C & E Trail, Lacombe, Alberta, Canada T4L 1W1 Département des sciences animals, Faculté des sciences de l'agriculture et de l'alimentation, Pavillon Paul Comtois, Université Laval, Québec, Québec, Canada G1K 7P4

A R T I C L E

I N F O

Article history: Received 29 August 2007 Received in revised form 22 February 2008 Accepted 24 March 2008 Keywords: Mycobacterium avium subsp. paratuberculosis Beef carcasses IS900 F57 Nested PCR

A B S T R A C T Fifty samples were collected from each of skinned and dressed carcasses, from each of culled beef breeding cows and fed beef cattle b18 months old at two beef packing plants A and B, and from culled dairy cows at a packing plant C. The 450 samples were collected by swabbing an area of about 1000 cm2 in the anal region of each carcass. DNA extracted from each swab was tested for the IS900 and F57 sequences of the Mycobacterium avium subsp. paratuberculosis (MAP) genome by two stage, nested polymerase chain reaction (PCR) procedures. An internal amplification control (IAC) was detected in 45 or more of each group of 50 DNA preparations. IS900 and F57 were detected in some IAC-positive preparations from all and all but one of the groups of carcasses, respectively. Of the IAC-positive preparations in each group, between 6 and 54% were positive for IS900, and between 4 and 20% were positive for F57. When preparations were tested by single stage, quantitative PCR procedures, IS900 was detected in two samples but F57 was detected in none. The MAP DNA on carcasses was probably derived from small numbers of MAP from the environment that contaminated the animals' hides. Crown Copyright © 2008 Published by Elsevier B.V. All rights reserved.

1. Introduction Mycobacterium avium subsp. paratuberculosis (MAP), a member of the Mycobacterium avium complex (MAC), is the cause of Johne's disease in cattle and other ruminants. The disease, a chronic, granulomatous enteritis, affects the functioning of the gut epithelium, which develops a characteristic corrugated appearance (Buergelt et al., 1978). Although cattle are usually infected while young, the clinical symptoms of persistent diarrhoea and weight loss appear only when animals are aged two years or more (Whitlock and Buergelt, 1996). However, many infected older animals show no symptoms of the disease (McKenna et al., 2004). The gut tissues of infected animals become heavily colonized by MAP; and faecal shedding of the organism, by subclinically infected as well as overtly diseased animals can occur (Cocito et al., 1994). The disease can become systemic, with MAP being recoverable from organs such as the liver and from lymph nodes throughout the body (Hines et al., 1987), or being detectable in blood, by examination of white blood cells as the organism proliferates within macrophages (Bhide et al., 2005). Crohn's disease in humans is a chronic inflammatory condition of the gut, with changes of the gut wall that resemble those in the guts of animals infected with Johne's disease (Chacon et al., 2004). Consequently, involvement of MAP in Crohn's disease has long been suspected. Whether or not there is some causative relationship ⁎ Corresponding author. Tel.: +1 403 782-8113; fax: +1 403 782 6120. E-mail address: [email protected] (C.O. Gill).

between MAP and Crohn's disease remains debatable. Large numbers of acid-fast MAP are certainly not present in gut tissues from Crohn's patients, but in recent years various studies have suggested that small numbers of a non-acid-fast form of MAP may be present in such tissues (Hermon-Taylor et al., 2000). Although those latter findings are not generally viewed as conclusive, it is now widely believed that exposure of humans to MAP should be minimized, as a precautionary measure (Gould et al., 2005). Humans might be exposed to MAP by consumption of milk, water or beef (Williams, 2003). There are a relatively large number of reports on the examination of milk products for the presence of MAP, and some reports on the detection of MAP in water, but there has been little investigation of the presence of MAP in meat (Grant, 2005). There is the possibility that ground beef could be contaminated with MAP if the product included meat from animals systemically infected with the organism (Manning and Collins, 2001). Perhaps more importantly, as the carcasses of all cattle are contaminated to some extent with faecal organisms transferred from the hide (Gill, 2006), contamination of the surfaces of some beef carcasses with MAP would seem inevitable. The surfaces of carcasses from uninfected as well as those from infected animals are likely to be contaminated, as faecal material containing MAP could be present on the hides of all cattle when both types of animal are held in the same facilities. Apparently, few culled cattle give carcasses that contain MAP infected tissue which may be incorporated in ground beef (Rossiter and Henning, 2001), although MAP infected herds are common (McKenna et al., 2004). Thus, it is possible that consumers of beef are more likely to be

0168-1605/$ – see front matter. Crown Copyright © 2008 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2008.03.019

292

W.J. Meadus et al. / International Journal of Food Microbiology 124 (2008) 291–294

exposed to MAP that was deposited on carcass surfaces than to MAP from infected tissue. The organism is difficult to cultivate and it grows very slowly. Consequently, for MAP to be recovered, samples from the field must be subject to decontaminating treatments to reduce the numbers of competing organisms. Decontaminating treatments will also reduce the numbers of viable MAP, perhaps by several orders of magnitude (Dundee et al., 2001). Thus, MAP that is present in samples in relatively small numbers may not be detected by cultivation. Therefore, to obtain some initial indication of the extent to which beef carcasses may be contaminated with MAP, samples from carcasses were examined by two stage, nested polymerase chain reaction (PCR) procedures, for the detection of MAP DNA. Samples positive by nested PCR were retested by single stage, quantitative PCR procedures, to obtain indication of the numbers of MAP genomes that were present in MAP DNA positive samples. 2. Materials and methods 2.1. Collection of samples Samples were obtained from carcasses at three North American beef packing plants. At plants A and B, both fed beef cattle aged less than 18 months and culled, mainly beef cows are slaughtered. At plant A the slaughtering of culled cows has been a usual practice, with batches of culled cows and fed cattle being interspersed. At plant B, the slaughtering of culled cows is a recent practice, and all culled cows are slaughtered during a single period at the beginning of the second shift each day. At plant C, only culled, mainly dairy cows are slaughtered. At each plant, on each of 5 days, 10 samples were collected from each or the sole type of carcass that was processed; after carcasses were skinned but before the pre-evisceration washing of carcasses; and after carcasses were dressed and pasteurized, with hot water at plant A or with steam at plants B and C. Samples were collected from the carcasses of fed cattle at plant A during only the first shift each day. The carcasses to be sampled at each stage of processing were selected at random from those being processed during a period of about 1 h. Thus, for each type of carcass processed at each plant, 50 carcasses were sampled after skinning, and another 50 carcasses were sampled after carcass processing was completed. A single sample was obtained from each carcass by swabbing an area of about 1000 cm2 in the anal region on one side, using a 5×5 cm2 pad of medical gauze (Curity gauze sponge; Kendall Canada , Peterborough, Ontario, Canada) moistened with 0.1% (w/v) peptone water (Difco; Becton Dickinson, Sparks, MD, USA). Each swab was placed in a 50 ml polypropylene centrifuge tube (BD Falcon; VWR International, Edmonton, Alberta, Canada), and the capped tubes were stored on ice until the samples were frozen with liquid nitrogen within 3 h of being collected. The frozen samples were stored at −18 °C until they were thawed for extraction of DNA.

2.2. Extraction of DNA Unless stated otherwise, all chemicals used for the extraction of DNA were obtained from Sigma (St. Louis, MO, USA). Each swab was boiled for 10 min with 10 ml of buffer containing 10 mM Tris–HCl and 10 mM ethylene diamine tetra-acetic acid (EDTA), pH 8.0. After cooling, 100 µl of a solution containing 50 mg lysozyme/ ml was added, and the swab and buffer were incubated at 37 °C for 30 min. Then, 8 ml of a solution containing 1 mg proteinase K/ml was added, and the swab and buffer were incubated at 65 °C for 10 min. After cooling, the buffer was supplemented with 1 ml of 10% (w/v) sodium lauryl sulphate (SDS), 1 ml of 0.5 M NaCl, 0.8 ml of 10% (w/v) hexadecyltrimethyl ammonium bromide (CTAB), and 100 µl of a solution containing 100 ng/ml of the internal amplification control (IAC) template. The IAC was made of a pCR2.1 plasmid construct (Invitrogen, Burlington, Ontario, Canada) containing a porcine LxR cDNA sequence (GenBank # AY170462; Meadus, 2003). The mixture was vortexed after the addition of each solution, and when complete was incubated at 65 °C for 10 min. After cooling, the fluid was removed using a pipette and transferred to a second centrifuge tube. To extract DNA, 2 ml of Tris–HCl saturated 10 mM phenol solution, pH 8.0: isoamyl alcohol (95:5, v/v), was added to the fluid from each swab. After mixing and heating at 90 °C for 10 min, the mixture was cooled to 20 °C and 1 ml of chloroform was added. After mixing again, the resulting mixture was centrifuged at 15,300 ×g for 5 min at 4 °C. A 5 ml portion of the upper, aqueous layer was recovered and mixed with 5 ml of isopropanol. That mixture was held at −20 °C for 30 min, then it was centrifuged at 15,300 ×g for 30 min at 4 °C. The supernatant was decanted and the pelleted nucleic acids were washed twice with 70% (v/v) ethanol at 4 °C. The final nucleic acid pellet was dissolved in 0.1 ml of buffer containing 10 mm Tris–HCl and 10 mM EDTA, pH 7.5, and stored at −20 °C. The yield of DNA was determined by electrophoresis on agarose gel and staining with ethidium bromide. 2.3. Nested PCR procedures The DNA isolated from each swab was tested for the presence of MAP DNA using nested PCR assays for the insertion sequence IS900 (Pusterla et al., 1999) and the sequence F57 (Herthnek and Bölske, 2006), based on the signals generated from dual labelled fluorogenic probes synthesized by Sigma-Proligo (St. Louis, MO, USA). PCR primers and probes were designed using the Primer 3 program (Rosen and Skalitsky, 2000). All PCR assays were performed using a multiple quantitative PCR system (Model Mx 4000; Stratagene, La Jolla, CA, USA). The first stage of the nested PCR for IS900 was performed using the primer and probe Mix A (Table 1). The IAC primers with the FAM/ BHQ1-labelled probe were used to determine the recovery rate of the IAC, and so to obtain indication of the possible presence of inhibitory substances from the heavily soiled samples. Preparations that gave a

Table 1 Sequences of oligonucleotide primes and probes used, and the expected sizes of the PCR products obtained in the nested PCR detection of Mycobacterium avium subsp. paratuberculosis Mix

PCR

Primer

Sequence (5′–3′)

Product (bp)

Reference

A

IS900 stage 1

Forward Reverse Forward Reverse Probe Forward Reverse Probe Forward Reverse Forward Reverse Probe

ATGTGGTTGCTGTGTTGGATGG CCGCCGCAATCAACTCCAG TTCCACTACAACGTGCTGAG AGGCGGATCTGTTCTTCTG FAM-ATTCTTCCGTCGCAGTCTCATCAA-BHQ1 TCGACCGCTAATTGAGAGATGC CCTCCGTAACCGTCATTGTCC CY5-CCAFCAGACGACCACGCCGACG-BHQ2 CAAGTCCTGACCACCCTTC ATCTCAGACAGTGGCGGTG CCAAACTCAGAGACCACGAG TGGTGTACCGAATGTTGTTG HEX-TGAACTCGAACACACCTGGGA-BHQ1

297

Bull et al., 2003

205

GenBank AY170462

LxR internal amplification control

B

IS900 stage 2

C

F57 stage 1

D

F57 stage 2

98

317 133

Herthnek and Bolske (2006) GenBank X70277

W.J. Meadus et al. / International Journal of Food Microbiology 124 (2008) 291–294

FAM signal N 30 cycles were discarded. The IS900 primers in Mix A were based on the AV1/AV2 primers (Bull et al., 2003) and amplified a 297 bp region of the IS900 sequence. The reaction mixture for the first stage of the IS900 nested PCR contained 2 µl of a DNA preparation, 10 µl of multiplex PCR premix (Qiagen, Mississauga Ontario, Canada), each Mix A primer at a concentration of 250 nM, 250 nM FAM/BHQ1 labelled IAC probe, and water, for a final volume of 20 µl. The reaction was started by preheating at 95 °C for 15 min for the hot start Taq polymerase in the Qiagen mix, followed by 40 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min. For the second stage of the IS900 nested PCR the reaction mixture contained 2 µl of completed first stage PCR reaction mixture, 10 µl of multiplex PCR premix, each Mix B primer (Table 1) at a concentration of 500 nM, 250 nM CY5/BHQ2 labelled probe, and water, for a final volume of 20 µl. The PCR conditions were preheating at 95 °C for 1 min, followed by 40 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min. DNA preparations in which the IS900 product was detected within 32 cycles of replication in the second stage of the nested PCR were regard as MAP positive. All samples that were positive for IS900 by nested PCR were tested for F57. The first round of PCR for F57 was performed using a reaction mixture containing 2 µl of a DNA preparation, 10 µl of multiplex PCR premix, each Mix C primer (Table 1) at a concentration of 250 nM, and water, for a final volume of 20 µl. The reaction conditions were preheating at 96 °C for 15 min, followed by 40 cycles of 96 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, with a final extension at 72 °C for 10 min. The second stage of the F57 nested PCR was performed using a reaction mixture containing 2 µl of the completed first stage PCR reaction mixture, 10 µl of multiplex PCR premix, each Mix D primer (Table 1) at a concentration of 250 nM, 500 nM DHEX/DBH1 labelled probe, and water, for a final volume of 20 µl. The reaction conditions were preheating at 95 °C for 15 min, followed by 45 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min. DNA preparations in which the F57 product was detected within 32 cycles of replication in the second stage of the nested PCR were regarded as positive for the F57 sequence. PCR DNA control reactions were run simultaneously in each realtime sample test plate. Negative control PCR tests were a water blank and Mycobacterium sp. DNA (ATCC 19015D). Acceptable positive control PCR tests were purified IAC plasmid DNA, 0.5 ng/reaction, detected at about 20 cycles; and MAP DNA, from strain ATCC BAA-968, 20 ng/reaction, detected at about 20 cycles. The products of the first and second stage PCR reactions for detection of both IS900 and F57 were sequenced. Completed reaction mixtures were cleaned using the EXOSAP-IT kit (Amersham Biosciences, Baie d'Urfé, Québec, Canada). Sequencing reactions were preformed using the Big Dye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and the sequencing reaction mixture was purified using the Dye Ex spin kit (Qiagen). Sequencing was preformed using a capillary electrophoresis machine (Model CEQ 8000; Beckman Instruments, Fullerton, CA, USA). Sequence data were confirmed using the Blast program on the NIH NCBI website (http:// www.ncbi.nlm.nih.gov/BLAST).

293

Table 2 Numbers of preparations, from 50 samples from skinned or dressed carcasses of each type processed at each of three beef packing plants, in which added Internal Amplification Control (IAC) DNA was detected by PCR, and in which IS900 and F57 DNAs were detected by nested PCR; and the percent fractions of IAC-positive preparations that were positive for IS900 and F57 Plant

Carcass type

Stage of processing

A

Culled Beef cows Fed Beef cattle Culled Beef cows Fed Beef cattle Culled Dairy cows

After skinning After dressing After skinning After dressing After skinning After dressing After skinning After dressing After skinning After dressing

B

C

DNA positive preparations

Fraction of IAC-positive preparations (%)

IAC

IS900

F57

IS900

F57

47 50 48 50 50 46 50 50 46 45

21 18 21 20 19 23 11 3 25 15

5 6 9 1 3 9 2 0 4 4

45a 36a 44a 40a 38a 50a 22b 6c 54a 33b

11b 12b 19a 2c 6c 20a 4c 0d 9b 9b

Fractions in the same column with the same letter are not significantly different (P N 0.05).

between the IS900- or F57-positive fractions of the IAC-positive DNA preparations obtained from the samples from each group of carcasses. The difference between a pair of fractions was regarded as significant when the probability of the Pearson chi-square statistic was b0.05. 3. Results

DNA preparations that were positive for IS900 by nested PCR were retested as in the first stage of the IS900 nested PCR, but with addition to the reaction mixture of the fluorogenic probe for detection of IS900. DNA preparations that were positive for F57 were similarly retested using the reaction mixture for the first stage of the F57 nested PCR supplemented with the F57 fluorogenic probe.

All water and Mycobacterium sp. DNA controls were negative for IS900 or F57 DNA. All IAC and MAP DNA controls were positive for the added DNA. The product of each stage of each nested PCR was of the expected sequence. IAC DNA was detected in 45 or more of the 50 DNA preparations obtained from the samples from each group of carcasses (Table 2). The fractions of IAC-positive preparations that were positive for IS900 by nested PCR were not significantly different (P N 0.05) for all the groups of preparations except those obtained from samples from skinned or dressed carcasses of fed beef cattle at plant B, or from dressed carcasses of culled dairy at plant C. For each of the carcasses of fed beef cattle at plant B and culled dairy cows at plant C, the fraction of IS900positive preparations obtained from dressed carcasses was significantly less (P b 0.05) than the fraction of IS900-positive preparations obtained from skinned carcasses. For all groups of preparations except those obtained from dressed carcasses of fed beef cattle at plant B, some IS900-positive preparations were also positive for F57, by nested PCR (Table 2). In groups with F57positive preparations, the fractions of IS900-positive preparations that were also positive for F57 ranged from 5 to 43%. The fraction of IACpositive preparations that was positive for F57 was not significantly different (P N 0.05) for preparations obtained from skinned or dressed culled beef cow carcasses at plant A or culled dairy cow carcasses at plant C. The fractions of F57-positive samples were significantly lower (P b 0.05) for preparations obtained from dressed than from skinned carcasses of fed beef cattle at plant A or plant C, or from dressed than from skinned carcasses of culled beef cows at plant B. With quantitative PCR, IS900 was detected in 2 preparations, but F57 was detected in neither although both were positive for F57 by nested PCR. The quantitative PCR IS900-positive preparations were obtained from a skinned culled cow and a dressed fed steer carcass at plant A. IS900 was detected after about 26 replication cycles in both preparations.

2.5. Data analysis

4. Discussion

A chi-square test for association in Minitab, release 12 (Minitab Inc., State College, PA, USA) was used to decide the significances of differences

IS900 elements, which are present at between 14 and 20 copies in the MAP genome, have generally been regarded as specific to MAP

2.4. Quantitative PCR procedures

294

W.J. Meadus et al. / International Journal of Food Microbiology 124 (2008) 291–294

(Grant et al., 2000). However, IS900-like elements have been found in the genomes of non-MAP organisms, so the presence of MAP DNA may not be certainly established by detection of IS900 (Semret et al., 2006). The F57 sequence is thought to be specific to MAP but it is present in the MAP genome as a single copy only (Tasara and Stepen, 2005). Although the similar sensitivity of PCR assays for IS900 or F57 has been reported, the sensitivities were necessarily determined using MAP suspensions in which cells were likely aggregated in clumps (Vansnick et al., 2004). If small numbers of natural contaminants are better distributed, then it would be expected that an assay for IS900 would be more sensitive than one for F57 (Ravva and Stanker, 2005). Thus, while the detection of both IS900 and F57 indicated the presence of MAP DNA in a preparation, the detection of IS900 alone indicates only its possible presence in amounts less than that required for detection of F57. That is, the fractions of F57 and IS900 positive preparations indicate, respectively, lower and maximum possible upper limits for the prevalences of MAP DNA on the carcasses. As F57 in all and IS900 in the great majority of preparations positive for those sequences were detected by nested PCR only, the amount of MAP DNA recovered from carcasses would seem to be small. That and the relatively high prevalence of MAP DNA on the carcasses of young, fed as well as of older, culled cattle indicates that most of the MAP DNA was not derived from MAP shed by the animals that gave positive IS900 tests. Instead, the MAP DNA was probably from organisms that had been present in some or all the various environments to which the animals were exposed before slaughter. Contamination of the hides or uninfected cattle with MAP from the environment might be expected, as IS900 from MAP can be detected in soils for many days after sources of the organism have been removed (Cook and Brilt, 2007). The detection of MAP DNA does not, of course, establish whether or not all the organisms from which the DNA was extracted were viable. It is possible that the initial contaminants on carcasses include nonviable cells, and the numbers of viable organisms might be reduced by the decontaminating treatments, including pasteurizing, that are applied to carcasses at all three plants (Gill and Landers, 2003). Moreover, washing of carcasses may remove or redistribute MAP as well as other bacteria (Gill et al., 2000) to produce differences in the prevalence of MAP DNA on skinned or dressed carcasses. If the amounts of MAP DNA or carcasses are indeed generally small then MAP DNA would be infrequently detected on cuts of beef, which generally include little or nothing of the original surface of the carcass, or in ground beef, in which surface contamination is diluted in the mass of uncontaminated subsurface tissue. That expectation is supported by the recently reported failure to detect MAP DNA in 200 samples of retail ground beef (Jaravata et al., 2007). The results of the study also indicate that viable MAP would be recoverable from beef carcass surfaces only infrequently, even if large areas of carcass surfaces were sampled. Further work will be needed to determine if that is in fact the case, but the limited data available as yet suggest that contamination of beef carcass surfaces with MAP may not be a major route by which humans might be exposed to the organism. Acknowledgments We thank the management of the plants involved with this study for facilitating the collection of samples from carcasses. Funding for this study was provided by the Canadian Beef Information Centre. References Bhide, M., Chakurkar, E., Tkacikova, L., Barbuddhe, S., Novak, M., Mikula, I., 2006. IS900PCR-based detection and characterization of Mycobacterium avium subsp. paratuberculosis from buffy coat of cattle and sheep. Veterinary Microbiology 112, 33–41.

Buergelt, C.D., Hall, C., McEntee, K., Duncan, J.R., 1978. Pathological evaluation of paratuberculosis in naturally infected cattle. Veterinary Pathology 15, 196–207. Bull, T.J., McMinn, E.J., Sidi-Boumedine, K., Skull, A., Durkin, D., Neild, P., Rhodes, G., Pickup, R., Hermon-Taylor, J., 2003. Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease. Journal of Clinical Microbiology 41, 2915–2923. Chacon, O., Bermudez, L.E., Barletta, R.G., 2004. Johne's disease, inflammatory bowel disease, and Mycobacterium paratuberculosis. Annual Reviews of Microbiology 58, 329–363. Cocito, C., Gilot, P., Coene, M., De Kesel, M., Poupart, P., Vannuffel, P., 1994. Paratuberculosis. Clinical Microbiology Reviews 7, 328–345. Cook, K.L., Brilt, S.J., 2007. Optimization of methods for detecting Mycobacterium avium subsp. paratuberculosis in environmental samples using quantitative, real-time PCR. Journal of Microbiological Methods 69, 154–160. Dundee, L., Grant, I.R., Ball, H.J., Rowe, M.T., 2001. Comparative evaluation of four decontamination protocols for the isolation of Mycobacterium avium subsp. paratuberculosis from milk. Letters in Applied Microbiology 33, 173–177. Gill, C.O., 2006. HACCP in the processing of fresh meat. In: Sofos, J.N. (Ed.), Improving the Safety of Fresh Meat. Woodhead Publishing, Cambridge, UK, pp. 630–672. Gill, C.O., Landers, C., 2003. Microbiological effects of carcass decontaminating treatments at four beef packing plants. Meat Science 65, 1005–1011. Gill, C.O., Bryant, J., McGinnis, C., 2000. Microbial effects of the carcass washing operations at three beef packing plants. Fleischwirtschaft International 3, 46–48. Grant, I.R., 2005. Zoonetic potential of Mycobacterium avium subsp. paratuberculosis: the current position. Journal of Applied Microbiology 98, 1282–1293. Grant, I.R., Pope, C.M., O'Riordan, L.M., Ball, H.J., Rowe, M.T., 2000. Improved detection of Mycobacterium avium subsp. paratuberculosis in milk by immunomagnetic PCR. Veterinary Microbiology 77, 369–378. Gould, G., Franken, P., Hammer, P., Mackey, B., Shanahan, F., 2005. Mycobacterium avium subsp. paratuberculosis (MAP) and the food chain. Food Protection Trends 25, 268–297. Herthnek, D., Bolske, G., 2006. New PCR systems to confirm real-time PCR detection of Mycobacterium avium subsp. paratuberculosis. BMC Microbiology 6, 87–95. Hermon-Taylor, J., Bull, T.J., Sheridan, J.M., Cheng, J., Stellakis, M.L., Sumar, N., 2000. Causation of Crohn's disease by Mycobacterium avium subspecies paratuberculosis. Canadian Journal of Gastroenterology 14, 521–539. Hines, S.A., Buergelt, C.D., Wilson, J.H., Bliss, E.L., 1987. Disseminated Mycobacterium paratuberculosis infection in a cow. Journal of the American Veterinary Medical Association 190, 681–683. Jaravanta, C.V., Smith, W.L., Rensen, G.J., Ruzante, J., Cullor, J.S., 2007. Survey of ground beef for the detection of Mycobacterium avium paratuberculosis. Foodborne Pathogens and Disease 4, 103–106. Manning, E.J.B., Collins, M.T., 2001. Mycobacterium avium subsp. paratuberculosis: pathogen, pathogenesis and diagnosis. OIE Revue Scientific et Techneque 20, 133–150. McKenna, S.L.B., Keefe, G.P., Varkema, H.W., McClure, J., VanLeeuwen, J.A., Hanna, P., Sockett, D.C., 2004. Cow level prevalence of paratuberculosis in culled dairy cows in Atlantic Canada and Maine. Journal of Dairy Science 87, 3770–3777. Meadus, W.J., 2003. A semi-quantitative RT-PCR method to measure the in vivo effect of dietary conjugated linoleic acid on porcine muscle PPAR gene expression. Biological Procedures Online 5, 20–28. Pusterla, N., Huder, J.B., Leutenegger, C.M., Braun, U., Madigan, J.E., Lutz, H., 1999. Quantitative real-time PCR for detection of members of the Ehrlichia phagocytophila genogroup in host animals and Ixodes ricinus ticks. Journal of Clinical Microbiology 37, 1329–1331. Ravva, S.V., Stanker, L.H., 2005. Real-time quantitative PCR detection of Mycobacterium avium subsp. paratuberculosis and differentiation from other mycobacteria using SYBR Green and Taq Man assays. Journal of Microbiological Methods 63, 305–317. Rossiter, C.A., Henning, W.R., 2001. Isolation of Mycobacterium paratuberculosis from thin market cows at slaughter. Journal of Animal Science 79, 113–114 supplement 1. Rozen, S., Skalitsky, H.J., 2000. Primer 3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols; Methods in Molecular Biology. Humana Press, Tokowa, N.J., pp. 365–386. Semret, M., Turenne, C.Y., Behr, M.A., 2006. Insertion sequence IS900 revisited. Journal of Clinical Microbiology 44, 1081–1083. Tasara, T., Stephan, R., 2005. Development of an F57 sequence-based real-time PCR essay for detection of Mycobacterium avium subsp. paratuberculosis in milk. Applied and Environmental Microbiology 71, 5957–5968. Vansnick, E., de Rijk, P., Vercammen, F., Geysen, D., Rigouts, L., Portaels, F., 2004. Newly developed primers for the detection of Mycobacterium avium subspecies paratuberculosis. Veterinary Microbiology 100, 197–204. Whitlock, R.H., Buergelt, C., 1996. Preclinical and clinical manifestations of paratuberculosis (including pathology). Veterinary Clinics of North America: Food Animal Practice 12, 345–356. Williams, A., 2003. Food-borne Mycobacterium avium subsp. paratuberculosis and Crohn's disease: another challenge for the food industry? Food Science and Technology 17 (2), 41–42.