Templates for sequential assembly of DNA based nanostructures

Proceedings of 2005 5th IEEE Conference on Nanotechnology Nagoya, Japan, July 2005

Templates for Sequential Assembly of DNA Based Nanostructures Michael Norton, Aoune Barhoumi and David Neff Department of Chemistry, Marshall University, Huntington, WV 25755 USA Abstract — Elements of the design, synthesis, cloning, amplification, isolation and characterization of template strands of DNA applicable to the parallel construction of nanostructures via sequential assembly processes are described. Particularly, codes have been filed within bacteria which can be accessed to obtain one micron long single stranded DNA molecules which contain multiple copies of a 32nm repetitive sequence. Characterization of these template strands has been performed using Atomic Force Microscopy. Index Terms — Arrays, assembly, atomic force microscopy, biological materials, DNA, parallel processing, periodic structures.

I. INTRODUCTION Several approaches to the assembly of nanostructures have been described [1]. The method of Directed Sequential Assembly, is the pathway to nanostructure formation selected for elaboration. The process of sequential assembly has several requirements. The essential chemical assembly steps must be self limiting, the growth steps may be either cyclical for periodic structure formation, or non-cyclical to enable assembly of aperiodic structures, and the structures must be amenable to purging of unreacted species between growth steps. Although these constraints are significant, the sequential assembly process is capable of conveying exquisite dimensional control of structures, as demonstrated in the particular example of ALE, or Atomic Layer Epitaxy [2]. In contrast to ALE, where the unidimensional growth is initiated on a two dimensional substrate, the objective of directed sequential assembly as described here is to grow thin organic films, composed of DNA and derivativised DNA, much the same way that tapestries are woven from threads. A periodic template strand is immobilized on a surface, allowing solution aliquots containing reagents, in the form of DNA building blocks [3] to bind in a self limiting reaction. The following step, a rinse procedure, is only made possible through by the immobilization of the template. Punctuated by similar rinses, a sequence of other solutions, containing other DNA based building blocks designed with recognition elements which provide for self limiting binding, are performed in a step like manner. The final product is a two dimensional two

0-7803-9199-3/05/$20.00 ©2005 IEEE

nanometer thin organic film which may be modulated in one dimension through modulation of the block composition in the growth direction or in two dimensions, if the template is also modulated in composition. This template strand, here termed a Director strand, is then the core element for nanostructure formation via the directed sequential assembly process. The design, synthesis, cloning (or biofiling of the sequence), amplification, isolation and characterization are described next. II. EXPERIMENTAL APPROACH The 95 base pair linear repetitive sequence was designed to be compatible with the DNA blocks described in reference [3]. The sequence, which is provided below, contains no repeats which are greater than 3 bp in length. 5’GCTGCTGTCCGATGCGGTCACTGGTTAGTCCATG ATGCACGGTAGCGCCGTTAGTCCAACTGGCATGT AGTATCGTCCGATGCAACCAGCGTCAG-3’. The circularization of this sequence, and the production of lengthy segments composed of concatenations of this sequence have been described previously [4]. Short segments of these concatenated sequences were cloned into e-coli as a means of biofiling the sequence. Filing, or the introduction of the sequence into a self replicating system affords a relatively secure permanent storage mechanism for the structure, while also providing a mechanism for amplification. The cloning method employed is described below. A two step amplification method is employed to access the biofiled sequence. The first step is an amplification utilizing PCR (Polymerase Chain Reaction), which produces double stranded DNA. The second amplification step involves asymmetric amplification, also utilizing DNA polymerase. This method of amplification is also described in the next section. The product strands are purified using standard methods of DNA isolation. Product strands are characterized using both traditional gel electrophorsis methods and using Atomic Force Microsopy.

III. EXPERIMENTAL METHODS A. Biofiling the Sequences The insert was designed with one restriction site at each end, sites for EcoRI and XbaI, to allow insertion into the pGEM vector, a commercial vector from Promega The sequence was ligated into the vector then introduced to UltraMaxT M DH5_-FTT M Competent Cells from Invitrogen. The clones containing inserts were screened using a blue/white insert assay and the size of the insert was determined using gel electrophoresis. Promising clones were selected, grown in culture tubes and the plasmids were purified using a Miniprep kit from Qiagen. Selected clones were sequenced by the Integrated Biotechnololgy Laboratories Facility at the University of Georgia. B. Amplification In order to prepare the one micron long double stranded DNA, 100 ng of the purified plasmid containing 6 repeats (purified using QIAprep Spin Miniprep Kit from QIAGEN) is used as the template for symmetric PCR. Both the forward and reverse primers are 25 base pairs long. The PCR Core Kit from Roche is used, with1 bead of Taq Bead hot start PCR (from Promega). The amplification cycle is started with a 94 degrees step for 5 min, followed by 20 cycles of 90 degree for 15 sec, 58 degrees for 30 sec, and 72 degrees for 3 min. A final extension step of 72 degree for 10 min completes the amplification. In order to prepare single stranded DNA, an asymmetric PCR protocol has been developed which uses the symmetric PCR product described above as the template (purified using QIAquik PCR Purification Kit from QIAGEN). The purification step is meant to eliminate primers remaining from the symmetric synthesis. Unlike symmetrical PCR, in the asymmetric PCR only one primer is used. Being a linear amplification technique, one must start with a higher template concentration to enable post amplification characterization with gel electrophoresis. To synthesize 1 micron thiolated ssDNA sequence, only the 25 base pair forward primer is used in the amplification. The concentration of the primer used is 40 pmol/ul. 1ul of the double stranded template (225 ng) is used with the PCR Core Kit from Roche. The polymerase used is one bead of Taq Bead hot start PCR (from Promega). The thermal program described above for the symmetrical PCR reaction is also used for the asymmetric PCR reaction. C. Characterization: Gel Electrophoresis Two types of gels were used in this study, TBE-Urea precast gels from ( B I O - R A D ) , and agarose gels (SeaPlaque GTG agarose from C A M B R E X ). 1X TBE

buffer was used as the running buffer, SYBR Green I (Molecular Probes) 1:10000 in 1X TBE buffer was used for staining double stranded DNA and Reflex (Transbio Corporation) was used to exclusively stain single stranded DNA. Quantity 2.2 Bio-Rad software was used for gel image analysis. D. Characterization: Atomic Force Microscopy AFM images were acquired using a ThermoMicroscopes Explorer scanning probe microscope in AFM mode with a dry scanner scan head. We used amplitude feedback in noncontact mode. During acquisition the scanner was covered to minimize imaging artifacts caused by acoustic and thermal effects. IV. RESULTS AND DISCUSSION A. Biofiling the Sequences Several promising clones were identified. At this time, however, the clone containing the largest number of repeats contains a concatenation of six 95 bp repeats. CTTGACCTGATTCGCCAGCTATTTAGGTGA CACTATAGAATACTCAAGCTTGCATGCCTG C A G G T C G A CT C T A G AT C G G A C A G C A G C C T G ACGCTGGTTGCATCGGACGATACTACATGC CAGTTGGACTAACGGCTCTACCGTGCATCA T G G A C T A A C C A G T G A C C G C AT C G G A C A G C A GCCTGACGCTGGTTGCATCGGACGATAATA CATGCCAGTTGGACTAACGGCGCTACCGTG C A T C A T G G A C T A A C C A G T G A C C G C AT C G G A CAGCAGCCTGACGCTGGTTGCATCGGACGA TACTACATGCCAGTTGGACTAACGGCGCTA CCGTGCATCATGGACTAACCAGTGACCGCA TCGGACAGCAGCCTGACGCTGGTTGCATCG GACGATACTACATGCCAGTTGGACTAACGG CGCTACCGTGCATCATGGACTAACCAGTGA C C G C AT C G G A C A G C A G C C T G A C G C T G G T T G CATCAGACGATACTACATGCCAGTTGGACT AACGGCGCTACCGTGCATCATGGACTAACC A G T G A C C G C AT C G G A C A G C A G C C T G A C G C T GGTTGCATCGGACGATACTACATGCCAGTT GGACTAACGGGCGCTACCGTGCATCATGGA C T A A C C A G T G A C C G C AG A A T T C G C C C T A T A GTGAGTCGTATTACAATTCACTGGCCGTCG TTTTACAACGTCGTGACTGGGAAAACCCTG GCGTTAC

Figure 1: Sequencing result. Each copy is depicted in a different color; the red color shows the EcoRI and XbaI restriction sites introduced into the DNA fragment.

B. Amplification Characterized Using Gel Although asymmetric PCR produces linear rather than logarithmic amplification, significant amplification is demonstrated in the gel image provided in Fig. 2 below.

The single stranded product (lane 3 of Fig. 2) is shown by gel electrophoresis to display the expected length. The fact that the primer is required in order to observe amplification is demonstrated by the fact that lane 1, which has been exposed to all conditions necessary for amplification and lane 2, which contains only the template, are of almost identical intensity. The AFM image provided in Fig. 3 displays several segments of DNA which appear to be one micron in length.

V. CONCLUSIONS

Figure 2 . Gel Image representative of amplification results obtained using asymmetric PCR. L: 1 Kb ladder, 1 n o primer added, 2 template control, 3 single stranded amplicon.

C. Characterization: Atomic Force Microscopy

Directed Sequential Assembly provides an alternative avenue to nanostructure fabrication. Of the several requirements for implementation of the method, a central challenge is design and fabrication of long single stranded segments of DNA which can act as directors, or nucleation sites for nanostructure assembly. This work has demonstrated not only a successful pathway to such structured polymers, but a biological storage mechanism which provides a ready route for transferring this code from one laboratory to another. Avoiding repetitive synthesis of these lengthy sequences may speed the development of nanosystems based upon this approach. Although the sequences developed and described here contain fewer repeats than optimal, they are quite satisfactory for prototyping DNA based nanostructrues. ACKNOWLEDGEMENT The authors wish to acknowledge the support of ARO grant DAAD19-01-1-0460 and a Research Challenge Grant administered by the West Virginia Higher Education Policy Commission. REFERENCES

Figure 3. AFM image of one micron long double stranded DNA Director Strands (image width is 7 microns)

[1] H. Yan, T.H. LaBean, L. Feng and J.H. Reif, “Directed Nucleation Assembly of DNA Tile Complexes for Barcode-Patterned Lattices”, PNAS, vol 100, pp. 8103 – 8108, 2003. [2] W. T. Suntola, J. Hyvärinen, "Atomic Layer Epitaxy", Ann. Rev. Mater. Sci. vol.15, pp. 177, 1985. [3] E. Winfree, F. Liu, L. A. Wenzler, and N.C. Seeman, “Design and Self-Assembly of Two-Dimensional DNA Crystals”. Nature, vol. 394, pp. 539-544, 1998. [4] M. Norton, Aoune Barhoumi and D. Neff, “Toward Large Nanostructures”, Proceedings 2003 3r d IEEE Conference on Nanotechnology, 2003.