Veterinary Microbiology 78 (2001) 353±362
Response of porcine peripheral blood mononuclear cells to CpG-containing oligodeoxynucleotides Sùren Kamstrupa,b,*, Daniela Verthelyib, Dennis M. Klinmanb a
Department for Pathobiology and Diagnostics, Danish Veterinary Institute for Virus Research, Lindholm, DK-4771 Kalvehave, Denmark b Retroviral Immunology Section, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892, USA Received 29 February 2000; received in revised form 11 July 2000; accepted 17 July 2000
Abstract Exposure to bacterial DNA generates a ``danger signal'' that stimulates cellular elements of the mammalian immune system to proliferate and/or secrete cytokines. Stimulation is critically dependent on hexameric motifs that contain an unmethylated CpG dinucleotide: these are commonly found in bacterial but not vertebrate DNA. Different motifs are optimally stimulatory in different species. This work examines whether oligodeoxynucleotides (ODNs) containing CpG motifs stimulate peripheral blood mononuclear cells from pigs. Results show that pigs respond to CpG ODN by proliferating and secreting IL-6, IL-12 and TNF-a. By screening a large panel (>100) of ODNs, the palindromic hexamer `ATCGAT' was identi®ed as being optimally active in all animals examined (N 10). These ®ndings are the ®rst to establish the immunostimulatory activity of CpG ODN in pigs, and suggest that the therapeutic uses envisioned for these ODNs (as vaccine adjuvants and immunoprotective agents) may be applicable to husbandry animals. # 2001 Elsevier Science B.V. All rights reserved. Keywords: PBMC; CpG; Oligodeoxynucleotides; Immunostimulation; Pigs
1. Introduction The capacity of the mammalian immune system to selectively recognize sequence motifs present in bacterial but not vertebrate DNA was recognized relatively recently. Experiments involving mice and primates revealed that unmethylated CpG dinucleotides common to bacterial DNA but suppressed in vertebrate DNA are capable of stimulating B cells, NK cells and monocytes/macrophages (Klinman et al., 1996; Krieg et al., 1995; *
Corresponding author. Tel.: 45-55-86-02-21; fax: 45-55-86-03-00. E-mail address:
[email protected] (S. Kamstrup). 0378-1135/01/$ ± see front matter # 2001 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 1 3 5 ( 0 0 ) 0 0 3 0 0 - X
354
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
Yamamoto et al., 1994). The CpG dependent response is characterized by cell proliferation, maturation, and the production of polyreactive IgM, cytokines and chemokines (Ballas et al., 1996; Klinman et al., 1996; Krieg et al., 1995; Liang et al., 1996; Moss et al., 2000; Yamamoto et al., 1994). Further studies documented that CpG recognition stimulates a rapid innate immune response that helps protect the host from an infecting microorganism while promoting the development of pathogen-speci®c immunity (Elkins et al., 1999; Halpern et al., 1996; Klinman et al., 1999b; Zimmermann et al., 1998). For example, CpG ODN protected mice from challenge with >103 LD50 of various intracellular pathogens, including F. tularensis and L. monocytogenes (Elkins et al., 1999; Klinman et al., 1999b). Since different pathogens preferentially infect certain hosts, selective pressures may drive the immune system of different species to preferentially recognize sequence motifs expressed by those pathogens. Consistent with such a possibility, recent reports show that CpG motifs that are optimally active in mice are relatively inactive in humans, and vice versa (Bauer et al., 1999; Hartmann et al., 2000). It could be of considerable practical importance to determine whether CpG DNA is immunostimulatory in husbandry animals, since CpG DNA may be of value both as vaccine adjuvants (improving the antibody and Th1 mediated response elicited by DNA, protein and peptide-based antigens) and as immunoprotective agents (Carpentier et al., 1999; Hartmann et al., 2000; Klinman, 1998; Klinman et al., 1999a; Klinman et al., 1997; McCluskie and Davis, 1998, 1999; Oxenius et al., 1999). The current work examines whether synthetic oligonucleotides (ODN) containing CpG motifs can stimulate PBMC from pigs. ODN containing at least one CpG dinucleotide induced porcine PBMC to proliferate and/or increase expression of cytokine mRNA, effects similar to those reported in mice and humans. 2. Materials and methods 2.1. Oligodeoxynucleotides All ODN were synthesized at the Center for Biologics Evaluation and Research Core Facility. All had less than 0.1 EU/ml (ODN concentration 1 mg/ml), and were used in vitro at a ®nal concentration of 1 mM. 2.2. Preparation, stimulation and analysis of PBMC PBMC were prepared by density gradient centrifugation of freshly drawn heparinized blood from 6±10-month old NIH minipigs. Cells were washed three times in RPMI 1640 supplemented with 5% FBS. For in vitro proliferation assays, 3 105 cells were incubated in 200 ml of medium in 96 well ¯at-bottom plates (Costar) for 72 h at 378C in a 5% CO2 in air incubator. 1 mCi of 3H-thymidine was then added for 6 h, and incorporation of 3H-thymidine determined using standard protocols. Stimulation index was calculated as the ratio of incorporation in stimulated versus unstimulated (incubated in medium) cells.
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
355
For analysis of cytokine mRNA levels, 1:8 106 cells were stimulated in vitro with 1 mM ODN (or 100 mg/ml Con A) for 6 h in 1.2 ml of medium. Cells were then harvested from 24 well plates (Nunc, Roskilde, Denmark), pelleted by centrifugation, and immediately homogenized in 1 ml of Trizol reagent (Gibco/BRL). RNA was puri®ed from the pellet and transcribed into cDNA using Superscript II (Gibco/BRL) and random primers as recommended by the manufacturer. This cDNA (®nal volume 20 ml) was PCR ampli®ed by TaqMan PCR. Primers and 6-FAM/TAMRA labeled internal probes speci®c for porcine beta-actin, TNF-alpha (TNF-a), IFN-gamma (IFN-g), IL-6, IL-12 p35, and IL-12 p40 were designed from published sequences using the program PrimerExpress ver. 1.0 (P.E. Biosystems). In all cases, primer pairs were selected that spanned introns (manuscript in preparation). PCR was performed on a 7700SDS Thermocycler (P.E. Biosystems) as recommended by the manufacturer. The amount of beta-actin mRNA was used to normalize mRNA levels between individual samples. Data show the fold increase in mRNA levels in cells stimulated with ODN versus non-stimulated controls. 3. Results 3.1. Porcine PBMC respond to ODN containing unmethylated CpG dinucleotides The ability of porcine PBMC to respond to a panel (n > 100) of synthetic ODN by proliferating and/or producing cytokines was investigated. This screening identi®ed several ODN that induced PBMC to proliferate and up-regulate production of TNF-a, IL6 and/or IL-12 mRNA. Representative examples of these ODN are shown in Table 1. Consistent with ®ndings from other mammalian species, ODN that were stimulatory in pigs contained an unmethylated CpG dinucleotide (D25, D28, D19). Inversion of this critical CpG to a GpC (D26, D44), replacement of one or both nucleotides (D47±49, D122), or methylation of either nucleotide (D45, D46) resulted in a signi®cant loss of activity. While CpG ODN composed entirely of phosphodiester nucleotides were active in these studies (D25), such ODN are known to be highly sensitive to digestion by DNAse present in serum and on cells (Eder et al., 1991). By introducing nuclease resistant phosphorothioate nucleotides at both ends of the ODN but leaving the nucleotide sequence intact, signi®cantly greater proliferation and cytokine production was observed (D19 versus D25). Thus, subsequent studies were performed using chimeric phosphodiester/phosphorothioate ODN. Dose/response curves for stimulation of porcine PBMCs with ODN D19 (0±5 mM) were similar to that observed for other species (data not shown), and a subsaturating concentration of 1 mM was chosen for all subsequent experiments. 3.1.1. Contribution of nucleotides ¯anking the CpG to ODN-mediated activation The immunostimulatory activity of various CpG ODN was analyzed in a total of 10 animals. Consistent with the results from pig #14 shown above, an optimal response was generally elicited by ODN D19 (SI 99 10). Thus, this ODN was chosen for subsequent studies examining the contribution of sequence and structure to ODN activity. Based on ®ndings from other mammalian species, it was expected that the nucleotides immediately ¯anking the CpG dinucleotide might in¯uence ODN activity. A series of
356
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
Table 1 ODN containing unmethylated CpG dinucleotides are immunostimulatorya ODN
Sequence
Proliferation (fold increase)
Fold increase in mRNA level TNF-a
IL-6
IL12 p35
p40
D25 D26
GGTGCATCGATGCAGGGGGG GGTGCATGCATGCAGGGGGG
19 1
18 2
9 2
32 3
522 2
D28 D44
ggTGCGTCGATGCAGGGGGG ggTGCGTGCATGCAGGGGGG
11 1
5 3
1 4
6 6
30 3
D19 D45 D46 D47 D48 D49 D122
ggTGCATCGATGCAGggggg ggTGCATZGATGCAGggggg ggTGCATCXATGCAGggggg ggTGCATTGATGCAGggggg ggTGCATCAATGCAGggggg ggTGCATAAATGCAGggggg ggTGCATTGATGCAGggggg
97 2 0 0 0 1 1
42 1 1 2 0 3 2
18 1 1 1
14 1 1 2
2 1
3 1
8882 1 1 1 14 2 1
a
PBMC from pig #14 were stimulated in vitro with 1 mM of each ODN. Proliferation was monitored 3 days later by 3H-thymidine incorporation, while cytokine mRNA levels were determined 6 h after ODN stimulation by TaqMan PCR. Data show the fold increase when compared to cells incubated in medium alone. ODNs are grouped according to sequence and backbone, with the CpG ODN followed by its respective non-CpG controls. Note that only those ODN containing unmethylated CpG dinucleotides were active. ODN sequences show phosphodiester nucleotides in upper case and phosphorothioate nucleotides in lower case. Z: 5-methylcytosine, X: 5-methylguanosine.
D19-based ODN were synthesized in which individual nucleotides in the ¯anking region were replaced. A >50% loss of activity resulted when any modi®cation was made to the optimal ATCGAT ¯anking region, including conservative changes involving the replacement of purines with purines (D28, D53) or pyrimidines with pyrimidines (D30, D27) (Table 2). A similar or greater loss of activity was observed when purines were substituted with pyrimidines, or vice versa, anywhere in the CpG ¯anking region (data not shown). There were two potential explanations for the sensitivity of ODN to these changes in ¯anking region sequence. Either the ATCGAT hexamer at the core of D19 was optimal for stimulating porcine PBMC, or the palindrome created by this hexamer was critical to ODN activity. To examine these alternatives, paired conservative substitutions were introduced that changed the sequence of the hexameric CpG motif but re-created a palindrome. As seen in Table 2, when paired conservative nucleotide substitutions were introduced, ODN activity improved but not to levels observed with D19 (D32, D29). Paired non-conservative nucleotide substitutions (i.e. purine ! pyrimidine) did not improve ODN activity despite the formation of a new palindrome (data not shown). A number of ODNs were synthesized in which nucleotides outside the hexameric motif were replaced. Whereas substitutions in the poly G tail reduced ODN activity, other changes outside the ATCGAT hexamer had little impact on the ability of CpG ODN to activate PBMC (data not shown).
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
357
Table 2 Contribution of CpG ¯anking sequences to ODN activitya ODN
Sequence
% maximal proliferation (pig #) 12
14
15
Fold increase in mRNA level (pig #14) 16
TNF-a IL-6
IL-12 p35
p40
D19
ggTGCATCGATGCAGggggg
100
100
100
100
42
18
14
8882
D28 D30 D32
ggTGCGTCGATGCAGggggg ggTGCATCGACGCAGggggg ggTGCGTCGACGCAGggggg
39 49 73
11 14 84
29 30 ±
31 50 12
5 7 74
1 2 14
6 2 32
30 44 6025
D27 D53 D29
ggTGCACCGATGCAGggggg ggTGCATCGGTGCAGggggg ggTGCACCGGTGCAGggggg
29 ± 57
11 0 37
37 0 46
22 0 30
5 3 69
1 1 7
8 1 8
53 8 6237
a PBMC were stimulated in vitro with 1 mM of each ODN. Proliferation results from four animals and cytokine mRNA levels from pig #14 were monitored as described in Table 1. Note that elimination of the hexameric palindrome ATCGAT significantly reduces ODN activity, and that paired conservative substitutions that recreate a palindrome tend to improve activity.
3.1.2. Heterogeneity in the response of different animals to speci®c ODNs PBMC from individual animals differed somewhat in their proliferative response to various ODN. The response to D32 was particularly heterogeneous. As seen in Fig. 1, 60% of animals generated no detectable response to D32. Yet the animals that did respond
Fig. 1. Heterogeneity in the proliferative response of PBMCs from individual animals to various ODN. Data represent the fold increase in proliferation (compared to medium alone) for each animal tested (individual symbols) with each ODN. For visualisation, D32-non-responders have been given open symbols.
358
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
Table 3 Effect of stimulatory CpG ODN on cytokine productiona Cytokine
N
Pigs responding (%)
TNF-a IFN-g IL-6 IL-12 p35 IL-12 p40
31 25 34 23 15
58 48 32 61 80
a PBMC were stimulated in vitro with 1 mM of CpG ODN. mRNA from cells that responded to stimulation by proliferation 5-fold were analyzed for cytokine up-regulation by TaqMan PCR. Samples with an increase in cytokine mRNA levels exceeding the mean 2 S.D. for non-proliferating cultures, were scored as positive.
to D32 generated a response whose magnitude exceeded that of all other ODN tested except D19. Heterogeneity was also observed in the relative amount of cytokine mRNA induced in individual animals (Table 3). In >90% of animals, ODN that stimulated a signi®cant increase in proliferation also increased expression of mRNA for at least one of the cytokines tested. Yet no single cytokine was activated in every animal: a maximum of 80% of animals were triggered to increase IL-12 p40 mRNA production, while as few as 32% were activated to produce IL-6 mRNA. Of note, the magnitude of cytokine induction was quite impressive, reaching levels >1000-fold above baseline (versus medium alone) for the p40 subunit of IL-12 (Table 1). Similar heterogeneity in both the presence and magnitude of responses to individual ODN in different individuals was also reported in studies of other outbred mammalian populations, such as humans (data not shown). 4. Discussion Previous studies focused on the ability of bacterial DNA and CpG ODNs to activate the immune system of mice and humans (Deml et al., 1999; Hartmann et al., 2000; Klinman et al., 1999a,b; Krieg et al., 1995; McCluskie and Davis, 1998; Moss et al., 2000; Oxenius et al., 1999; Stacey and Blackwell, 1999; Walker et al., 1999; Weiner et al., 1997). Those reports showed that CpG DNA may be useful therapeutically as immune adjuvants, antiallergens and immunoprotective agents. Indeed, phase I studies examining the capacity of CpG ODN to act as vaccine adjuvants have been initiated. Yet the activity of CpG ODN in husbandry animals has not been examined, despite evidence that DNA from the protozoal parasite Babesia bovis stimulates bovine PBMCs just as E. coli DNA stimulates human PBMC (Brown et al., 1998). The current work was undertaken to examine the response of porcine PBMC to ODN, and demonstrates that cells from this species recognize and respond to palindromic hexameric motifs containing an unmethylated CpG dinucleotide of optimal sequence ATCGAT. The mechanism by which CpG ODN stimulate immune cells remains a topic of active investigation. In murine B and macrophage cell lines, CpG DNA enter the endosomal/ lysosomal compartment where they must be acidi®ed and released before activation is
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
359
observed (Hacker et al., 1998; Yi and Krieg, 1998; Yi et al., 1996). A similar cascade of events may occur in human B cells (Hartmann and Krieg, 2000) However, data from Liang et al. (Liang et al., 1996) indicate that ODN binding to the surface of human cells may be suf®cient to trigger immune activation. Species differ in their recognition of speci®c CpG motifs. As reported by Hartman et al., motifs that are optimally stimulatory in mice are relatively inactive in humans, and vice versa (Hartmann et al., 2000). In the current study, a large number of CpG ODNs was screened to identify sequences that could activate porcine PBMC. Data show that PBMCs from this species respond to CpG ODN by proliferating and/or secreting proin¯ammatory and Th1-associated cytokines. The responses are sequence speci®c and dependent on the presence of an unmethylated CpG dinucleotide, since ODNs in which the CpG was replaced or methylated were relatively inactive. In this respect, the response of porcine PBMC is similar to those of other mammals examined. The contribution of ODN sequence/structure to immunostimulatory activity was facilitated by data showing that ODN D19 induced optimal proliferation and cytokine production in every animal examined. D19 was a chimeric ODN, composed of a phosphodiester core with phosphorothioate nucleotides at both ends. This modi®ed backbone is DNAse resistant, helping to protect the ODN from degradation and perhaps accounting for the superior activity of D19 when compared to D25, which has the same sequence but lacks DNAse resistant nucleotides (Table 1). The increased activity of such chimeric ODN has also been found by others (Krieg et al., 1996). In addition to the modi®ed backbone, D19 contains a run of poly G's at both ends, which may facilitate ODN entry into cells (Pisetsky and Reich, 1998; Wloch et al., 1998). By sequentially substituting nucleotides in the CpG ¯anking region of D19, the in¯uence of sequence and structure on ODN activity was probed. Results indicate that the palindromic hexamer ATCGAT was optimally stimulatory in pigs. Other palindromes (created by conservative purine ! purine and pyrimidine ! pyrimidine substitutions) also induced proliferation, albeit to lower levels than D19 (Table 2). D19 contains an even larger palindrome, encompassing nucleotides 3±14. This palindrome could potentially form a stem loop structure or generate dimers in solution at 378C. To examine whether such structures were important to ODN activity, non-conservative nucleotide substitutions were introduced into the sequence of the larger palindrome outside the central hexamer. These did not disrupt ODN function, leading us to conclude that porcine PBMC optimally recognize CpG dinucleotides embedded in a hexameric palindrome consisting of purine/ pyrimidine/CG/purine/pyrimidine. Considerable heterogeneity was observed in the response of individual pigs to various CpG ODN. For example, D32 induced strong proliferation in 40% of the animals tested, but was relatively inactive in others (Fig. 1). Similarly, the cytokine response of individual pigs to different ODNs diverged strongly, with some preferentially mounting TNF-a and other IL-12 biased responses. This heterogeneity is reminiscent of that observed in studies of humans, another outbred population. Among humans, ODNs that are strongly stimulatory in a majority of subjects show little or no activity in 10±15% of the donor pool (data not shown). Although mRNA for IL-12 p40 was detected most frequently, this could re¯ect the use of mRNA isolated 6 h after ODN stimulation for cytokine quantitation. Preliminary kinetic studies showed that all of the cytokines
360
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
examined were present at 6 h. However, TNF-a and IL-6 mRNA levels peaked at 2±4 h whereas IL-12 mRNA levels were still rising at 6 h. Thus, sampling additional time points might have increased the likelihood of detecting a signi®cant increase in the mRNA levels of each cytokine. Taken together, our experiments have identi®ed proliferation as the most reliable single indicator of ODN activation. The measurement of cytokine mRNA levels backs up the proliferation data and provide more detailed information on the activating properties of CpG ODNs. The cytokines activated when porcine PBMC were stimulated by CpG ODN correspond to those up-regulated in other mammalian species such as mice and humans (Hartmann et al., 2000; Klinman et al., 1996; Yamamoto et al., 1994). These include the pro-in¯ammatory cytokines IL-6 and TNF-a, and the Th1-associated cytokine IL-12. In mice, CpG ODN have been shown to promote the development of Th1-biased immune responses and to improve host defense by stimulating a protective innate immune response. Given the similarities of CpG ODN responsiveness between pigs and other mammals, we postulate that the therapeutic uses envisioned for ODNs (as vaccine adjuvants, anti-allergens and immunoprotective agents) may be applicable to farm animals as well. Acknowledgements The assertions herein are the private ones of the authors and are not to be construed as of®cial or as re¯ecting the views of the Food and Drug Administration at large. This work was ®nanced in part by grant CEP97-SVIV-9 from ``Research Centre for the Management of Animal Production and Health (CEPROS)'', and grant BIOT99-SVIV-3 from ``Biotechnology in the Food Sciences''. A grant from the Danish Agricultural and Veterinary Research Council to SK is also greatly appreciated. The authors also wish to thank Dr. Joni Taylor of the National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, for supplying fresh swine blood. References Ballas, Z., Rasmussen, W., Krieg, A., 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157, 1840±1845. Bauer, M., Heeg, K., Wagner, H., Lipford, G.B., 1999. DNA activates human immune cells through a CpG sequence-dependent manner. Immunology 97 (4), 699±705. Brown, W.C., Estes, D.M., Chantler, S.E., Kegerreis, K.A., Suarez, C.E., 1998. DNA and a CpG oligonucleotide derived from Babesia bovis are mitogenic for bovine B cells. Infect. Immunol. 66 (11), 5423±5432. Carpentier, A.F., Chen, L., Maltonti, F., Delattre, J.Y., 1999. Oligodeoxynucleotides containing CpG motifs can induce rejection of a neuroblastoma in mice. Cancer Res. 59 (21), 5429±5432. Deml, L., Schirmbeck, R., Reimann, J., Wolf, H., Wagner, R., 1999. Immunostimulatory CpG motifs trigger a T helper-1 immune response to human immunode®ciency virus type-1 (HIV-1) gp 160 envelope proteins. Clin. Chem. Lab. Med. 37 (3), 199±204. Eder, P.S., DeVine, R.J., Dagle, J.M., Walder, J.A., 1991. Substrate speci®city and kinetics of degradation of antisense oligonucleotides by a 30 exonuclease in plasma. Antisense Res. Dev. 1 (2), 141±151.
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
361
Elkins, K.L., Rhinehart-Jones, T.R., Stibitz, S., Conover, J.S., Klinman, D.M., 1999. Bacterial DNA containing CpG motifs stimulates lymphocyte-dependent protection of mice against lethal infection with intracellular bacteria. J. Immunol. 162 (4), 2291±2298. Hacker, H., Mischak, H., Miethke, T., Liptay, S., Schmid, R., Sparwasser, T., Heeg, K., Lipford, G., Wagner, H., 1998. CpG-DNA-speci®c activation of antigen-presenting cells requires stress kinase activity and is preceded by non-speci®c endocytosis and endosomal maturation. EMBO J. 17 (21), 6230±6340. Halpern, M.D., Kurlander, R.J., Pisetsky, D.S., 1996. Bacterial DNA induces murine interferon-gamma production by stimulation of interleukin-12 and tumor necrosis factor-alpha. Cell Immunol. 167 (1), 72±78. Hartmann, G., Krieg, A., 2000. Mechanism and function of a newly identi®ed CpG DNA motif in human primary B cells. J. Immunol. 164, 944±952. Hartmann, G., Weeratna, R.D., Ballas, Z.K., Payette, P., Blackwell, S., Suparto, I., Rasmussen, W.L., Waldschmidt, M., Sajuthi, D., Purcell, R.H., Davis, H.L., Krieg, A.M., 2000. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo (in process citation). J. Immunol. 164 (3), 1617±1624. Klinman, D.M., 1998. Therapeutic applications of CpG-containing oligodeoxynucleotides. Antisense Nucleic Acid Drug Dev. 8 (2), 181±184. Klinman, D.M., Barnhart, K.M., Conover, J., 1999a. CpG motifs as immune adjuvants. Vaccine 17 (1), 19±25. Klinman, D.M., Conover, J., Coban, C., 1999b. Repeated administration of synthetic oligodeoxynucleotides expressing CpG motifs provides long-term protection against bacterial infection. Infect. Immun. 67 (11), 5658±5663. Klinman, D.M., Yamshchikov, G., Ishigatsubo, Y., 1997. Contribution of CpG motifs to the immunogenicity of DNA vaccines. J. Immunol. 158 (8), 3635±3639. Klinman, D.M., Yi, A.K., Beaucage, S.L., Conover, J., Krieg, A.M., 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl. Acad. Sci. U.S.A. 93 (7), 2879±2883. Krieg, A., Matson, S., Fisher, E., 1996. Oligodeoxynucleotide modi®cations determine the magnitude of B cell stimulation by CpG motifs. Antisense Nucleic Acid Drug Dev. 6, 133±139. Krieg, A.M., Yi, A.K., Matson, S., Waldschmidt, T.J., Bishop, G.A., Teasdale, R., Koretzky, G.A., Klinman, D.M., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374 (6522), 546±549. Liang, H., Nishioka, Y., Reich, C., Pisetsky, D., Lipsky, P., 1996. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Invest. 98 (5), 1119±1129. McCluskie, M.J., Davis, H.L., 1998. CpG DNA is a potent enhancer of systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice. J. Immunol. 161 (9), 4463±6446. McCluskie, M.J., Davis, H.L., 1999. CpG DNA as mucosal adjuvant. Vaccine 18 (3±4), 231±237. Moss, R.B., Diveley, J., Jensen, F., Carlo, D.J., 2000. In vitro immune function after vaccination with an inactivated, gp120-depleted HIV-1 antigen with immunostimulatory oligodeoxynucleotides. Vaccine 18 (11± 12), 1081±1087. Oxenius, A., Martinic, M.M., Hengartner, H., Klenerman, P., 1999. CpG-containing oligonucleotides are ef®cient adjuvants for induction of protective antiviral immune responses with T-cell peptide vaccines. J. Virol. 73 (5), 4120±4126. Pisetsky, D.S., Reich III, C.F., 1998. The in¯uence of base sequence on the immunological properties of de®ned oligonucleotides. Immunopharmacology 40 (3), 199±208. Stacey, K.J., Blackwell, J.M., 1999. Immunostimulatory DNA as an adjuvant in vaccination against Leishmania major. Infect. Immun. 678, 3719±3726. Walker, P.S., Scharton-Kersten, T., Krieg, A.M., Love-Homan, L., Rowton, E.D., Udey, M.C., Vogel, J.C., 1999. Immunostimulatory oligodeoxynucleotides promote protective immunity and provide systemic therapy for leishmaniasis via IL-12- and IFN-gamma-dependent mechanisms. Proc. Natl. Acad. Sci. U.S.A. 96 (12), 6970±6975. Weiner, G.J., Liu, H.M., Wooldridge, J.E., Dahle, C.E., Krieg, A.M., 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. U.S.A. 9420, 10833±10837. Wloch, M., Pasquini, S., Ertl, H., Pisetsky, D., 1998. The in¯uence of DNA sequence on the immunostimulatory properties of plasmid DNA vectors. Human Gene Therapy 9, 1439±1447.
362
S. Kamstrup et al. / Veterinary Microbiology 78 (2001) 353±362
Yamamoto, T., Yamamoto, S., Kataoka, T., Komuro, K., Kohase, M., Tokunaga, T., 1994. Synthetic oligonucleotides with certain palindromes stimulate interferon production of human peripheral blood lymphocytes in vitro. Jpn. J. Cancer Res. 85, 775±779. Yi, A., Krieg, A., 1998. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J. Immunol. 161 (9), 4493±4497. Yi, A.K., Klinman, D.M., Martin, T.L., Matson, S., Krieg, A.M., 1996. Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157 (12), 5394±5402. Zimmermann, S., Egeter, O., Hausmann, S., Lipford, G.B., Rocken, M., Wagner, H., Heeg, K., 1998. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J. Immunol. 1608, 3627±3630.
