PU.1 but not Ets-2 is essential for macrophage development from embryonic stem cells

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only.

1996 88: 2917-2926

PU.1 but not ets-2 is essential for macrophage development from embryonic stem cells GW Henkel, SR McKercher, H Yamamoto, KL Anderson, RG Oshima and RA Maki

Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only.

PU.l But Not Ets-2 Is Essential for Macrophage Development From Embryonic Stem Cells By Gregory W. Henkel, Scott R. McKercher, Hideyuki Yamamoto, Karen L. Anderson, Robert G. Oshima, and Richard A. Maki Transcription factors play an important role choreographing lineage commitment and expansion of blood cells. Nuclear factors that are expressed primarily or exclusively in hematopoietic cells are likely candidates for regulating blood cell development. The transcription factor PU.l is found only in hematopoietic cells, whereas ets-2, a related family member, is ubiquitously expressed. To compare the role of these two transcription factors in macrophage development, embryonic stem (ES) cells with a homozygous disruption of either the PU.l or the ets-2 gene were generated. The ability of both knockout ES cells to differentiate to macrophages was tested. Normal development of macrophages, as deter-

mined by histochemical and immunohistochemical analysis, from PU.l knockout ES cells was significantly blocked. Furthermore, the expression of known markers associated with macrophages, such as c-fms, CDllb, CD18 and granulocytemacrophage colony-stimulating factor receptor, were not detected by reverse transcriptase-polymerase chain reaction. In contrast to the PU.l knockout ES cells, macrophage development from the ets-2 knockout ES cells was normal. Although both PU.l and ets-2 are found in macrophages, these data show a distinct role for the lineage-restricted PU.l transcription factor in macrophage development. 0 1996 by The American Society of Hematology.

H

its high abundance in developing tissues, it has been proposed that ets-2, similar to c-fos and c-myc, may be important in regulating mitosis.’* In resting T cells, levels of ets-2 mRNA were found to be low.2oHowever, on activation of T cells by either cross-linking the T-cell receptor or with the addition of phorbol ester and ionomycin, ets-2 mRNA and protein increased. In macrophages, ets-2 mRNA and protein were also increased when the cells were stimulated with growth factors, lipopolysaccharide (LPS), and phorbol esters2’ Therefore, in both cell types, there is evidence to suggest that ets-2 is involved in activation and proliferation. PU. 1, a distantly related member of the ets family of DNA binding factors, has a restricted expression among cells of the hematopoietic lineage. Cells that express PU. 1 include B cells, macrophages, mast cells, neutrophils, and early erythroblasts.22-2’In addition, PU. 1 has been proposed to regulate several genes within these lineage^.^^.^' The restricted expression of PU.l suggests that this factor may be important in the development and/or growth of these various lineages. There have been studies showing a role for PU.l in hematopoietic development. During in vitro differentiation of an enriched population of human multipotential CD34+ cells, it was shown that PU.l expression increased as the cells committed to the myeloid lineage, whereas low but constant levels of PU.l expression were observed during erythroid development.28Furthermore, the addition of double-stranded oligonucleotides to cultures of CD34+ cells containing a PU. 1 binding site led to a reduction in the number of myeloid and erythroid colonies generated in colony-forming

EMATOPOIESIS is an ongoing process that involves the differentiation, expansion, and maturation of various types of blood cells. A continuous balance between death and replenishment of the various hematopoietic lineages is maintained by a small population of pluripotent stem cells.’,2 Stem cells are capable of both self-renewal and the production of daughter cells that commit to differentiation and expansion. During differentiation, specific sets of genes are activated that determine the blood cell phenotype. However, the master control switches that regulate this highly orchestrated developmental process are poorly understood. Nuclear factors that are restricted to specific lineages or to early precursor cells are potential candidates for regulating lineage commitment and development of hematopoietic cell^.^.^ Because cells express a large number of transcription factors, it is difficult to assess the role of one nuclear factor among the many. A tool that has been used to study individual gene products has been to disrupt or knockout the expression of a gene of interest to determine its function. Recently, this approach has been used to generate knockout mice to several genes encoding transcription factors thought to be important for hematopoietic de~elopment.’.’~ From these experiments, new insights into the role that specific transcription factors play in lineage commitment, maturation, and proliferation of multipotential precursor cells have been obtained. Since the discovery of the v-ets gene in the E26 avian retrovirus, there have been a growing number of ets-related gene sequences isolated from mammalian cell^.'^^'^ Members of the ets family are related by a high degree of sequence identity within the DNA binding domain (ETS domain).I6 Ets proteins bind to DNA sequences that contain a consensus core motif of GGA.I5 In general, the ets DNA binding proteins function as transcriptional activators and have been implicated in growth control, transformation, and development of lymphocytes.14,’’ The expression of some ets family members is restricted to cells of the hematopoietic lineage. The prototypic ets family member, ets-1, is expressed primarily in T and B cells.” In contrast, ets-2 is expressed in both hematopoietic and nonhematopoietic cells.” Furthermore, ets-2 mRNA can be found in all organs of both fetal and adult mice.” Based on temporal expression patterns in regenerating liver tissue and

Blood, Vol 88, No 8 (October 15), 1996: pp 2917-2926

From the Burnham Institute, La Jolla Cancer Research Foundation, La Jolla, CA. Submitted March 15, 1996; accepted June IO, 1996. Supported by the National Institutes of Health Grants No. A130656 (R.A.M.) and CA42302 (R.G.O.). Address reprint requests to Richard A. Maki, PhD, Burnham Institute, 1090I N Torrey Pines Rd, La Jolla, CA 92037. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with I8 U.S.C. section 1734 solely to indicate this fact. 0 1996 by The American Society of Hematology. 0006-4971/96/8808-0044$3.00/0

2917

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. 2918

HENKEL ET AL

A Wild type PU.l

P /

0

0

0

PU.l targeting construct

WK"

R

W3'920

+

d

Targeted PU.l t

0.Neo.l

B B

K

6

xh

K

Wild type Ets-2

ETSKO 2a-2

I RB

Targeted Ets-2 d

C

NeoSa Neo3b

assays. Recently, the PU.l gene has been disrupted in vivo.29 The PU.l null phenotype in these mice was embryonic lethal at around 16 to 18 days of gestation. Analysis of the embryos indicated that the mice lacked mature macrophages, granulocytes, B cells, and T cells. The development of early erythroblasts was unaffected, but there was a reduction in the level of mature erythrocytes. It was concluded that the lack of PU.l expression resulted in a defect in a multipotent progenitor important for myeloid and lymphoid development. We have also generated PU.l knockout mice (McKercher et al, manuscript in press). In contrast to the previous report, our mice were born but died 48 hours later due to severe septicemia. We were able to keep these mice alive for up to 2 weeks on a broadspectrum antibiotic. During this time, double- and single-positive CD4/CD8 T cells were found in the thymus and the periphery. Some neutrophil production took place during this time, but no mature macrophages or B cells were detected. Based on these results, we concluded that disruption of the PU.l gene allowed for lineage commitment but not expansion and maturation of several different cell types within the population of hematopoietic cells. It is unknown whether the lack of macrophage production in the PU.l knockout mouse was due to extrinsic andor intrinsic deficiencies. To further understand the role PU.l plays in macrophage development, embryonic stem (ES) cells with the PU.l gene disrupted were generated. ES cells are a totipotent cell line. Under the appropriate conditions,

Fig 1. Targeted disruption of both the PU.l and ets-2 DNA binding domain in ES cells. Recombination strategy for targeting the disruption of either (A) PU.l or (B) ets-2 DNA binding domains. The neo gene was inserted in the reverse orientation into the PU.l targeting vector. PCR primers to identify integration of the targeting constructs into either gene are indicated with small arrows. Neo, neomycin gene; Tk, thymidine kinase gene; R, €&I; Sa, Sac I; Bs, 6ssHll; CI, C/a I; SI, Sa/ I; B, 6amHI; K, Kpn I; Xh, Xho I.

these cells can differentiate toward myeloid and erythroid lineages3' Because PU.l and ets-2 are both expressed in macrophages and can bind to similar DNA recognition sequences, it is unclear if they have overlapping or distinct functions in the development of this lineage. For example, both PU. 1 and ets-2 have been implicated in regulating expression of the macrophage colony-stimulating factor (M-CSF) receptor (cf m s ) . " c-fms and its ligand are important for controlling macrophage d e ~ e l o p m e n tFurthermore, .~~ ets-2 may be involved in mediating mitogenic signals from ligand activated c - f m ~To . ~evaluate ~ the role of ets-2 in macrophage development, we also generated ES cells in which the ets-2 gene was disrupted. Therefore, the ability of PU.l and ets-2 double knockout ES cells to produce macrophages in vitro was evaluated. Our conclusion from these studies is that the loss of PU.l but not ets-2 in ES cells results in a block in the development of mature macrophages and that this defect is likely due to loss of factor(s) intrinsic to cells within the macrophage lineage. MATERIALS AND METHODS Cells. ES cells, E14TG2a (E14)34and D3jm p47 (D3),35were maintained in Dulbecco's modified Eagle's medium (DMEM) that

included 15% heat-inactivated fetal bovine serum, 50 mmoVL 0mercaptoethanol, and leukemia-inhibitory factor (LIF). The source of LIF was conditioned media from a Chinese hamster ovary (CHO)

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. THE ROLE OF PU.l IN MACROPHAGE DEVELOPMENT

C

2919

PU.1

M

bp

+I+

+I-

4-

1375 1

-

1170 bp

947

I

980 bp

D bD

872 603

Ets-2 M

+I+

+I-

4-

-Ne0 (737bP)

310 194

-

Ets-2

(166bP)

Fig 1 (cont'dl. PCR genotype analysis of (Cl PU.l and (Dl ets-2 single and double knockout ES clones. The wild-type PU.1 and ets2 genes generate a PCR product at 1,170 and 166 bp, respectively. The targeted PU.l allele gives a PCR band at 980 bp. The recombinationof the targeting vector into the ets-2 gene results in a loss of the 166bp PCR band and the appearance of a neo PCR product.

cell line stably transfected with the LIF cDNA and kindly provided by Genetics Institute Inc (Cambridge, MA). Generation of PW.1 and Ets-2 double knockorit ES cells. A 6kb EcoRl genomic fragment in pBluescript KS+ (Stratagene, La Jolla, CA) containing exons 3, 4, and 5 of the mouse PU.1 gene was used as the source for the targeting construct. The final targeting construct shown in Fig IA was created by excising two Sac I fragments and leaving behind a 3-kb genomic fragment that included part of exon 4, all of exon 5 , and part of the 3' untranslated region. The HSV-tk-neo gene (1.2 kb) from pMCl neopolyA26was bluntend ligated in the antisense direction into a BssHII site found within

exon 5. The HSV-tk gene from plC-IgR/MCl.tkJ7 was inserted into a Cla I-Sal I site in the multiple cloning region at the 3' end of the vector. Both the E14 and D3 ES cell lines were transfected by electroporation with this targeting construct. Forty micrograms of linear vector was electroporated into 5 x IO7 cells with a Transfector 100 (BTX, San Diego, CA) power source set at 250 V and 5 milliseconds. A BamHI-Xbu I fragment from the mouse ets-2 cDNA was used to screen 1.4 X IO6 plaques from a Lambda FIX11 library (Stratagene) for the full-length gene. Hybridization conditions were 6X SSC, 0.05X BLOTTO (1 X BLOTTO is 5% nonfat dried milk with 0.02% sodium azide) at 68°C ovemight. The blots were washed in 0% SSC and 0.1% sodium dodecyl sulfate (SDS) at 65°C. Four positive clones were isolated. From one of the clones, an 8.4-kb BomHIl EcoRI fragment was isolated and used for constructing an ets-2 targeting vector. The 8.4-kb fragment was subcloned into pHSG399." A 3.1-kb Kpn I fragment that included sequences coding for the DNA binding domain was removed and the remaining vector was religated. The truncated genomic fragment was subcloned into the pUC18 vector. The HSV-tk-neo gene from pMCIneopoly'6 was blunt-end ligated into the Kpn I site and the HSV-tk gene from PIClgR/MCI .tk3' was blunt-end ligated at the BumHI site upstream of where the neo gene was inserted. The ets-2 targeting vector (ETSKO 2a-2; Fig 1B) was transfected into the D3 ES cell line by electroporation. The transfected cells were grown in media containing 150 mgl mL of G418 and 300 mg/mL of gancyclovir. Individual G418lgancyclovir-resistant colonies were collected and expanded. To generate double knockout cell lines of either PU.1 or ets-2, the single knockout ES clones were cultured in higher concentrations of G418. Colonies that grew in 6 mg/mL of G418 were collected and expanded. Disruption of the PU. 1 or ets-2 alleles was verified by Southem blot and polymerase chain reaction (PCR) assays. Three different primers were used to screen for PU. I single and double knockouts by PCR: PUKO5' (5' GCCCCGGATGTGCTTCCCTATCAAACC 3'), which is located in the fourth exon just 5' of the Sac I site; PU3'920 (5' TGCCTCGGCCCTGGGAATGTC 3'). which is located in the 3' untranslated region of the targeting construct; and O.neo.1 (5' CGCACGGGTGTTGGGTCGTG'ITCGG 3'). which is located in the neo gene. The PCR reaction was performed in a 25 mL final reaction volume with 1 X PCR buffer (GIBCO BRL, Gaithersburg, MD), 1.5 mmolL MgCI?, 5% dimethyl sulfoxide (DMSO), 0.2 mmol/L dNTP mix, 200 ng of each primer, and I U of Tu9 polymerase (GIBCO BRL). The temperature cycling conditions were as follows: 95°C for 1 minute, 63°C for 2 minutes, and 72°C for 3 minutes for 30 cycles. Two sets of primers were used to screen for the ets-2 single and double knockouts. One set of primers was to an intronic portion of the ets-2 gene, located between sequences coding for the DNA binding domain: HKI (5' AGCCAGTCTCTGTGCCTCAG3') and HK2 (5' TGCTTTGGTCAATAGGAGCC 3'). The second set of primers was located within the neo gene: Neo5'a (5' GTGGAGAGGCTA'ITCGGCTA 3') and Neo3'b (5' TCAAGAAGGCGATAGAAGGC 3'). Genomic DNA was isolated from the cells and digested with EcoRI. The PCR reaction was performed in a final reaction volume of 25 mL with I X PCR buffer (Perkin Elmer, Norwalk, CT), 6% glycerol, 1 mg SSB (US Biochemicals, Cleveland, OH), 0.25 mmoll L dNTP mix, 100 ng of each primer, and 2.5 U of Tu9 Polymerase (Perkin Elmer). Temperature cycling was as follows: 94°C for 0.5 minutes, 55°C for 1 minute, and 72°C for 0.75 minutes for 25 cycles. In vitro differentiation. ES cells were induced to differentiate following protocols as described.'".'" Briefly, to initiate differentiation and the formation of embryoid bodies (EB), 500 undifferentiated ES cells were plated on 35-mmpetri dishes (Falcon; Becton Dickin-

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. 2920

HENKEL ET AL

son, Franklin Lakes, NJ) in Iscoves modified Dulbeccos’s media (IMDM), 1% methylcellulose, and 15%heat-inactivated fetal bovine serum. For the ets-2-/- ES cells, 2,000 cells were plated for EB development. After 7 days of differentiation, EBs were collected and dispersed with trypsin and equivalent numbers of cells were replated in IMDM/methylcellulose mix including 20% WEHI-3 cell conditioned media (as a source of IL-3) and SO ng/mL of mouse recombinant M-CSF (R & D Systems, Minneapolis, MN). A method for generating macrophages reported by Wiles4” was also used in this study. Instead of dispersing the EBs in trypsin, 10 to 15 whole EBs were isolated and plated on 60” tissue culture dishes (Falcon) in IMDM with 20% L-cell conditioned media as a source of M-CSF. Histochemical and immunohistochemical staining. ES cells differentiated under macrophage-promoting conditions were collected, spun onto slides with a cytocentrifuge, and stained with WrightGiemsa (Sigma, St Louis, MO). For F4/80 immunohistochemical staining, slides were initially incubated with a primary rat monoclonal antibody to the murine F4/80 surface marker (Biosource, Camarillo, CA). To visualize FLM8O-positive cells, immunoperoxidase staining was performed with the Vectastain Elite ABC and 3.3Diaminobenzidine (DAB) staining kits from Vector Laboratories (Burlingame, CA). After the peroxidase reaction, the cells were counterstained with Gill’s hematoxylin (Sigma). Revuse transcriptase-PCR(RT-PCR)analysis. Total RNA was collected from differentiated cells using RNAZOL (Biotecx, Houston, TX). One to two micrograms of total RNA was reverse transcribed using 200 U of Superscript Reverse Transcriptase (GIBCO BRL) according to the manufacturer’sprotocol. For PCR analysis, equivalent amounts of input cDNA were amplified with 2.5 U of Taq polymerase (GIBCO BRL), 10 mg/mL of each primer, 1 X PCR buffer, 1.5 mmol/L MgCll, 5% DMSO, and 0.2 mmol/L dNTPs in a 20 mL total reaction volume. Temperature cycling was as follows: 95°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes for 40 cycles. PCR primers were constructed from published sequences using Genbank or from previously published manuscripts. Primers for PCR include the following: c-fms“, sense 5’ GCGATGTGTGAGCAATGGCAGT 3’ and antisense 5’ AGACCGT7TTGCGTAAGACCTG 3’; CDI Ib, sense 5’ TATAACAGCCAAGTCTGCGG 3’ and antisense 5’ AGGAGGACACCAATCAGTACG 3’; CDI 8, sense 5’ CCTACTCCATGCTTGATGACC 3’ and antisense 5’ TCTGTACGCCATCACAGTCC 3‘; granulocyte-macrophage colony-stimulating factor receptor-a (GM-CSFR-a):’ sense 5‘ CCACGGAGGTCACAAGGTCAAGG 3’ and antisense 5’ GTCGTCGGACACCTTGTCCCTGATC 3 ’ ; a n d ets-2, sense 5’ CCAGATGCTGTGTAACCTCG 3’ and antisense 5’ TTCTGTATCAGGCTGGACGC 3’; and 0-actin:’ sense 5’ ATGCCATCCTGCGTCTGGACCTGGC 3’ and antisense 5’ AGCATITGCGGTGCACGATGGAGGG 3’. RESULTS

Colony-forming unit-macrophage (CFU-M) precursors were detected from differentiated ets-2 but not PU. I double knockout ES cells. In vitro differentiation of ES cells can produce cells of the myeloid and erythroid lineages. To study the roles of both PU. 1 and ets-2 in macrophage development, several knockout clones for each gene were derived in ES cells (see the Materials and Methods). The constructs used for homologous recombination into either the PU.l or ets-2 gene are shown in Fig 1A and B, respectively. Exons coding for the DNA binding domain of each gene were targeted for disruption. Successful recombination of the targeting con-

structs into one or both alleles of PU.l or ets-2 was determined by Southem blot (data not shown) and by PCR (Fig 1C and D). A combination of three primers for PCR were used to determine the insertion of the neo gene in the fifth exon of the PU.l gene (see the Materials and Methods). The 1,170-bp PCR product represents a portion of the wild-type PU.1 gene including the fifth exon, and the 980-bp PCR product shows the recombination of the neo gene in this exon (Fig 1C). Two sets of PCR primers were used to determine the disruption of the ets-2 gene. As shown in Fig ID, a 166-bp PCR product represents part of the wild-type ets2 gene within the targeted region. Recombination of the neo gene into both alleles of ets-2 resulted in a loss of this PCR product (Fig 1D). The other set of primers made to DNA sequences in the neo gene produced a PCR product of 737 bp (Fig ID). PU.l double knockout clones ( P U . l P ) were derived in both D3 and E14 ES cell lines and ets-2 double knockout clones (ets-2-’-) were generated in the D3 ES cell line. There were no apparent differences among the normal, PU.1, and ets-2 knockout ES cells in terms of growth or morphology. The results from one of the PU.1 clones in the D3 ES cell line are presented here. Four PU. 1 clones were evaluated in the experiments that follow and gave similar results. In vitro colony forming assays were performed to determine if macrophage progenitors could be generated from wild-type, PU.l-’-, and ets-2-’- ES cells. ES cells remain undifferentiated in the presence of LIF. To initiate differentiation, the various ES cell lines were placed in methylcellulose without LIF for several days, which leads to the formation of EBs.’~,~’ The EBs were collected, dispersed into a single-cell suspension, and replated in methylcellulose with growth factors to promote the development of macrophage colonies. After replating equivalent numbers of cells from EBs under macrophage colony-forming conditions, it was observed that macrophage colonies could be generated from the ets-2-j- ES cells (Table 1). In contrast to the ets-2 ES cells, PU. 1 ES cells were unable to produce macrophage colonies (Table 1). However, disruption of a single PU.1 allele in ES cells had no effect on these cells to generate macrophage colonies (Table I). In contrast to macrophage development, both the PU.l+ and ets-2 ES cells were able to generate erythroid colonies (data not shown). Therefore, the PU. 1 ES cells were not defective in differentiating toward another cell type of the hematopoietic lineage. Furthermore, the data from the colony-forming assays with PU. 1 -deficient ES cells is consistent, with regards to macrophage and erythroid development, to what was observed in the PU.1 knockout micez9 (McKercher et al, manuscript in press). Nonnul macrophage development from PU. 1 knockout ES cells was not detected in liquid cultures. Although there were no macrophage colonies detected from PU.1 ES cells, it was possible that a low number of macrophages might be produced that would not be measured by the colony-forming assay. We used another approach to determine if low numbers of macrophages were being produced from PU. 1 ES cells. Ten to 15 EBs (from day 7) were collected

’

+

-’

+

+

+

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. THE ROLE OF PU.l IN MACROPHAGE DEVELOPMENT

2921

Fig 2. Wright-Giemsa staining of differentiated normal and PU.1 knockout ES cells. Bone marrow-derivedmacrophages (BMM)and dfferentiated ES cells were collected from cultures containing 20% L-cell conditioned media. (AI BMM; (61differentiated wild-type D3 ES cells (+/+I; (C and E) differentiated PU.l+’- D3 ES cells (+/-I; and (D and F) differentiated PU.1-’- D3 ES cells were stained by Wright-Giemsa and photographed with a Zeiss Axioskop microscope. (A) through (D) were filmed through a 4Ox objective and (E)and (F) were filmed through a lOOx objective.

and plated in liquid media with L-cell conditioned media as a source of M-CSF. After 2 days, the EBs attached to the plate and began forming a monolayer of cells. Three or 4 days later, some of the attached EBs from both the wild-

Fig 4. F4/80 staining of PU.l single and double knockout differentiated ES cells from liquid cultures. (AI PU.l+’- and (SI PU.l-’- D3 ES cells were differentiated in liquid culture with 20% L-cell conditioned media and collected for immunohistochemical analysis with a monoclonal antibody to the F4/80 macrophage surface antigen. A biotinavidin immunoperoxidase staining kit was used to identify F4/ 80-positive cells (F4/80-positive cells stain brown). Cells were counterstained with Gills hematoxylin.

type and PU.l+’- ES cells produced large round light reftactive cells that eventually migrated throughout the plate, forming individual adherent colonies. These large bright cells and the adherent colonies had a morphology similar to bone marrow-derived macrophages grown under similar conditions. After 8 days, the cells were harvested and stained by Wright-Giemsa. As a control, bone marrow-derived macro-

Fig 5. Ets-2-’- differentiatedcells are F4/80-positive. (A) Wild-type (ets-2+’+)and (Bl ets-2-’- ES cells were differentiated in liquid culture with 20% L-cell conditioned media and collected for F4/80 staining (as described in Fig 4).

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. 2922

phages were also stained. Macrophages are usually large, irregularly shaped cells, with the nucleus eccentrically placed.- The nucleus is round or kidney shaped, with one or two nucleoli. The cytoplasm is fairly extensive and contains many vacuoles. Examination of the Wright-Giemsastained slides showed that the majority of the cells from both the differentiated wild-type and PU.l+’- ES cells had a similar morphology to the bone marrow-derived macrophages (Fig 2A through C and E). In contrast to both wildtype and PU.l+/- EBs, clumps of dead cells were observed on the monolayer of cells that formed once the PU.1-’- EBs attached to the dish. A few light refractive cells that looked like macrophages were observed; however, there were no adherent macrophage colonies. When the differentiated PU. 1-/- cells were harvested and stained by Wright-Giemsa, the majority of the cells appeared distinct from macrophages, but some cells (5% to 10%) on the slide had a morphology that was similar to that of macrophages (Fig 2D and F). To determine if the macrophage-like cells derived from the PU. 1-’- ES cells expressed markers associated with this lineage, total RNA was isolated from the differentiated cells for RT-PCR analysis. Both the differentiated wild-type and PU.1”- cells were found to express c-fms, CDllb, CD18, and GM-CSFR-a. There was little to no detectable expression of these macrophage markers observed from the differentiated PU.l-/- cells (Fig 3A). The levels of RNA for RT-PCR analysis were equivalent, as determined semiquantitatively by comparing the amount of a @-actinPCR product generated from differentiated wild-type, PU. 1 single and double knockout cells (Fig 3A). The promoter regions that control expression of c-fms, CD1 lb, CD18, and GM-CSFR-a have been shown to contain an ets binding site that is recognized by PU. 1.45-49 However, it is possible that other ets family members expressed in macrophages could also interact with the ets binding sites found in these promoters. To determine if ets-2 may be important in regulating expression of these macrophage markers, RNA was isolated from the ets-2-l- macrophage colonies for RT-PCR analysis. In contrast to PU. 1 differentiated cells, the ets-2-l- macrophages were found to express all of the markers examined (Fig 3B). RT-PCR was also performed to determine whether transcription through the neo gene and the PU.l DNA binding domain might occur from the PU.1 transgene. The primers flanking the neo gene and the PU.l DNA binding domain used in the genotyping of the PU.l-’- ES cells were used in this analysis (Fig 1). PU.l message was detected in differentiated wild-type, PU.l+/-, and ets-2-l- cells and, as expected, no PU. 1 transcript was detected from the differentiated PU.1-I- cells (Fig 3A and B). Likewise, no ets-2 message could be found by RT-PCR in the ets-2-/- macrophages (Fig 3B). F4/80 is a surface antigen found on mature macrophage^.^" To further characterize these macrophage-like cells derived from the PU. 1 ES cells, a monoclonal antibody to F4/80 was used to stain the cells (see the Materials and Methods). F4/80-positive cells from liquid cultures of differentiated PU. 1+/- ES cells were easily detected (Fig 4A). In addition,

HENKEL ET AL Table 1. Macrophage Colony A r a y s Generated From Normal, PU.1. and a s - 2 Knockout ES Cells

D3 PU.l+’. PU.l-’ets-2-j ~

Exp 1

Exp 2

19 2 1.7 16 2 2.5 0 42 f 4.2

27 5 8.7

ND 0 29 2 3.8

EBs were dispersed into a single cell suspension. Twenty thousand cells were plated in methylcellulose plus 50 ng/mL rM-CSF and 20% WEHI-3 CM. Colonies were scored 8 days later. All values are the means of triplicate determinations f S.D. Abbreviation: ND. not determined.

macrophages produced from ets-2-’- ES cells in liquid cultures also expressed the F4/80 antigen (Fig 5B). In contrast, there were no F4BO-positive cells detected from liquid cultures of differentiated PU.1-/- ES cells (Fig 4B). Occasionally, under these liquid culture conditions, a rare F4BO-positive cell was detected from PU. 1 differentiated cells. However, in general, the macrophage-like cells generated from PU.l-/- ES cells lacked expression of many of the characteristic markers associated with this lineage. We conclude, therefore, that normal macrophage development from ES cells appears to be blocked in the absence of PU. 1 expression but not in the absence of ets-2 expression. DISCUSSION

How a multipotential cell commits to a single lineage is a central question in understanding the mechanism of hematopoiesis and development in general. In this study, we showed in vitro that the loss of expression of the transcription factor PU. 1 in ES cells blocked normal macrophage development. Furthermore, the lack of macrophage development was observed from several independently derived PU. 1 double knockout ES cell lines. The expression of one PU.1 allele, on the other hand, was sufficient for normal production of macrophages. Although macrophage colonies did not form in vitro, there were a few cells with a macrophage-like morphology that did develop from PU.l knockout ES cells in liquid culture. However, these macrophage-like cells did not express a number of the appropriate markers associated with macrophages, including c-fms, CDllb, CD18, and GMCSFR-a, and, except for the rare cell, they did not express F4/80. In contrast to PU. 1, macrophage development from ets2-l- ES cells appeared to be normal based on the production of macrophage colonies, morphology, and expression of surface markers. Furthermore, although ets-2 mRNA was detected in differentiated PU. l-/- cells, this did not compensate for the lack of PU.l expression to promote normal macrophage development. Clearly, these results show distinct functions of PU.l and ets-2 in macrophage development. Although ets-2 has been implicated as a nuclear mediator of mitogenic signals from the c-fms receptor,33it appears not to be critical for macrophage development regulated by cf m s and its ligand. It is possible that, during macrophage development, other ets family members may compensate for

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. THE ROLE OF PU.l IN MACROPHAGE DEVELOPMENT

2923

B

A

c-fms

CD11b

Fig 3. RT-PCR analysis for genes associated with cells of the macrophage lineage. Total RNA was isolated from (A) wildtype (D31, PU.l+’-, and PU.l-/and from (Bl ets9-’- cells differentiated under macrophage promoting conditions in liquid culture. The primers used for PCR are described in the Materials and Methods. The PU.l primers PUKO-5’ and PU3’920 that were used for genotyping the PU.1 knockout clones were also used for RT-PCR analysis. All amplifications were performed for 40 cvcles.

GM-CSF Receptor

254 bp

ets-2

994 bp

the role of ets-2 in the c-fms signaling pathway. Further work is needed to determine if the function andor activation capabilities of the ets-2-’- macrophages are normal. How the function of PU. 1 and ets-2 is differentially regulated to control the genetic profile of macrophages is unknown. One possible means of regulation may be in the DNA recognition sequence within individual promoters. Although ets family members recognize a common GGA DNA binding motif, flanking sequences that vary in different gene promoter elements have been shown to influence binding specificity among the ets family members”.” (Klemsz and Maki, unpublished results). An example showing the speci-

0 El

530 bp

807 bp

CD18

PU.1

p Actin

341 bp

605 bp

ets-2

m

570 bp

994 bp

p Actin ficity of PU.1 binding showed that PU.1, but not ets-2, etsI , elf-I, or tli-1. bound to an ets site located in the CDI Ib promoter.” Another possibility is that distinct signaling networks may differentially regulate the function of PU.1 and ets-2 in macrophages. There have been several studies showing that ets-2 is a downstream effector of the Ras signaling pathWay..?~.s2.s~ Recently, a Ras-mediated phosphorylation of a threonine residue in the N-terminus of ets-2 was identified.5’ Furthermore, phosphorylation of this site was shown to be important for Ras-induced superactivation of ets-2transactivating function. In a similar set of experiments, we were unable to detect Ras-mediated superactivation of PU. I -

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. 2924

transactivating function (unpublished results). However, phosphorylation of the serine 148 residue of PU. 1 by casein kinase I1 was shown to be necessary for protein-protein interaction with NF-EM5.54The ternary complex of PU.l, NFEM5, and DNA is important for regulating the ~ 3enhancer ‘ in B ~ e l l s .It~is~ not , ~ known ~ if phosphorylation of this site is important for PU.l function in macrophages. What role PU. 1 is playing in macrophage development is unknown at this time. Results from the differentiation of PU. 1-I-ES cells in liquid culture showed that, during differentiation, many cells die. However, a small number of cells have a macrophage-like morphology and, infrequently, a cell with this phenotype is F4BO-positive. This finding suggests that commitment to the myeloid lineage may be occurring, but that survival and/or proliferation of these cells is blocked. The same type of role has been proposed for GATA-2 in regulating the expansion of early hematopoietic cells.’ Consistent with the potential role of PU.l in regulating the survival and/or expansion of myeloid progenitors is the finding that in our mice in which the PU. 1 gene has been disrupted, extremely rare F4/80-positive cells were observed in the liver and thymus and very low numbers of neutrophils were consistently detected in the blood (McKercher et al, manuscript in press). Neutrophils have also been produced from in vitro cultures of PU.1-/- neonate liver cells and, infrequently, a sparse number of F4/80-positive cells were detected from these cultures (K. Anderson, unpublished results). The presence of neutrophils and the rare F4/80positive cell suggests that PU.1 may not regulate lineage commitment, as previously predicted.” In further corroboration of this hypothesis, a report recently published while this manuscript was in preparation showed that lack of PU.l does not block expression of genes associated with early myelop~iesis.~~ There is some evidence to support a role for PU.l in regulating proliferation. In a recent study, in situ immunohistochemistry showed PU. 1 expression in myeloid lineages from normal bone marrow.” Interestingly, it was noted that mitotic cells contained higher levels of PU. 1 protein in their nucleus than did nondividing cells. In another study, transfection of an antisense PU. 1 expression construct or the addition of antisense PU.l oligonucleotides to bone marrow macrophages reduced M-CSF-induced proliferation of these cells.58 Finally, because the in vitro environment was not sufficient to support normal development of macrophages from PU.l-’- ES cells, we conclude that the loss of PU.l results in an intrinsic defect that inhibits normal macrophage development. Although PU.l may be regulating many genes within the macrophage lineage, one possible molecular mechanism that could explain the lack of macrophage development and would be intrinsic to this lineage may be a reduction or a loss in the expression of the c-fms receptor. c-fms protein expression has been found in the early stages of macrophage development and increases as these cells matUre.28.32.59 M-CSF, the ligand for c-fms, has been shown to be important for promoting growth and survival of macrophages.m“’Furthermore, in the op/op mouse, loss of M-CSF expression resulted in a severe deficiency of macrophages

HENKEL ET AL

in neonate^.^"^^ In the same study that used antisense PU.1 to inhibit M-CSF-induced proliferation of bone marrow macrophages, it was found that there was a correlative decrease in the expression of c - f m ~ . ’ Therefore, ~ lack of c-fms expression could be detrimental to macrophage development. The promoter region regulating expression of the cf m s gene contains a PU.l binding site that has been shown to be important for promoter activity?’ There was little to no c-jns mRNA detected from the population of differentiated PU.l knockout ES cells generated from the liquid cultures. The lack of detectable c-fms expression may be a result of no monocytic/macrophage precursors produced from differentiated PU.l-’- ES cells or that these precursors exist but they do not express c-fms. Experiments are under way to express constitutively c-fms in the PU. 1 knockout ES cells and to determine if expression of this receptor will help rescue macrophage development. ACKNOWLEDGMENT

We thank Dr Gordon Keller and Marion Kennedy for their protocol and technical advice on ES cell differentiation; Dr Helene Baribault for her advice in generating knockout ES cell lines; Michelle Butler for her technical support; Cynthia Ortiz for her help with generating some of the figures; and Drs Deborah Vestal, Paul ConIon, and Diane Mochizuki for critical reading of the manuscript. REFERENCES

1. Momson SJ, Uchida N, Weissman IL: The biology of hematopoietic stem cells. Annu Rev Cell Dev Biol 11:35, 1995 2. Ogawa M: Differentiation and proliferation of hematopoietic stem cells. Blood 81:2844, 1993 3. Orkin S: Transcription factors and hematopoietic development. J Biol Chem 270:4955, 1995 4. Kehrl JH: Hematopoietic lineage commitment: Role of transcription factors. Stem Cells 13:223, 1995 5. Tsai S, Martin DIK, Zon LI, D’Andrea AD, Wong GG, Orkin SH: Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339:446, 1989 6. Mucenski ML, McLain K, Kier AB, Swerdlow SH, Schreiner CM, Miller TA, Pietryga DW, Scott WJ Jr, Potter SS: A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65:677, 1991 7. Pevny L, Simon MC, Robertson E, Klein WH, Tsai SF, D’Agati V, Orkin SH, Costantini F: Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-I. Nature 349:257, 1991 8. Tsai FY, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt M, Alt F W ,Orkin SH: An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature 371:221, 1994 9. Georgopoulos K, Bigby M, Wang J, Molnar A, Wu P, Winandy S, Sharpe A: The Ikaros gene is required for the development of all lymphoid lineages. Cell 79:143, 1994 10. Zhuang Y, Soriano P, Weintraub H: The helix-loop-helix gene E2A is required for B cell formation. Cell 792375, 1994 11. Bain G , Maandag ECR, Izon DJ, Amsen D, Kruisbeek DM, Weintraub BC, JSrop I, Schlissel MS, Feeney AJ, van Roon M, van der Valk M, te Riele HPJ, Berns A, Murre C: E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 79385, 1994 12. Sun X: Constitutive expression of the Id1 gene impairs mouse B cell development. Cell 79:893, 1994

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. THE ROLE

OF PU.l IN MACROPHAGE DEVELOPMENT

13. Urbanek P, Wang A, Fetka I, Wagner EF, Busslinger M: Complete block of early B cell differentiation and altered patteming of the posterior midbrain in mice lacking pax5BSAP. Cell 79:901, 1994 14. Hromas R, Klemsz M: The ETS oncogene family development, proliferation and neoplasia. Int J Hematol 59:257, 1994 15. Wasylyk B, Hahn SL, Giovane A: The Ets family of transcription factors. Eur J Biochem 211:7, 1993 16. Karim MJ, Umess LK, Thummel CS, Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA, Gunther CV, Nye JA, Graves BJ: The ETS-domain: A new DNA binding motif that recognizes a purine-rich core DNA sequence. Genes Dev 4:1451, 1990 17. Chen JH: The proto-oncogene c-ets is preferentially expressed in lymphoid cells. Mol Cell Biol 5:2993, 1985 18. Bhat NK, Fisher RJ, Fujiwara S, Ascione R, Papas TS: Temporal and tissue-specific expression of mouse ets genes. Proc Natl Acad Sci USA 84:3161, 1987 19. Kola I, Brookes S, Green AR, Garber R, Tymms M, Papas TS, Seth A: The Etsl transcription factor is widely expressed during murine embryo development and is associated with mesodermal cells involved in morphogenetic processes such as organ formation. Proc Natl Acad Sci USA 90:7588, 1993 20. Bhat NK, Thompson CB, Lindsten T, June CH, Fujiwara S, Koizumi S, Fisher RJ, Papas TS: Reciprocal expression of human ETS 1 and ETS2 genes during T-cell activation: Regulatory role for the protooncogene ETS1. Proc Natl Acad Sci USA 87:3723, 1990 21. Boulukos E,Pognonec P, Sariban E, Bailly M, Lagrou C, Ghysdael J: Rapid and transient expression of ets2 in mature macrophages following stimulation with cMGF, LPS, and PKC activators. Genes Dev 4:401, 1990 22. Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA: The macrophage and B cell-specific transcription factor PU. 1 is related to the ets oncogene. Cell 61: 113, 1990 23. Ray D, Bosselut R, Ghysdael J, Mattei MG, Tavitian A, Moreau-Gachelin F: Characterization of Spi-B, a transcription factor related to the putative oncoprotein Spi-1PU.l. Mol Cell Biol 12:4297, 1992 24. Chen H, Zhang P, Voso MT, Hohaus S, Gonzalez DA, Glass CK, Zhang D, Tenen DG: Neutrophils and monocytes express high levels of PU.1 (Spi-I) but not Spi-B. Blood 85:2918, 1995 25. Galson DL, Hensold JO, Bishop TR, Schalling M, D’Andrea AD, Jones C, Auron PE, Housman DE: Mouse b-globin DNA-binding protein B1 is identical to a proto-oncogene, the transcription factor Spi-1P U . 1, and is restricted in expression to hematopoietic cells and the testis. Mol Cell Biol 13:2929, 1993 26. Moreau-Gachelin F: Spi-lPU.1: An oncogene of the Ets family. Biochem Biophys Acta 1198:149, 1994 27. Henkel G, Brown M: PU.1 and GATA: Components of a mast cell-specific interleukin 4 intronic enhancer. Proc Natl Acad Sci USA 91:7737, 1994 28. Voso MT, Burn TC, Wulf G, Lim B, Leone G, Tenen DG: Inhibition of hematopoiesis by competitive binding of transcription factor PU.1. Proc Natl Acad Sci USA 91:7932, 1994 29. Scott EW, Simon MC, Anastasi H, Singh H: Requirement of transcription factor PU. 1 in development of multiple hematopoietic lineages. Science 265: 1573, 1994 30. Wiles MV, Keller G: Multiple hematopoietic lineages develop from embryonic stem (ES) cells in culture. Development 1 1 1 :259, 1991 31. Reddy MA, Yang B, Yue X, Bamett CJK, Ross IL, Sweet MJ, Hume DA, Ostrowski MC: Opposing actions of c-etsPU. 1 and c-myb protooncogene products in regulating the macrophage-specific promoters of the human and mouse colony-stimulating factor1 receptor (c-fms) genes. J Exp Med 180:2309, 1994

2925

32. Sherr CJ: Colony-stimulating factor-I receptor. Blood 75: 1, 1990 33. Langer SJ, Bortner DM, Roussel MF, Shen CJ, Ostrowski MC: Mitogenic signaling by colony-stimulating factor 1 and ras is suppressed by the ets-2 DNA-binding domain and restored by myc overexpression. Mol Cell Biol 125355, 1992 34. Hooper M, Hardy K, Handyside A, Hunter S, Monk M: HPRT-deficient (Lesh-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326:292, 1987 35. Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R: The in vitro development of blastocyst-derived embryonic stem cell lines: Formation of visceral yolk sac, blood islands and myocardium. J Embryo1 Exp Morpho1 87:27, 1985 36. Thomas KR, Capecchi M R Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 5 1503, 1987 37. Mansour SL, Thomas KR, Capecchi MR: Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: A general strategy for targeting mutations to non-selectable genes. Nature 336:348, 1988 38. Takeshita S, Toba M, Masahashi W, Hashimoto-Gotoh T: High-copy-number and low-copy-number plasmid vectors for LacZ alpha-complementation and chloramphenicol- or kanamycin-resistance selection. Gene 61:63, 1987 39. Keller G, Kennedy M, Papayannopoulou T, Wiles MV: Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 13:473, 1993 40. Wiles MV: Embryonic stem cell differentiation in vitro. Methods Enzymol 225:900, 1993 41. Schmitt RM, Bruyns E, Snodgrass HR: Hematopoietic development of embryonic stem cells in vitro: cytokine and receptor gene expression. Genes Dev 5:728, 1991 42. McClanahan T, Dalrymple S, Barkett M, Lee F: Hematopoietic growth factor receptor genes as markers of lineage commitment during in vitro development of hematopoietic cells. Blood 81:2903, 1993 43. McKnight AJ, Barclay AN, Mason DW: Molecular cloning of rat interleukin 4 cDNA and analysis of the cytokine repertoire of subsets of CD4+ T-cells. Eur J Immunol 21:1187, 1991 44. Auger MJ, Ross JA: The biology of the macrophage, in Lewis CE, McGee JO (eds): The Macrophage. NCW York, NY, Oxford, 1992, p 3 45. Zhang DE, Hetherington CJ, Chen HM, Tenen DG: The macrophage transcription factor PU. 1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Mol Cell Biol 14:373, 1994 46. Pahl HL, Scheibe RJ, Zhang D, Chen H, Galson DL, Maki RA, Tenen DG: The proto-oncogene Pu.1 regulates expression of the myeloid specific CDllb promoter. J Biol Chem 2685014, 1993 47. Bottinger EP, Shelley CS, Farokhzad OC, Arnaout MA: The human p2 integrin CD18 promoter consists of two inverted ets cis elements. Mol Cell Biol 14:2604, 1994 48. Rosmarin A, Caprio D, Levy R, Simkevich C: CD18 (p2 leukocyte integrin) promoter requires PU. 1 transcription factor for myeloid activity. Proc Natl Acad Sci USA 92201, 1995 49. Hohaus S, Petrovick MS, Voso MT, Sun Z, Zhang DE, Tenen DG: PU. 1 (Spi-1) and CEBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene. Mol Cell Biol 155830, 1995 50. Austyn JM, Gordon S: F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur J Immunol 11:805, 1981 5 1. Wang C, Petryniak B, Hu I, Thompson CB, Leiden JM: Evo-

From bloodjournal.hematologylibrary.org by guest on July 12, 2011. For personal use only. 2926

lutionary conserved ets family members display distinct DNA binding specificities. J Exp Med 175:1391, 1992 52. Galang CK, Der CJ, Hauser CA: Oncogenic Ras can induce transcriptional activation through a variety of promoter elements, including tandem c-Ets-2 binding sites. Oncogene 9:2913, 1994 53. Yang BS, Hauser CA, Henkel G, Colman MS, Van Beveren C, Stacey KJ, Hume DA, Maki RA, Ostrowski MC: Ras-mediated phosphorylation of a conserved threonine residue. enhances the transactivation activities of c-Etsl and c-Eh2. Mol Cell Biol 16:538, 1996 54. Pongubala JMR, Van Beveren C, Nagulapalli S, Klemsz MJ, McKercher SR, Maki RA, Atchison ML: Effect of PU.1 phosphorylation on interaction with NF-EM5 and transcriptional activation. Science 259:1622, 1993 55. Pongubala JMR, Magulapalli S, Klemsz MJ, McKercher SR, Maki RA, Atchison ML: Pu.1 recruits a second nuclear factor to a site important for immunoglobulin K 3’ enhancer activity. Mol Cell Biol 12:368, 1992 56. Olson MC, Scott EW, Hack AA, Su GH, Tenen DG, Singh H, Simon MC: PU.l is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity 3:703, 1995 57. Hromas R, Orazi A, Neiman RS, Maki R, Van Beveran C, Moore J, Klemsz M: Hematopoietic lineage- and stage-restricted

HENKEL ET AL

expression of the ETS oncogene family member PU.1. Blood 82:2998, 1993 58. Celada A, Borras FE, Soler C, Lloberas J, Klemsz M, van Beveren C, McKercher S, Mak~RA: The transcription factor PU.1 is involved in macrophage proliferation. J Exp Med 184:61, 1996 59. Sariban E, Mitchell T, Kufe D: Expression of the c-fms protooncogene during human monocytic hfferentiation. Nature 3 16:64, 1985 60. Tushinski RJ, Oliver IT, Guilbert LJ, Tynan PW, Stanley ER: Survival of mononuclear phagocytes depends on a lineage-specific growth factor that the differentiated cells selectively destroy. Cell 28:71, 1982 61. Tushinski RJ, Stanley ER: The regulation of mononuclear phagocyte entry into S phase by the colony stimulating factor CSF1. J Cell Physiol 122:221, 1985 62. Wiktor-Jedrzejczak W, Bartocci A, Ferrante AW Jr, AhmedAnsari A, Sell KW, Pollard JW, Stanley ER: Total absence of colony-stimulating factor 1 in the macrophage deficient osteopetrotic (op/op) mouse. Proc Natl Acad Sci USA 87:4828, 1990 63. Yoshida H, Hayashi S, Kuniscada T, Ogawa M, Okamura H, Sudo T, Schultz LD, Nishikawa S: The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature 345:442, 1990