Protein PknE, a novel transmembrane eukaryotic-like serine/threonine kinase from Mycobacterium tuberculosis

BBRC Biochemical and Biophysical Research Communications 308 (2003) 820–825 www.elsevier.com/locate/ybbrc

Protein PknE, a novel transmembrane eukaryotic-like serine/threonine kinase from Mycobacterium tuberculosis Virginie Molle,a,* Christine Girard-Blanc,a Laurent Kremer,b Patricia Doublet,a Alain J. Cozzone,a and Jean-Francßois Prosta b

a Institut de Biologie et Chimie des Prot eines, Universit e de Lyon, Centre National de la Recherche Scientifique, Lyon, France Laboratoire des M ecanismes Mol eculaires de la Pathog enie Microbienne, INSERM U447, Institut Pasteur de Lille/IBL, Lille, France

Received 18 July 2003

Abstract Protein PknE from Mycobacterium tuberculosis has been overproduced and purified, and its biochemical properties have been analyzed. This protein is shown to be a eukaryotic-like (Hanks’-type) protein kinase with a structural organization similar to that of membrane-bound eukaryotic sensor serine/threonine kinases. It consists of a N-terminal catalytic domain located in the cytoplasm, linked via a single transmembrane-spanning region to an extracellular C-terminal domain. The full-length enzyme, as well as the cytosolic domain alone, can autophosphorylate on serine and threonine residues. Such autokinase activity requires the presence of a lysine residue at position 45 in subdomain II, which is known to be essential also for eukaryotic kinase activity. Involvement of PknE in the transduction of external signals into the cytosol of bacteria is proposed. Ó 2003 Elsevier Inc. All rights reserved. Keywords: Protein phosphorylation; Serine/threonine protein kinase; Membrane topology; Signal transduction; Mycobacterium tuberculosis

For many years after the discovery of protein phosphorylation, catalyzed namely by serine/threonine protein kinases (STPKs), the prevailing view was that these enzymes were present only in eukaryotes [1]. However, the occurrence of similar kinases was later recognized in prokaryotes as well [2–7]. STPKs currently represent an emerging theme in prokaryotic signaling and appear to be involved in a diversity of control mechanisms [8–11]. The theoretical analysis of Mycobacterium tuberculosis genome predicts the presence of eleven different STPKs in this Gram-positive bacterium [12,13] and a recent in silico report indicates that most of them are essential for M. tuberculosis survival [14]. So far, only five of these kinases (PknA, PknB, PknD, PknF, and PknG) have been biochemically characterized [15–20], and no experimental data have been reported yet concerning their topological organization. In this work, we have analyzed the enzymatic and structural characteristics of one of the M. tuberculosis * Corresponding author. Fax : +33-4-72-72-26-01. E-mail address: [email protected] (V. Molle).

0006-291X/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved. doi:10.1016/S0006-291X(03)01476-1

kinases, PknE, which had not been studied before. After overproduction and purification, its capacity to autophosphorylate has been assessed in vitro. Then, on the basis of translational fusion experiments, its topological organization within the cell membrane has been investigated. From this, the location of its catalytic domain has been determined.

Experimental procedures Bacterial strains and growth conditions. Strains, plasmids, and primers used in this study are listed in Tables 1 and 2. Overproduction of proteins was performed in Escherichia coli BL21 (pRep4-groESL) [21]. E. coli DH5 strain [22] was used to propagate plasmids in cloning experiments. The phoA deletion strain CC118, in which the pkne::phoA fusions were expressed, was kindly provided by Beatty [23]. All strains were grown and maintained in Luria–Bertani or 2TY medium at 37 ° C. When required, media were supplemented with either 50 lg/ml ampicillin or 25 lg/ml kanamycin. DNA manipulations. Plasmids were purified by using a Qiaprep Purification Kit (Qiagen). All restriction enzymes, T4 DNA ligase, Klenow fragment, were used as recommended by the manufacturer (Promega). PCR amplifications were performed using either the Pfu polymerase or the HotStar DNA polymerase, purchased from

V. Molle et al. / Biochemical and Biophysical Research Communications 308 (2003) 820–825

821

Table 1 Oligonucleotides used in this study Primer

50 to 30 sequencea

Pho1 (+) Pho2 ()) Pho3 ()) Pho4 ()) Pho5 ()) Pho6 ()) 18 (+) 19 ()) 30 ()) Oligo K45M ())

TATCCCAAGCTTATGGATGGCACCGCGGAATCGCGGGAGGGTAC TATGGATCCCGCGGTGCGGGCCTCGCGCTGCATACG TATGGATCCGGTCAAGCACTC TATGGATCCTGACCGGGGCAGCGGAGACGACGG TATGGATCCAGATGACCGCCACGG TATGGATCCCGGCGTACCGCTGGCATTGAAGCC TATCCCGGGCACCGCGGAATCGCGGG TATGAATTCCTACCCGATCAGCCTCGCGAGCCAG TATGAATTCTGGCGGGCTGACCGGGGCAGCGG GTCTCCGACATCAGCATTAGTGCCACGATCCG

a

Restriction sites are italicized.

Table 2 Bacterial strains and plasmids used in this study Strain or plasmid

Genotype or description

Reference or source

JM109 BL21(pRep4-groESL) CC118 pUC19-phoA pGEX-KT pGEX-pknE pGEX-cytNT

recA1 supE44 endA1 hsdR17 gyrA96 relA1 thiD(lac-proAB) F 0 [traD36proABþ laclq lacZDM15]  F dcm omp T hsdS(r B mB ) gal k[pRep4GroESL] araD139 D(ara leu)7697 DlacX74 phoAD20 galE galK thi rps rpoB argEam recA1 PhoA-fusion vector Expression vector generating GST fusion proteins Expression vector generating PknE in fusion with GST Expression vector generating Cyt-NT in fusion with GST

[33] [21] [23] [34] From Qiagen This study This study

Promega and Qiagen, respectively. PCR products and plasmid DNA fragments were purified using the QiaexII kit (Qiagen). Oligonucleotides were provided by Sigma–Genosys. Transformation of E. coli cells was performed following the method previously described [24]. DNA sequencing was carried out by Genome-Express. Nucleotide sequence of all synthesized and mutated genes was verified to ensure error-free amplifications and proper base replacements. Construction of plasmids expressing wild or mutated PknE protein. The pknE gene (Rv 1743) was amplified by PCR from genomic DNA of M. tuberculosis H37Rv using oligonucleotide primers pairs 18/19 (Table 1) deduced from the genome sequence [12]. The amplified DNA product of pknE was cloned into pGEX-KT vector. The resulting plasmid, designated pGEX-pknE (Table 2), was used to transform E. coli BL21 (pRep4-groESL). The DNA region corresponding to the N-terminal extremity of PknE (Cyt-NT), was amplified by PCR in the same conditions as those described above using oligonucleotide primer pairs 18/30 (Table 1), and was cloned into pGEX-KT vector. The resulting plasmid, designated pGEX-cyt-NT (Table 2), was used to transform E. coli BL21 (pRep4-groESL). Site-directed mutagenesis. Site-directed mutagenesis was carried out based on PCR amplification. The strategy consisted in creating substitutions of an individual residue in PknE or Cyt-NT proteins. For PknE single mutants, a first set of PCR amplification was performed using pGEX-pknE as a template (Table 1) along with the primer pair 18/K45 (Table 2) to generate pknE-K45 DNA primers. This primer was then used in a second round of PCR amplification in combination with primer 19, to generate the entire 1651-bp pknE gene. For the Cyt-NT domain mutant, a similar procedure was applied using pGEX-cyt-NT as template (Table 1) with primer pairs 18/K45, to generate pknE-K45 DNA primers. This primer was then used in a second set of PCR amplification, in combination with primer 30, thus generating the DNA fragment corresponding to the Cyt-NT domain. These two different DNA fragments, which correspond respectively to the entire gene and to the 50 extremity of pknE, were cloned into pGEX-KT vector. The resulting plasmids were termed pGEX-pknE-K45 and pGEX-cyt-NT-K45, respectively (Table 1).

Expression and purification of PknE. The purification procedure was the same for each protein and mutant. An overnight cell culture was used to inoculate 200 ml of 2TY medium supplemented with ampicillin, and incubated at 37 °C under shaking until the A600 reached 0.6. IPTG was then added at a final concentration of 2 mM, and growth was continued for 3 h at 37 °C under shaking. Cells were harvested by centrifugation at 6000g for 10 min, washed in 10 ml of buffer A (50 mM Tris–HCl, pH 7.5; 150 mM NaCl; 10% glycerol; 1 mM EDTA; and 1 mM aprotinin), and centrifuged again in the same conditions. The cell pellet was resuspended in buffer A containing deoxyribonuclease I (DNase I) and ribonuclease A (RNase A) at a final concentration of 5 lg/ml each, 10 lM leupeptin, and 6 lM pepstatin. Cells were disrupted in a French pressure cell at 16,000 lb/in.2 (psi). The resulting suspension was centrifuged at 4 °C for 30 min at 30,000g. The supernatant was incubated for 5 h with glutathione–Sepharose 4B matrix (Pharmacia Biotech), suitable for purification of glutathione S-transferase (GST) fusion proteins. The protein–resin complex was packed into a column for washing and elution. The column was washed with 50 ml PBS (phosphate buffer saline). Protein elution was carried out with buffer B (50 mM Tris–HCl, pH 8.0; 5 mM MgCl2 ; and 1 mM DTT) containing 15 mM glutathione. Eluted fraction were analyzed by sodium dodecyl sulfate–polyacrylamide gel (SDS–PAGE) [25]. Fractions containing purified chimeric proteins were stored at )20 °C. Construction of pknE::phoA and pknE::lacZ translational fusions. To construct a series of translational fusions of the PknE gene fragments to the phoA gene expressing a truncated alkaline phosphatase lacking its leader peptide (PhoA), PCR products were prepared by using a forward primer for 50 pknE gene (Pho1), paired with five different downstream reverse primers (Pho2 to Pho6) complementary to various codons within the pknE gene (Table 1). Genomic DNA from M. tuberculosis H37Rv strain was used as template. The amplified fragments were cloned into pUC19-phoA, and the resulting plasmids containing different pknE::phoA fusions were transformed into the phoA E. coli strain CC118 (Table 2) in order to measure alkaline phosphatase activity. The alkaline phosphatase assays were then performed as previously described [26].

822

V. Molle et al. / Biochemical and Biophysical Research Communications 308 (2003) 820–825

In vitro kinase assay. In vitro phosphorylation of PknE or Cyt-NT was carried out for 15 min at 37 °C in a reaction mixture (20 ll) containing buffer P (25 mM Tris–HCl, pH 7.0; 1 mM DTT; 5 mM MgCl2 ; and 1 mM EDTA) with 200 lCi/ml [c-32 P]ATP. The reaction was stopped by addition of an equal volume of 2 sample buffer and the mixture was heated at 100 °C for 5 min. One-dimensional gel electrophoresis was performed as described by Laemmli [25]. After electrophoresis, gels were soaked in 16% TCA for 10 min at 90 °C, and dried. Radioactive proteins were visualized by autoradiography using direct exposure films. When needed, radioactivity was measured with a Molecular Dynamics Typhoon phosphoimager. Phosphoamino acid analysis of the labeled protein reaction products of the in vitro protein kinase reactions was performed as previously described [27].

this is due to the different phosphorylated forms of the enzyme. On the other hand another diffuse band was detected around 67 kDa (Fig. 1B, lane 2) due, in this case, to some cleavage of the entire protein occurring during the lysis of E. coli. Indeed, mass spectrometry analysis (MALDI-TOF) of this truncated form of PknE indicated that it corresponded to the putative cytosolic region of PknE fused with the GST. Since PknE contains a hydrophobic region located within the membrane, these observations suggested that its extracytoplasmic C-terminal domain (30 kDa) was presumably cleaved by periplasmic proteases during expression in E. coli, in agreement with the previous observation made for PknD [15].

Results and discussion Protein kinase activity of PknE Overproduction and purification of PknE In a first series of experiments, protein PknE was overproduced in fusion with GST, then purified by using a glutathione–Sepharose 4B matrix, analyzed by SDS– PAGE electrophoresis (Fig. 1B), and characterized by anti-GST Western blotting (data not shown). The electrophoregram presented in Fig. 1B (lane 2) revealed the presence of a diffuse band around 97 kDa. A similar diffuse migration was previously observed for PknD, another STPK described in M. tuberculosis [15], and for Pkn9 and Pkn6, two other STPKs described in Myxococcus xanthus [3,28]. It was shown that, in each case,

The pknE gene encodes a 566-aminoacid protein, with a calculated molecular mass of 60,511 Da and an estimated pI of 5.52. The analysis of the predicted primary structure of this protein indicated that it seemed to harbor all essential amino acids and sequence subdomains (Fig. 1A) that are characteristic of the Hanks’ family of eukaryotic-like protein kinases [29,30]. These include the central core of the catalytic loop, consisting of subdomain VI (corresponding to 139DVKPEN144 ) and the invariant residue K45 in the consensus motif within subdomain II, which is usually involved in the phosphotransfer reaction and also required for the

Fig. 1. (A) Schematic presentation of the main PknE domains. M.tuberculosis gene pknE encodes a membrane protein with a single transmembrane helix. The N-terminal domain of PknE exhibits all essential amino acids and sequence subdomains that are characteristic of the Hanks’ family of eukaryotic-like protein kinases. (B) The GST-PknE, and GST-PknE-K45A proteins were overproduced, purified on glutathione–Sepharose 4B matrix, submitted to gel electrophoresis and stained with Coomassie blue (lanes 2 and 3, respectively). In vitro phosphorylation assays on GST-PknE, and GST-PknE-K45A were performed with [c-32 P]ATP for 15 min, proteins were analyzed by SDS–PAGE and radioactive bands were revealed by autoradiography (lanes 4 and 5, respectively). Reference proteins of known molecular mass were run in parallel (lane 1). (C) Phosphoamino acid pattern of GST-PknE after two-dimensional separation.

V. Molle et al. / Biochemical and Biophysical Research Communications 308 (2003) 820–825

autophosphorylating activity of eukaryotic STPKs (Fig. 1A). From this theoretical analysis, an attempt was therefore made to demonstrate that PknE was actually an eukaryotic-like STPK. For this, the entire protein was incubated in vitro with [c-32 P]ATP and the extent of its labeling was analyzed. The corresponding autoradiogram (Fig. 1B, lane 4) showed that PknE could effectively incorporate phosphate from [c-32 P]ATP, and give rise to a radioactive signal at about 97 kDa, a size similar to that expected for GST-PknE, thus indicating that PknE was able to autophosphorylate in vitro. In addition, another radioactive band at approximately 67 kDa, possibly corresponding to the truncated N-terminal region of PknE, was also detected. This finding suggested that either (i) the N-terminal region of PknE as well as the complete enzyme were each able to undergo autokinase activity, or (ii) PknE was able to autophosphorylate and also to phosphorylate its N-terminal region through an intermolecular reaction. Before trying to decide between these two possibilities (see below), control experiments were performed to determine whether the phosphorylation of GST-PknE resulted from an autokinase activity, or from a contaminating phosphorylating activity, namely present in the E. coli cells used for overproducing the enzyme. For that purpose, we mutated the well-characterized catalytic domain residue K45 (Fig. 1A), which is the invariant amino acid of subdomain II involved in the phosphotransfer reaction [31]. The mutated form GSTPknE-K45M was purified from E. coli by using the same procedure as for the wild-type protein (Fig. 1B, lane 3), and assayed for autophosphorylation in the presence of [c-32 P]ATP. No intense radioactive signal was then detected (Fig. 1B, lane 5), thus showing that the phosphorylation of the enzyme was due to the intrinsic kinase activity of PknH rather than to a contaminating activity. Together, these data indicated that pknE encodes a functional enzyme capable of phosphorylating itself in vitro through an autocatalytic process, and that this kinase shares common features with eukaryotic STPKs. To investigate further the biochemical characteristics of PknE, the nature of the amino acid residues phosphorylated in this protein was determined. GST-PknE was labeled in vitro with [c-32 P]ATP, then separated by SDS–PAGE, excised, and subjected to acid hydrolysis. By such treatment, only acid-resistant phosphoamino acids were analyzed since a number of other phosphorylated residues, such as phosphohistidine, phosphoarginine and phosphoaspartate are known to be labile in acid. The corresponding autoradiogram (Fig. 1C) showed that GST-PknE was phosphorylated on serine and threonine residues, but not on tyrosine. This result confirmed that PknE belongs to the STPK family of M. tuberculosis, and is able to autophosphorylate on both types of residues.

823

PknE contains a transmembrane domain To obtain further information on the structural organization of PknE, the hydropathic profile of the protein deduced from its amino acid sequence was determined [32]. This analysis revealed the presence of a unique short hydrophobic domain, located between amino acids V340 and A359 , suggesting that it could correspond to a transmembrane spanning a-helix and constitute an anchor in the membrane. The membrane topology of PknE was analyzed by using an experimental approach based on translational fusions of pknE with the E. coli gene phoA expressing a truncated alkaline phosphatase lacking its leader peptide (PhoA). Alkaline phosphatase, which requires the formation of disulfide bonds for activity, exhibits its enzymatic activity exclusively when present in the periplasm. Fusion proteins were produced from fragments either immediately preceding the transmembrane (TM) region or encompassing the TM region with flanking sequences at both sides. Two levels of activity were observed: strains expressing pknE::phoA constructs with fusion sites located before the putative transmembrane helix of PknE (G69 , T210 , and S332 ) exhibited PhoA activities of only about 4 units, in the same range as the background PhoA activity of the CC118 (pUC19-DphoA) strain. By contrast, the strains carrying fusion sites located after the hypothetical TM (G366 , P544 ), displayed about 250 units. These results demonstrated that PknE is a transmembrane protein with its C-terminal region (H360 -G566 ) downstream of the TM helix in the periplasm space and its N-terminal domain (M1 –W339 ) upstream of the TM helix in the cytoplasm (Fig. 2). Moreover, these structural domains are connected by a unique transmembrane a-helix located

Fig. 2. Schematic presentation of the membrane topology of PknE. The different amino acids on which translational fusions pknE::phoA were performed are indicated by single letter code and number. The alkaline phosphatase activity, as expressed in total units, is presented in each case in a circle close to the relevant amino acid.

824

V. Molle et al. / Biochemical and Biophysical Research Communications 308 (2003) 820–825

between V340 –A359 . The topology of this membranespanning protein is consistent with that of proteins acting as signaling molecules between the cell exterior and interior, and thus confirms that PknE can be classified as an eukaryotic-like protein receptor. Overproduction and purification of the cytoplasmic domain of PknE The data obtained from kinase activity measurement (see above) and those arising from membrane topology analysis concurred in suggesting that the N-terminal cytosolic domain of PknE was functionally independent and could undergo kinase activity as well as the fulllength enzyme. In order to check this point, we overproduced and purified the cytosolic region of PknE that includes the kinase core and the juxtamembrane linker, corresponding to residues M1 to Q335 . The electrophoregrams shown in Fig. 3A (lanes 2 and 3) revealed the presence of a major band of about 67 kDa consistent with the molecular mass predicted for the cytoplasmic domain of PknE linked to the fused GST protein. Protein kinase activity of the cytosolic domain of PknE To demonstrate that the cytosolic region of PknE was able, alone, to undergo autokinase activity, the GST-Cyt-NT and the GST-Cyt-NT-K45M proteins were separetely incubated in vitro in the presence of [c-32 P]ATP. The corresponding autoradiograms (Fig. 3A, lanes 4 and 5) showed that the cytosolic domain of PknE could actively incorporate phosphate from [c-32 P]ATP, and give rise to a radioactive signal at 67 kDa, consistent with the size of this peptide (lane 4). By contrast, the GST-Cyt-NT-K45M mutant protein fragment was unable to autophosphorylate in vitro (lane 5). It therefore appeared that the cytosolic domain of PknE could exhibit the same autokinase activity as the whole enzyme, and, consequently, represents a func-

tionally independent domain. The nature of the amino acid residues phosphorylated in this domain was determined by performing phosphoamino acid analysis on the recombinant protein, as described above for the whole enzyme. The autoradiograms presented in Fig. 3B indicated that the GST-Cyt-NT protein was phosphorylated on serine and threonine residues, like the whole enzyme. This result confirmed that the N-terminal fragment of PknE, from M1 to Q335 , is functionally independent and constitute the catalytic domain of the protein. Interestingly, such structural organization in two main fragments is consistent with that of eukaryotic receptors. However, it must be noted that, in contrast to PknE, the catalytic domain of the eukaryotic kinases pertains to the C-terminal; not the N-terminal, region of the enzymes. Moreover, these data indicated that the labeling of the cleaved fragment during the PknE phosphorylation assay (Fig. 1B, lane 4) was due to an autokinase activity of this peptide (67 kDa) rather than to its phosphorylation by the whole enzyme. In conclusion, the present data concerning PknE activity, membrane topology, and domain organization, indicate that this enzyme is a membrane-associated kinase which can be considered as a membrane receptor connecting the external environment of bacteria with the cell cytosol. One can speculate that the C-terminal segment of PknE could form, outside the cell, a peptidic structure acting as a bacterial sensor and transducing extracellular signals via its protein kinase domain to internal substrate(s). The existence of such protein receptor in M. tuberculosis would suggest that PknE, like other STPKs, could play a general role in sensing different environmental modifications, especially during infection of macrophages by bacteria, and in generating various responses allowing physiological adaptation of cells. Further experiments are now required to assess the plausibility of this hypothesis and, namely, to characterize the effectors that would modulate such signal transduction process.

Fig. 3. (A) The GST-Cyt-NT and GST-Cyt-NT-K45A proteins were overproduced, purified on glutathione–Sepharose 4B matrix, submitted to gel electrophoresis, and stained with Coomassie blue (lanes 2 and 3, respectively). In vitro phosphorylation assays of GST-Cyt-NT, and GST-Cyt-NTK45A were performed with [c-32 P]ATP for 15 min, proteins were analyzed by SDS–PAGE, and radioactive bands were revealed by autoradiography (lanes 4 and 5, respectively). Reference proteins of known molecular mass were run in parallel (lane 1). (B) Phosphoamino acid pattern of GST-PknECyt-NT after two-dimensional separation.

V. Molle et al. / Biochemical and Biophysical Research Communications 308 (2003) 820–825

Acknowledgments This work was supported by grants from the Ministere de la Recherche (Contract FNS 2000 Microbiologie), the Fondation pour la Recherche Medicale, the Societe Ezus-Lyon 1 (Contract 482.022), the Institut Universitaire de France, and INSERM.

References [1] E.G. Krebs, E.H. Fischer, The phosphorylase b to a converting enzyme of rabbit skeletal muscle, Biochim. Biophys. Acta 1000 (1989) 302–309. [2] A. Matsumoto, S.K. Hong, H. Ishizuka, S. Horinouchi, T. Beppu, Phosphorylation of the AfsR protein involved in secondary metabolism in Streptomyces species by a eukaryotic-type protein kinase, Gene 146 (1994) 47–56. [3] W. Zhang, M. Inouye, S. Inouye, Reciprocal regulation of the differentiation of Myxococcus xanthus by Pkn5 and Pkn6, eukaryotic-like Ser/Thr protein kinases, Mol. Microbiol. 20 (1996) 435–447. [4] C.J. Leonard, L. Aravind, E.V. Koonin, Novel families of putative protein kinases in bacteria and archaea: evolution of the “eukaryotic” protein kinase superfamily, Genome Res. 8 (1998) 1038–1047. [5] C.C. Zhang, L. Libs, Cloning and characterisation of the pknD gene encoding an eukaryotic-type protein kinase in the cyanobacterium Anabaena sp. PCC7120, Mol. Gen. Genet. 258 (1998) 26–33. [6] S.T. Motley, S. Lory, Functional characterization of a serine/ threonine protein kinase of Pseudomonas aeruginosa, Infect. Immun. 67 (1999) 5386–5394. [7] E. Madec, A. Laszkiewicz, A. Iwanicki, M. Obuchowski, S. Seror, Characterization of a membrane-linked Ser/Thr protein kinase in Bacillus subtilis, implicated in developmental processes, Mol. Microbiol. 46 (2002) 571–586. [8] S. Inouye, R. Jain, T. Ueki, H. Nariya, C.Y. Xu, M.Y. Hsu, B.A. Fernandez-Luque, J. Munoz-Dorado, E. Farez-Vidal, M. Inouye, A large family of eukaryotic-like protein Ser/Thr kinases of Myxococcus xanthus, a developmental bacterium, Microb. Comp. Genomics 5 (2000) 103–120. [9] C.J. Bakal, J.E. Davies, No longer an exclusive club: eukaryotic signalling domains in bacteria, Trends Cell. Biol. 10 (2000) 32–38. [10] T. Umeyama, P.C. Lee, S. Horinouchi, Protein serine/threonine kinases in signal transduction for secondary metabolism and morphogenesis in Streptomyces, Appl. Microbiol. Biotechnol. 59 (2002) 419–425. [11] H. Nariya, S. Inouye, Activation of 6-phosphofructokinase via phosphorylation by Pkn4, a protein Ser/Thr kinase of Myxococcus xanthus, Mol. Microbiol. 46 (2002) 1353–1366. [12] S.T. Cole, R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S.V. Gordon, K. Eiglmeier, S. Gas, C.E. Barry 3rd, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B.G. Barrell, et al., Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence, Nature 393 (1998) 537–544. [13] Y. Av-Gay, M. Everett, The eukaryotic-like Ser/Thr protein kinases of Mycobacterium tuberculosis, Trends Microbiol. 8 (2000) 238–244. [14] G. Lamichhane, M. Zignol, N.J. Blades, D.E. Geiman, A. Dougherty, J. Grosset, K.W. Broman, W.R. Bishai, A postgenomic method for predicting essential genes at subsaturation levels of mutagenesis: application to Mycobacterium tuberculosis, Proc. Natl. Acad. Sci. USA (2003). [15] P. Peirs, L. De Wit, M. Braibant, K. Huygen, J. Content, A serine/ threonine protein kinase from Mycobacterium tuberculosis, Eur. J. Biochem. 244 (1997) 604–612.

825

[16] Y. Av-Gay, S. Jamil, S.J. Drews, Expression and characterization of the Mycobacterium tuberculosis serine/threonine protein kinase PknB, Infect. Immun. 67 (1999) 5676–5682. [17] A. Koul, A. Choidas, A.K. Tyagi, K. Drlica, Y. Singh, A. Ullrich, Serine/threonine protein kinases PknF and PknG of Mycobacterium tuberculosis: characterization and localization, Microbiology 147 (2001) 2307–2314. [18] R. Chaba, M. Raje, P.K. Chakraborti, Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division, Eur. J. Biochem. 269 (2002) 1078–1085. [19] M. Ortiz-Lombardia, F. Pompeo, B. Boitel, P.M. Alzari, Crystal structure of the catalytic domain of the PknB serine/threonine kinase from Mycobacterium tuberculosis, J. Biol. Chem. 278 (2003) 13094–13100. [20] T.A. Young, B. Delagoutte, J.A. Endrizzi, A.M. Falick, T. Alber, Structure of Mycobacterium tuberculosis PknB supports a universal activation mechanism for Ser/Thr protein kinases, Nat. Struct. Biol. 10 (2003) 168–174. [21] K.E. Amrein, B. Takacs, M. Stieger, J. Molnos, N.A. Flint, P. Burn, Purification and characterization of recombinant human p50csk protein- tyrosine kinase from an Escherichia coli expression system overproducing the bacterial chaperones GroES and GroEL, Proc. Natl. Acad. Sci. USA 92 (1995) 1048–1052. [22] D. Hanahan, Studies on transformation of Escherichia coli with plasmids, J. Mol. Biol. 166 (1983) 557–580. [23] H.N. LeBlanc, J.T. Beatty, Topological analysis of the Rhodobacter capsulatus PucC protein and effects of C-terminal deletions on light-harvesting complex II, J. Bacteriol. 178 (1996) 4801–4806. [24] M. Dagert, S.D. Ehrlich, Prolonged incubation in calcium chloride improves the competence of Escherichia coli cells, Gene 6 (1979) 23–28. [25] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [26] C. Manoil, Analysis of membrane protein topology using alkaline phosphatase and beta-galactosidase gene fusions, Methods Cell Biol. 34 (1991) 61–75. [27] C. Grangeasse, P. Doublet, E. Vaganay, C. Vincent, G. Deleage, B. Duclos, A.J. Cozzone, Characterization of a bacterial gene encoding an autophosphorylating protein tyrosine kinase, Gene 204 (1997) 259–265. [28] W.A. Hanlon, M. Inouye, S. Inouye, Pkn9, a Ser/Thr protein kinase involved in the development of Myxococcus xanthus, Mol. Microbiol. 23 (1997) 459–471. [29] S.K. Hanks, A.M. Quinn, T. Hunter, The protein kinase family: conserved features and deduced phylogeny of the catalytic domains, Science 241 (1988) 42–52. [30] S.K. Hanks, T. Hunter, Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification, FASEB J. 9 (1995) 576–596. [31] A.C. Carrera, K. Alexandrov, T.M. Roberts, The conserved lysine of the catalytic domain of protein kinases is actively involved in the phosphotransfer reaction and not required for anchoring ATP, Proc. Natl. Acad. Sci. USA 90 (1993) 442–446. [32] J. Kyte, R.F. Doolittle, A simple method for displaying the hydropathic character of a protein, J. Mol. Biol. 157 (1982) 105–132. [33] C. Yanisch-Perron, J. Vieira, J. Messing, Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors, Gene 33 (1985) 103–119. [34] P. Doublet, C. Grangeasse, B. Obadia, E. Vaganay, A.J. Cozzone, Structural organization of the protein-tyrosine autokinase Wzc within Escherichia coli cells, J. Biol. Chem. 277 (2002) 37339–37348.