Molecular and Cellular Probes (2000) 14, 33–39 doi:10.1006/mcpr.1999.0280, available online at http://www.idealibrary.com on
Specific PCR primers for Cryptosporidium parvum with extra high sensitivity Z. Wu,1 I. Nagano,1 A. Matsuo,1 S. Uga,2 I. Kimata,3 M. Iseki3 and Y. Takahashi1∗ 1
Department of Parasitology, Gifu University School of Medicine, Tsukasa 40, Gifu 500–8705, Japan, 2Department of Medical Technology, Faculty of Health Science, Kobe University School of Medicine, Tomogoka, Suma-Ku, Kobe 650-0017, Japan, 3 Department of Medical Zoology, Osaka City University Medical School, Abeno-Ku, Osaka 545–8585, Japan (Received 10 August 1999, Accepted 18 November 1999) One pair of high-sensitive polymerase chain reaction (PCR) primers for Cryptosporidium parvum was constructed based on the sequence of random amplified polymorphic DNA. PCR with this primer pair amplified only the DNA of C. parvum, not the control DNA including Cryptosporidium muris. This primer pair had most advantageous in its sensitivity over the six pairs of primers reported elsewhere. The minimum amount of template DNA required to produce visible bands after gel electrophoresis and ethidium bromide staining was 0·156 pg of C. parvum or just a single oocyst in the PCR tube. 2000 Academic Press
KEYWORDS: Cryptosporidium parvum, PCR, primer.
INTRODUCTION
Cryptosporidium parvum is a causative agent of cryptosporidiosis in humans and domesticated mammals.1 A method to detect Cryptosporidium with high specificity and sensitivity is critically needed. Because water reservoirs are contaminated with numerous microorganisms, strict specificity in the detection system is required. Populations of Cryptosporidium oocysts in reservoir water are supposedly sparse, sometimes below the detectable level by conventional methods. Unfortunately, uptake of even a single oocyst of Cryptosporidium may cause cryptosporidiosis, which requires extra high sensitivity in the detection system. These demands have been satisfied by the polymerase chain reaction (PCR) technique, which has been used to detect microorganisms recently. The
usefulness of a given PCR technique varies depending on many factors, of which the primer is foremost. In fact, although many PCR primers have been constructed to detect Cryptosporidium, the sensitivity and specificity seem to differ with each other (reviewed by Morgan & Thompson).2 The sensitivity is apparently affected by the number of copies of the target DNA per one cell of the microorganism. Here, we report new PCR primer pairs for Cryptosporidium parvum, which are advantageous in sensitivity over previously reported primers. MATERIALS AND METHODS Parasite samples One isolate (HNJ-1) of C. parvum was collected from an immunologically normal human adult with
∗ Author to whom all correspondence should be addressed at: Department of Parasitology, Gifu University School of Medicine, Tsukasa 40 Gifu, 500-8705 Japan. Tel: +58 267 2251; Fax: +58 267 2960; E-mail:
[email protected]
0890–8508/00/010033+07 $35.00/0
2000 Academic Press
34
Z. Wu et al.
diarrhoea, and five isolates were collected from newborn calves at Gifu and Kobe in Japan. One isolate (RN66) of Cryptosporidium muris was from a house rat (Rattus norvegicus). Oocysts were isolated from faeces using sucrose flotation methods. Using an immuno-magnetic separation kit (Dynabeads antiCryptosporidium, Dynal A. S., Oslo, Norway) the samples were refined to remove contaminated microorganisms to a minimum level of contamination by other organisms.
Template DNA Two methods were adapted to obtain template DNA for PCR. One method includes isolation of purified DNA from oocysts. The oocysts in PCR buffer were treated at 95°C for 20 min, then digested with proteinase K at a final concentration of 200 ug ml−1 at 55°C for 3 h. The reaction was stopped by heating at 95°C for 10 min. Then DNA was purified using a conventional method of phenol/chloroform extraction and ethanol precipitation. The second method is a simplified method. Oocysts were boiled for 20 min at 100°C in PCR buffer and then directly used as a template for PCR detection.
CP-CR.8 The sequences of each primer, annealing temperature of PCR, size of amplicon are shown in Table 1.
Specificity The specificity of the PCR primers were tested against control DNA samples including C. muris, hosts of Cryptosporidium (human and bovine), intestinal protozoa (Entamoeba histolytica, Giardia lamblia and Blastocystis hominis), Ascaris lumbricoides, Trichomonas vaginalis and Escherichia coli.
Sensitivity The sensitivity given by these primers was tested by amplifying serially diluted template DNA or oocyst. Two protocols were adapted: one was one-fold dilution of purified DNA from 80 pg to 0·02 pg. The other was dilution of oocysts in a suspension (80, 40, 20, 10, 5, 2, 1 and 0–1 oocysts per PCR tube) which was subsequently heated as described above in Materials and Methods.
The detection of oocysts from raw water Development of PCR primers Arbitrary primed PCR (AP-PCR) was employed to obtain random amplified polymorphic DNA (RAPD) of Cryptosporidium samples using 10 base-pair arbitrary primer (CGGCCCCTGT). Template DNA included genomic DNA of C. parvum and C. muris. From the resulting RAPD band pattern, a dense band seen in C. parvum samples were selected, and the DNA fragment, named RAPD SB012, was extracted and sequenced as described.3 The accession number of DNA sequences of RAPD SB012 in GenBank is AF161076. Based on the DNA sequence, a pair of primers named SB012 was developed. The primer sequence was as follows: SB012 F: 5′-CTCCGTTCGATGATGCAGATG-3′; SB012 R: 5′-CGGCCCCTGTAGAAATAAGTCA-3′. PCR conditions were as follows: one cycle of initial denaturation at 94°C for 3 min; 35 cycles at 94°C for 30 s, 51–56°C (depending on the primers) for 30 s, and 72°C for 1 min; and one cycle of final extension at 72°C for 10 min. For comparison purposes, we used six pairs of primers published elsewhere, including primer SB50,4 primers LAX469 F/ LAX869R,5 AWA995 F/ AWA1206R,5 Cry44/Cry39,6 Cp.E/Cp.Z7 and 012F/
To check the practical usefulness of the primer SB012, Cryptosporidium oocysts for PCR analysis were spiked in natural water and recovered by three methods: (1) the oocysts (0, 5, 10, 20 or 40) were seeded in 1 ml river water (collected from Nagara River which is used for tap water in Gifu City), and concentrated by centrifugation; (2) the oocysts (0, 10, 50 or 100) were seeded in 2 l of the river water, recovered by filtration (1·0 lm pore size, provided by Toyo Roshi Kaisha, Ltd, Japan), and concentrated by centrifugation; (3) the oocysts (0, 10, 50 or 100) were seeded in 2 l of the river water, recovered by filtration, purified with the immuno-magnetic separation kit, and concentrated by centrifugation. These oocysts were used as PCR template after the treatment described in the Materials and Methods.
RESULTS Specificity of the constructed primer The specificity of constructed primer pairs was examined. The primer pair SB012 produced an expected band of 433 bp from C. parvum DNA (n=6), while control samples including C. muris, humans, bovine,
PCR primer to detect Cryptosporidium parvum
35
Table 1. Condition and sequence of primers to detect C. parvum Primer
Annealing Tm
Product size
51
458
51
338
52
451
54
256
58
315
54
1181
54
312
SB012F SB012R SB50F SB50R LAX469F LAX869R AWA995F AWA1206R Cry44 Cry39 Cp.E Cp.Z 012F CP-CR M 1 2 3 4
Sequence
ataaacaagcaggaaaaaaggt cgcacaagttacaaggattatt agtctttgtctttgcgtcag tcgtatttgtattggattca ccgagtttgatccaaaaagttacgaa tagctcctcatatgccttattgagta tagagattggaggttgttcct ctccaccaactaagaacggcc ctcttaatccaatcattacaac gagtctaataataaaccactg ggatgggtatcaggtaataagaa caactagcccagttctgactctctgg ggtactggatagatagtgga tccaaattattgtaacctggaag
5 6 7 8 9 10 11 12 13 14 15 16
Comparison of sensitivity of primers By varying the concentration of template DNA, the sensitivity of the primers in PCR was tested. The density of bands tended to faint when a low concentration of template DNA was used. The minimum concentration of template DNA necessary for a positive reaction in each PCR with primer SB012, SB50, LAX469/LAX869R, AWA995F/AWA1206R, Cry44/ Cry39, Cp.E/Cp.Z, and 012F/CP-CR was 0·156 pg, 0·312 pg, 0·625 pg, 80 pg, 0·156 pg, 20 pg, and 10 pg, respectively (Fig. 2, Table 2) A similar test to determine the minimum number of oocysts necessary for the PCR detection was performed by serial dilution of oocysts and subsequent PCR with the same set of primer pairs. The primer pair SB012 gave positive bands in the samples containing 80 oocysts to one oocyst (Fig. 3a). Both seven of eight samples of one oocyst (Fig. 3b) and three of eight samples of 0–1 oocyst (Fig. 3c) gave positive results, suggesting this primer could detect even single oocyst. The same results were obtained with SB50,
Fig. 1. The specificity of constructed primer pair SB012. M, 100 base-pair ladder of molecular weight marker; Lanes 1–5, five isolates of C. parvum collected from calves; Lane 6, one isolate of C. parvum collected from human; Lanes 7–13, control sample including C. muris, human, bovine, Entamoeba histolytica, Giardia lamblia, Blastocystic hominis, Ascaris lumbricoides, Trichomonas vaginalis, Trichinella spiralis and Escherichia coli.
E. histolytica, G. lamblia, B, hominis, A. lumbricoides, E. coli, T. vaginalis and T. spiralis produced negative results (shown in Fig. 1), which suggested species specificity of this primer. The specificity of the other six primers was shown in Table 2.
Table 2. Sensitivity and specificity of primers to detect C. parvum Sensitivity Primer SB012F/R SB50F/R LAX469F/R AWA995F/R Cry44/39 Cp.E/Z 012F/CP-CR a b
Target DNA RAPD RAPD Chromosomal DNA 18 S RNA Polythreonine TRAP-C1 Ribosomal DNA
Specificity
DNA (pg)
oocysts
C. parvum
C. muris
others
Reference
0·156 0·312 0·625
1 1 1
+ + +
− − −
− − −/+a
4 5
80 0·156 20 10
80 1 20 10
+ + + +
+ + − −
− +b − −
5 6 7 8
Some of control samples gave a positive band. All of control sample gave a positive band.
Z. Wu et al.
36 (a)
M
1
2
3
4
5
6
7
8
9
10 11 12 13
(a)
M
1
2
3
4
5
6
7
8
(b)
(b)
(c)
(c) (d)
(e)
Fig. 3. The sensitivity of constructed primer pair SB012 by detecting oocysts. M, 100 base-pair ladder of molecular weight marker. (a) Lanes 1–8, 80, 40, 20, 10, 5, 2, 1, 0–1 oocyst, respectively. (b) Lanes 1–8, 1 oocyst. (c) 0–1 oocyst. (f)
(g)
LAX469F/LAX869R and Cry44/Cry39, which gave positive bands in the samples containing 80 oocysts to one oocyst (Fig. 4a, b and d). On the other hand, primer pair AWA995F/AWA1206R, Cp.E/Cp.Z, 012F/ CP-CR gave positive results in the sample of 80, 20 and 10 oocysts, respectively (Fig. 4c, e and f).
Detection of oocysts from raw water
Fig. 2. The sensitivity of constructed primer pair SB012 by detecting template DNA and a comparison with other six pair of primers. M, 100 base-pair ladder of molecular weight marker; Lane 1–13, DNA amount of 80, 40, 20, 10, 5, 2·5, 1·25, 0·625, 0·3125, 0·156, 0·078, 0·039, 0·020 pg, respectively. (a) SB012; (b) SB50; (c) LAX469 F/ LAX869R; (d) AWA995 F/ AWA1206R; (e) Cry44/ Cry39; (f) Cp.E/Cp.Z; (g) 012F/CP-CR.
PCR sensitivity decreased when template DNA was from the oocysts spiked in river water. The samples spiked with oocysts in 1 ml of the river water produced positive band when more than five oocysts were seeded, as shown in Fig. 5a. When the oocysts were spiked in 2 l of the river water, filtration alone was not enough to get positive results, even if the sample was spiked with 100
PCR primer to detect Cryptosporidium parvum (a)
M
1
2
3
4
5
6
7
8
(b)
(a)
M
1
2
3
37 4
5
6
(b)
M
1
2
3
Fig. 5. The detection of Cryptosporidium from raw water with primer SB012. (a) One millilitre of water was spiked with different numbers of oocysts, and PCR was used for the detection. The numbers of spiked oocysts is 0 in Lane 1, 1 in Lane 2, 5 in Lane 3, 10, in Lane 4, 20 in Lane 5 and 40 in Lane 6. (b) Two litres water was spiked with different numbers of oocysts, and PCR was used for the detection. The numbers of spiked oocysts is 10 in Lane 1, 50 in Lane 2 and 100 in Lane 3. M, 100 base-pair ladder of molecular weight marker.
(c)
oocysts. Immuno-magnetic separation after the filtration gave better results. The samples spiked with more than 50 oocysts gave positive results (Fig. 5b).
DISCUSSION (d)
(e)
(f)
Fig. 4. The sensitivity of published six primer pairs by detecting oocysts. M, 100 base-pair ladder of molecular weight marker; Lanes 1–8, 80, 40, 20, 10, 5, 2, 1, 0–1 oocyst, respectively. (a) SB50; (b) LAX469 F/ LAX869R; (c) AWA995 F/ AWA1206R; (d) Cry44/Cry39; (e) Cp. E/Cp.Z; (f) 012F/CP-CR.
The infection of Cryptosporidium is transmitted through an oral route. Contamination of tap water by Cryptosporidium is problematic from a public health of view because cryptosporidiasis can be waterborne diseases and sometimes life threatening for immunocompromised hosts such as AIDS patients. The conventional method to diagnose C. parvum infection is detection of oocysts in faeces, which included Kinyoun,9 safranin-methylene blue,10 quinacrine staining11 and immunostaining.12 These methods are sufficient for proper diagnosis of each patient. Water control, however, is different. Many attempts have been made to detect Cryptosporidium in reservoir water; the most typical example is PCR.5,13,14 For this purpose many PCR primers have been reported. Target DNA was repetitive sequences,4 IST,15 18 S rRNA,5 and genes encoding functional peptides.7,16,17 The sensitivity of detection differs depending on the selection of priming sites. The present study compared the sensitivity of detection among seven kinds of primers, which revealed that the primer SB012 had an apparent advantage in sensitivity over six other primers. Similar sensitivity was achieved by Morgan et al.18 who employed RAPD-PCR to develop primers, suggesting RAPD-PCR seems to be one of best ways to develop highly sensitive diagnostic primers. Target DNA of the present primer is collected from a dense band of RAPD, which probably has a high
38
Z. Wu et al.
number of copies of repetitive sequences, sometimes hundreds of thousands to millions of copies.19 The function of repetitive sequences is still unknown, but comprise 42% of genomic DNA in nematode Trichinella.20 This high number of copies led to the advantage as a PCR priming site. Another source of target DNA can be ribosomal DNA (DNA encoding 18 S RNA) which also has a high number of copies per cell.19 In our preliminary experiment, a 479 bp DNA fragment of rDNA (GenBank accession number is AF093493) was used to construct primers (18-1 F: 5′-TTATACGGTTAAACTGCGAA-3′; 18-2 R: 5′GCTGCTGGCACCAGACTTG-3′) because this fragment seemed to be conservative among different strains of C. parvum. This primer resulted in equivalent sensitivity to SB012, but some control samples also gave positive bands with same or different bp sizes (data not shown). Rochille et al.5 had similar problems in that the PCR primers developed from 18 s rDNA amplified C. muris and C. beileyi also. Ribosomal DNA is functional in all kinds of biological beings, therefore it may be difficult to construct primers with narrow specificity. Because reservoir water is contaminated with numerous and unknown microorganisms, ribosomal DNA may not be a good choice for target DNA of PCR detection for Cryptosporidium. The best sensitivity in PCR is given when sample oocysts were suspended in distilled water. However, the usage of river water (mimicking natural conditions) lowers the sensitivity as reported by Sluter et al.,21 but not diminish the specificity even the river water is supposed to contain numerous microorganisms. In conclusion, we successfully constructed most sensitive PCR primers specific for C. parvum.
ACKNOWLEDGEMENTS A part of this study was supported by a Grant-in-Aid for Scientific Research (09670255) from the Ministry of Education, Science and Culture, the Ministry of Health and Welfare of Japan, and Ohyama Health Foundation Inc.
REFERENCES 1. Current, W. L. & Garcia, L. S. (1991). Cryptosporidiosis. Clinical Microbiology Review 4, 325– 58. 2. Morgan, U. M. & Thompson, R. C. A. (1998). PCR detection of Cryptosporidium, the way forward? Parasitology Today 14, 241–5. 3. Wu, Z., Nagano, I. & Takahashi, Y. (1998). The detection of Trichinella with polymerase chain reaction (PCR) primers constructed using sequences of random
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
amplified polymorphic DNA (RAPD) or sequences of complementary DNA encoding excretory-secretory (E-S) glycoproteins. Parasitology 117, 173–83. Wu, Z., Iseki, M., Kimata, I., Xu, D., Nagano, I., & Takahash, Y. (1995). Construction of polymerase chain reaction primer to detect Cryptosporidium parvum or C. muris. Journal of Protozoology Research 5, 149–56. Rochelle, P. A., de Leon, R., Stewart, M. H. & Wolfe, R. L. (1997). Comparison of primers and optimization of PCR conditions for detection of Cryptosporidium parvum and Giardia lamblia in water. Applied and Environmental Microbiology 63, 106–14. Carraway, M., Tzipori, S. & Widmer, G. (1997). A new restriction fragment length polymorphism from Cryptosporidium parvum identifies genetically heterogeneous parasite populations and genotypic changes following transmission from bovine to human hosts. Infection and Immunity 65, 3958–360. Spano, F., Putignani, L., Guida, S. & Crisanti, A. (1998). Cryptosporidium parvum: PCR-RFLP analysis of the TRAP-C1 (thrombospondia-related adhesive protein of Cryptosporidium-1) gene discriminates between two alleles differentially associated with parasite isolates of animal and human origin. Experimental Parasitology 90, 195–8. Morgan, U. M., Constantine, C. C., Forbes, D. A. & Thompson, R. C. A. (1997). Differentiation between human and animal isolates of Cryptosporidium parvum using rDNA sequencing and direct PCR analysis. Journal of Parasitology 83, 825–30. Anusz, K. Z., Mason, P. H., Riggs, M. W. & Perryman, L. E. (1990). Detection of Cryptosporidium parvum oocysts in bovine feces by monoclonal antibody capture enzyme-linked immunosorbent assay. Journal of Clinical Microbiology 28, 2770–4. Baxby, D., Blundellm, N. & Hart, C. A. (1984). The development and performance of a simple, sensitive method for the detection of Cryptosporidium oocysts in faeces. Journal of Hygiene 93, 317–23. Ungureanu, E. M. & Dontu, G. E. (1992). A new staining technique for the identification of Cryptosporidium oocysts in faecal smears. Transactions of the Royal Society of Tropical Medicine and Hygiene 86, 638. Webster, K. A., Smith, H. V., Giles, M., Dawson, L. & Robertson, L. J. (1996). Detection of Cryptosporidium parvum oocysts in faeces: comparison of conventional coproscopical methods and the polymerase chain reaction. Veterinary Parasitology 61, 5–13. Johnson, D. W., Pieniazek, N. J., Griffin, D. W., Misener, L. & Rose, J. B. (1995). Development of a PCR protocol for sensitive detection of Cryptosporidium oocysts in water samples. Applied and Environmental Microbiology 61, 3849–55. Kaucner, C. & Stinear, T. (1998). Sensitive and rapid detection of viable Giardia cysts and Cryptosporidium parvum oocysts in large-volume water samples with wound fiberglass cartridge filters and reverse transcription-PCR. Applied and Environmental Microbiology 64, 1743–9. Cai, J., Collins, M. D., McDonald, V. & Thompson, D. E. (1992). PCR cloning and nucleotide sequence determination of the 18 S rRNA genes and internal transcribed spacer 1 of the protozoan parasites Cryptosporidium parvum and Cryptosporidium muris. Biochimica et Biophysica Acta 1131, 317–20.
PCR primer to detect Cryptosporidium parvum 16. Rochelle, P. A., Ferguson, D. M., Handojo, T. J., De Leon, R., Stewart, M. H. & Wolfe, R. L. (1997). An assay combining cell culture with reverse transcriptase PCR to detect and determine the infectivity of waterborne Cryptosporidium parvum. Applied and Environmental Microbiology 63, 2029–37. 17. Wagner-Wiening, C. & Kimmig, P. (1995). Detection of viable Cryptosporidium parvum oocysts by PCR. Applied and Environmental Microbiology 61, 4514– 16. 18. Morgan, U. A., O’Brien, P. A. & Thompson, R. C. A. (1996). The development of diagnostic PCR primers
39
for Cryptosporidium using RAPD-PCR. Molecular and Biochemical Parasitology 77, 103–8. 19. Wolfe, S. L. (1993). Organization of the genome and genetic rearrangements. In Molecular and Cellular Biology (Wolfe, S. L., ed.) Pp. 740–60. Belmont, CA: Wadsworth Publishing Company. 20. Searcy, D. G. & MaClinnis, A. J. (1970). Measurement by DNA renaturation of the genetic basis of parasite reduction. Evolution 24, 796–806. 21. Sluter, S. D., Tzipori, S. & Widmer, G. (1997). Parameters affecting polymerase chain reaction detection of waterborne Cryptosporidium parvum oocysts. Applied Microbiology and Biotechnology 48, 325–30.
