repa , a repetitive and dispersed DNA sequence of the filamentous fungus Podospora anserina

Nucleic Acids Research, Vol. 18, No. 16 4901

© 1990 Oxford University Press

reps, a repetitive and dispersed DNA sequence of the filamentous fungus Podospora anserina Carole Deleu, Beatrice Turcq and Joel Begueret* Laboratoire de Genetique UA CNRS 542, Universite de Bordeaux II, Avenue des facultes, 33405 Talence, France Received February 12, 1990; Revised and Accepted May 15, 1990

ABSTRACT

INTRODUCTION In the yeast Saccharomyces cerevisiae several repetitive DNA elements have been characterized. They consist either of the retrotransposable Ty elements (1, 2, 3) or of shorter repetitive sequences such as solo delta (4), sigma (5) or tau (6). The later short elements consist of 300-400bp sequences flanked at each end by a direct 5bp duplication of the original genomic sequence at the site of their integration, a structure which is a characteristic of transposable sequences in prokaryotes and eukaryotes. Solo delta is though to be generated by recombination between two delta terminal repeats of Tyl (4). Such an hypothesis has also been proposed for the sigma element (5). In filamentous fungi repetitive sequences with such an organization have not yet been described. However a transposable element which exhibits some similarities with the I elements of Drosophila or the LINES of mammals has been found in a strain of Neurospora crassa from Adiopodoume (7). This transposable element is absent from laboratory strains. In the same species a pogo element was shown to be associated with the telomere of linkage group V (8). It was suggested that it is a transposable element on the facts that it is repeated in the genome and that the locations of this sequence are different in various strains. We have recently cloned the homologous loci containing the allelic incompatibility genes s and S from two different wild type strains of the ascomycete Podospora anserina (9). A restriction fragment length polymorphism was found at this locus in DNA from these two wild-type strains s and 5. Sequences of these genomic regions revealed the presence at this locus in s strain of a DNA element which exhibits similarities with the yeast solo delta, sigma or tau elements.

* To whom correspondence should be addressed

MATERIALS AND METHODS Strains Podospora anserina is a filamentous ascomycete, its biological characteristics have been previously described (10). P. anserina strains s, S, A, B, D, E, H, N, R, and U are wild-type strains isolated in France by G. Rizet (11) and J. Bernet (12). DNA blot hybridization and sequencing DNA was isolated from mycelium as described (13). DNA was digested with restriction enzymes, the fragments were separated in 0.8% agarose gels, transfered onto nitrocellulose filters and hybridized as described (14). Restriction fragments used as probes were isolated from agarose gels and labelled by random priming (15). DNA sequences were determined by the method of Sanger (16) using modified T7 polymerase (17). RESULTS Sequence of the repa element of Podospora anserina The two allelic genes s and 5 of P. anserina have been cloned from wild-type strains s and S (9). These two genes are responsible for vegetative incompatibility between J and S strains (11). When the restriction maps of the cloned DNA fragments containing these two genes were compared, a restriction fragment length polymorphism was observed (9). Specifically a HindlttXhol fragment has a size of 763bp in the s strain and a smaller size (409bp) in the 5 strain. The sequences of these two fragments revealed that this difference was due to the presence of a 349bp insertion in the ^ fragment which is not present in the 5 homologous region (fig 1). The sequences flanking this insertion are highly homologous in the two strains, only 8 differences were found out of 409 sequenced bp. The general organisation of this insertion sequence which will be called repa, exhibits striking similarities with the general organisation of the yeast solo delta , sigma and tau elements. First, repa is flanked by a direct five base pairs repeat (TTATG) which is present but not duplicated at the homologous S locus. Morever there is a striking homology between the 5' and 3' sequences of these elements and those of repa (fig.2). However, in repa the conserved base pairs belong to a 7bp direct repeat whereas in the other elements the consensus sequence is a part of a small terminal inverted repeat.

Downloaded from http://nar.oxfordjournals.org/ by guest on June 27, 2016

The sequences of homologous DNA regions of two wild-type strains of the fungus Podospora anserina, revealed in one strain the presence of a 349bp insertion leading to a RFLP. This DNA sequence is repeated in the genome and some of its locations are different in various wild-type strains. This DNA element exhibits structural similarities with the yeast solo delta, sigma or tau elements.

EMBL accession no. X52957

4902 Nucleic Acids Research, Vol. 18, No. 16 ggcatggggcgtt«tgTGTC»C»CGTCAATAAACCAACCACCGTGAACACGGCCAACAACACTGTCG ATACCACCGGAAGGAGGGGTAACTGCACGTTGTGAGCCflGTGGTCAAGTGAGGCAGACAATCACAGGCT TCGCGGTTATTAAGGAAATGATATTGGTCAACCTGAGATATTGAAGGACTTGGCAGCGGCCTGAGGCCA CGATGCACGGACCACTGGGCGAAGGATAAAGACGCGTTCTCftGAAGCTGTTTGTATTCCTAGACCTTCT TCTTCTTCATCACGCTCTTCGAGGCCATTGAAGATTATTAGCCTGAATTGAACCATGAGTTCCAAGCCC TGATATTACAGCCCTTGTCACAttatgctcttctgcgtggga

Figure 1. Sequence of the repa element (upper-case letters) and flanking regions (lower-case letters). Bold letters show the direct repeats of the genomic and of the repa sequences.

PEPA SI&R TNJ TY1 COPIA

TGTCAC *** TGTTGT *****

TGTCACA * *** TACAACA *****

TGTTGG ** TGAGAT **

ATCAACA ***** TOCAACA *****

TGTTGG

TACAACA

4.3 _

2.3 2.0 -

1

1.3 1.0 0.8 _

Figure 3. Southern hybridization analysis often different P.anserina strains using the Xhol-Hindill fragment of the s strain containing the repa element as probe. Genomic DNA were digested with fflndlll, fragments were separated in 0.8% agarose gels and probed as described in Materials and Methods.The tested strains were from the left to the right the wild type strains: A, E, N, R, s, H, B, D, U and S. The arrows show the position of the fragments which hybridize in s and 5 DNA with the Xho\-HindW fragment of the 5 strain which does not contain the repa element. On the left is given the position of molecular weight markers in kb.

repa is a repetitive and dispersed element Similarity between repa and yeast solo delta rises the question of its ability to transpose. Two properties of repa were examined: its number and position in the genome of different strains. To know whether repa is a repetitive element, the genomic DNA from ten different wild-type strains of P. anserina was analyzed

DISCUSSION A repetitive sequence, repa, was identified in the filamentous fungus P. anserina by sequencing the homologous regions of two wild-type strains which exhibit restriction fragment length polymorphism. The repa element has a number of the characteristics in common with some other repetitive sequences of eukaryotes such as the yeast solo delta (4), sigma (5) and tau (6) elements. It is flanked by a direct 5bp repeat of a target sequence. The presence of direct repeats of the targetted sequence is associated with transposition both in prokaryotes and eukaryotes. It is thought to be the consequence of assy metrical breaks produced by transposases(18). In addition to this structural similarity, we have found that different wild-type strains contain several dispersed copies of the repa element. Hybridization patterns also indicate that the positions of some of these copies are not identical in the different strains. These results strongly suggest that the repa element should be transposable. The location of most repa elements seems however similar in different strains. It has been reported in yeast that sigma and tau are often adjacent to tRNA genes (5,6). The specific localization of some repa elements close to some tRNA genes or any other specific genes could account for their conserved position in different strains. We did not find any tRNA like sequence close to the cloned repa element of the s strain. Such a possibility will be explored by cloning other genomic fragments containing repa. This will also provide an approach to search for a transposable element containing a unique sequence flanked by two repa elements. In S.cerevisiae, Ty3 and Ty4 retrotransposons were identified in such a way (2,3), starting from the existence of sigma and tau repeated sequences.

REFERENCES 1. Cameron, JR., Loh, E.Y. and Davies, R.W. (1979) Cell 16, 739-751 2. Clark, D. J., Bilanchone, V. W, Haywood, L. J., Dildine, S. L. and Sandmeyer, S. B. (1988) J. Biol. Chem. 263, 1413-1423 3. Stucka, R., Lockmuller, H. and Feldmann, H. (1989) Nucl. Ac. Res. 17, 4993-5001 4. Gafner, J. and Philippsen, P. (1980) Nature 286, 414-418 5. Del Rey, F.T., Donahue, T.F. and Fink, G.F. (1982) Proc. Natl. Acad. Sci. 79, 4138-4142 6. Chisholm, G.E., Genbauffe, F.S. and Cooper, T.G. (1984) Proc. Natl. Acad. Sci. 81, 2965-2969 7. Kinsey, J.A. and Helber, J. (1989) Proc. Natl. Acad. Sci. 86, 1929-1933 8. Schechtma, M.G. (1987) Mol. Cell Biol. 7, 3168-3177 9. Turcq, B., Denayrolles, M. and Begueret, J. (1990) Cur. Genet, (in press) 10. Esser, K. (1974) in King, R.C. (ed.) Handbooks of Genetics, Plenum Press New York and London, vol.1, pp. 531-551 11. Rizet, G. (1952) Rev. Cytol. Biol. Veg. 13, 51-92 12. Bernet, J. (1965) Ann. Sci. Nat. Bot. 6, 611-768 13. Razanamparany, V. and Be>ueret, J. (1986) Cur. Genet. 10, 811-817

Downloaded from http://nar.oxfordjournals.org/ by guest on June 27, 2016

Figure 2. Sequence homologies between the ends of repa, sigma (3), Ty\ (19), Tau (4), and copia (20) . The first 6 and the last 7 nucleotides of each element are given. The asterisk between nucleotides signifies identity at that position.

by Southern blot and probed with the HindlU-Xhol fragment containing the repa element from 5 strain . As shown in fig.3, all the strains contain up to ten DNA fragments which hybridize with this probe. As a control the blot was also probed with the HindUl-Xhol fragment from the 5 strain which does not contain the repa sequence. This probe hybridizes only to one fragment in each strain. Some of the fragments which hybridize with repa seem to be common to the different strains but some of them are dissimilar suggesting that repa is a repetitive sequence which is located at different positions in various strains.

Nucleic Acids Research, Vol. 18, No. 16 4903 14. Maniatis, T., Fritsch, E.F. and Sambrook, T. (1982) Molecular cloning. A Laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor 15. Feinberg, A.P. and Vogelstein, B. (1984) Anal. Biochem. 137, 266-270 16. Sanger, F., Nicklen.S., and Coulson, A. R. (1977) Proc. Natl. Sci. 74, 5463-5467 17. Tabor, S. and Richardson, C.C. (1989) J. Biol. Chem. 264, 6447-6458 18. Kleckner, N. (1981) Ann. Rev. Genet. 15, 341-404 19. Clare, J. and Farabough, P. (1985) Proc. Natl. Acad. Sci. 82, 2829-2833 20. Hieter, P. A., Max, E. E., Seidmann, J. G., Maizel, J. V. and Leder, P. (1980) Cell 22, 197-207

Downloaded from http://nar.oxfordjournals.org/ by guest on June 27, 2016

Downloaded from http://nar.oxfordjournals.org/ by guest on June 27, 2016