JOURNAL OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE RESEARCH J Tissue Eng Regen Med (2015) Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/term.2004
ARTICLE
TGFβ3 secretion by three-dimensional cultures of human dental apical papilla mesenchymal stem cells Rodrigo A. Somoza1*, Cristian A. Acevedo1, Fernando Albornoz1, Patricia Luz-Crawford2, Flavio Carrión2, Manuel E. Young1 and Caroline Weinstein-Oppenheimer3 1
Centro de Biotecnología, Universidad Técnica Federico Santa María, Valparaíso, Chile Laboratorio de Inmunología, Universidad de los Andes, Santiago, Chile 3 Escuela de Química y Farmacia, Facultad de Farmacia, Universidad de Valparaíso, Chile 2
Abstract Mesenchymal stem cells (MSCs) can be isolated from dental tissues, such as pulp and periodontal ligament; the dental apical papilla (DAP) is a less-studied MSC source. These dental-derived MSCs are of great interest because of their potential as an accessible source for cell-based therapies and tissueengineering (TE) approaches. Much of the interest regarding MSCs relies on the trophic-mediated repair and regenerative effects observed when they are implanted. TGFβ3 is a key growth factor involved in tissue regeneration and scarless tissue repair. We hypothesized that human DAP-derived MSCs (hSCAPs) can produce and secrete TGFβ3 in response to micro-environmental cues. For this, we encapsulated hSCAPs in different types of matrix and evaluated TGFβ3 secretion. We found that dynamic changes of cell–matrix interactions and mechanical stress that cells sense during the transition from a monolayer culture (two-dimensional, 2D) towards a three-dimensional (3D) culture condition, rather than the different chemical composition of the scaffolds, may trigger the TGFβ3 secretion, while monolayer cultures showed almost 10-fold less secretion of TGFβ3. The study of these interactions is provided as a cornerstone in designing future strategies in TE and cell therapy that are more efficient and effective for repair/regeneration of damaged tissues. Copyright © 2015 John Wiley & Sons, Ltd. Received 3 February 2014; Revised 2 October 2014; Accepted 7 January 2015
Keywords
mesenchymal stem cells; SCAP; TGFβ3; alginate; fibrin; 3D culture
1. Introduction It is estimated that, every year, millions of people worldwide are left with skin scars after damage caused by trauma or degenerative diseases. Tissue engineering (TE) has enabled the development of novel strategies that allow proper tissue healing under conditions in which traditional therapeutic methods are not effective. These approaches are based mainly on the development of skin substitutes using scaffolds and cells, which are implanted after damage. Mesenchymal stem cells (MSCs) have great therapeutic potential because of their multilineage
*Correspondence to: R. A. Somoza, Centro de Biotecnologia, Universidad Federico Santa Maria; Avda España 1680, Valparaiso, Chile. E-mail:
[email protected] Copyright © 2015 John Wiley & Sons, Ltd.
differentiation capacity (Somoza and Rubio, 2012), ease of isolation from multiple adult tissues (da Silva Meirelles et al., 2006; Huang et al., 2009) and secretion of growth factors (GFs) (Caplan and Dennis, 2006; Meirelles et al., 2009). This trophic activity has emerged as the main therapeutic effect of MSCs when implanted for tissue regeneration purposes (Meirelles et al., 2009). These findings have allowed the elucidation of a perivascular in vivo niche of MSCs as pericytes, in which they participate in the homeostasis and repair of vascularized tissues (Crisan et al., 2008). MSCs secrete a great variety of cytokines and GFs that mediate anti-apoptotic, angiogenic, immunoregulatory and anti-scarring processes, along with others (Meirelles et al., 2009). Several of these GFs are important in TE approaches, including basic fibroblast GF (bFGF), vascular endothelial growth factor (VEGF), platelet-derived GF (PDGF) and hepatocyte GF (HGF)
R. A. Somoza et al.
(Barrientos et al., 2008). Nevertheless, TGFβ3 secretion by MSCs has not been described, although its mRNA expression has been detected as part of broader analysis of expression in bone marrow-derived MSCs (Park et al., 2007) and periodontal ligament-derived cells (Pinkerton et al., 2008). TGFβ3 plays a key role in tissue regeneration and better quality repair without scar tissue generation (Ferguson and O’Kane, 2004). This role was evident as TGFβ3 is the most widely expressed TGFβ isoform in embryonic tissue and oral mucosa, in comparison to TGFβ1, TGFβ2 and other GFs involved in tissue repair (Occleston et al., 2008; Schrementi et al., 2008). Studies in animals and humans have established that the exogenous application of TGFβ3 produces an accelerated repair, together with an orderly remodelling of ECM, which ultimately produces a strong and elastic tissue, unlike scar formation (Ferguson et al., 2009; Hao et al., 2008). As MSCs are considered pericytes, orchestrating repair process in vascularized tissues, it has been proposed that they may be activated by unspecified injury signals, which directs them towards a medicinal cell phenotype (trophic) that will produce bioactive molecules locally (Caplan and Correa, 2011). The conditions that produce the specific activation of MSCs need to be investigated. It has been suggested that these activation elements are injury-like signals provided by damaged tissue (Liu et al., 2006; Oh et al., 2009). Probably these signals are unspecified soluble or ECM-derived factors; however, signals produced by mechanical forces might have an effect on the ’medicinal’ phenotype of MSCs (Engler et al., 2006; Pinkerton et al., 2008; Wang and Thampatty, 2008). The objective of this work was to evaluate the production and secretion of TGFβ3 by MSCs isolated from the human dental apical papilla (hSCAPs) when cells are cultured under 3D conditions within scaffolds, as a means of evaluating matrix interaction effects on MSCs behaviour.
present in sufficient numbers. When the cells reached 80% confluence they were detached with a 0.25% trypsin/2.65 mM EDTA solution and further expanded.
2.2. Immunomagnetic cell sorting Cell sorting based on CD105 and CD271 (MSCs markers) co-expression was performed using CELLection™ Pan Mouse IgG Dynabeads® (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s guidelines; 1 × 107 cells were suspended in PBS + 0.1% bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, MO, USA) and 0.6% sodium citrate (Merck) at 4°C and mixed with 25 μl microbeads coated with CD105 (Invitrogen) and CD271 (Abcam) monoclonal antibodies. The positive bound cells were then isolated from the unbound cells using a magnet. Sorted cells were detached from the microspheres with DNAse (Invitrogen). CD105/CD271-positive and -negative cells were further expanded until sufficient numbers were achieved for subsequent experiments. Expression of CD271 and CD105 was confirmed by immunocytofluorescence (data not shown). Passage 2–4 cells were characterized based on the minimal criteria stated by the International Society for Cellular Therapy for MSC denomination (Dominici et al., 2006).
2.3. Cellular viability and proliferation To examine cell viability and proliferation, we performed a colorimetric assay using WST-1 reagent (Roche, Germany), a tetrazolium salt that is converted into formazan dye by mitochondrial dehydrogenases. Cells were seeded at a density of 4 × 103 cells/cm2 and, at different time points (24, 48 and 72 h), the assay was performed following the manufacturer’s instructions. The absorbance at 450 nm was normalized with respect to day 0.
2. Methods
2.4. Mesenchymal differentiation protocols
2.1. Cell culture
For adipogenic and osteogenic differentiation, cells were seeded at a density of 2.5 × 104 cells/cm2 and later stimulated with adipogenic induction medium [DMEM low-glucose, supplemented with 100 mg/ml isobutylmethylxanthine (Calbiochem, La Jolla, CA, USA), 1 mM dexamethasone, 0.2 U/ml insulin (Humalog) and 100 mM indomethacin (Sigma-Aldrich)] or osteogenic induction medium [DMEM low-glucose, containing 10% FBS, 0.1 mM dexamethasone, 50 μg/ml ascorbate-2phosphate and 10 mM β-glycerophosphate (Sigma-Aldrich)] for 10 and 21 days, respectively. To assess adipogenic and osteogenic differentiation, intracellular lipid droplets were revealed by staining with oil red O (Merck, West Point, PA, USA) and matrix mineralization by staining with alizarin red (Sigma-Aldrich), respectively. For chondrogenic differentiation, cells were cultured at a density of 5 × 103 cells/ml in 10 μl DMEM high-glucose containing 10% FBS to achieve the adequate
Dental apical papilla tissues were isolated from exfoliated third molars from patients aged 15–35 years. Each patient signed an informed consent after the tooth was extracted, due orthodontic reasons and after the authorization of the dental surgeon. Successful isolation of viable cells was achieved from four samples (four donors). The dental tissues were washed several times with phosphatebuffered saline (PBS; 0.1 M, pH 7.3) supplemented with streptomycin–penicillin (100 μg/ml and 100 U/ml; Gibco, USA). The tissue was cut into 1–2 mm3 pieces and then placed on 10 cm2 culture dishes in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone Thermo-Scientific, USA) supplemented with 10% fetal bovine serum (FBS; Biological Industries, Israel) and streptomycin–penicillin. The explants were incubated in a humidified atmosphere at 37°C in 5% CO2 until outgrowing cell colonies were Copyright © 2015 John Wiley & Sons, Ltd.
J Tissue Eng Regen Med (2015) DOI: 10.1002/term
TGFβ3 secretion by hSCAPs
three-dimensional (3D) conditions for micromass formation. After 2 h the medium was replaced with chondrogenic differentiation medium (DMEM highglucose, supplemented with 0.1 μM dexamethasone, 50 μg/ml ascorbate-2-phosphate, 0.2 U/ml insulin and 10 ng/ml TGFβ3). After 7 days, proteoglycan deposition was revealed with safranin O (Merck) staining. Nonstimulated cultures were used as a control and were maintained in DMEM with 10% FBS; the medium was replaced twice a week.
2.7.2. In alginate Cells were seeded on 1.2% w/v alginate in 0.9% NaCl solution, pH 7.2, at a density of 4 × 105 cells/ml. The alginate–cell solution was deposited drop by drop on a 100 mM CaCl2 solution under constant gentle agitation, using a 22G syringe and a perfusion pump. The capsules were incubated for 10 min in the CaCl2 solution under agitation and then washed three times with 0.9% NaCl. The capsules were cultured on the wells of a 24-well plate with standard medium (DMEM, 10% FBS) for various time periods.
2.5. Flow-cytometry immunophenotype determination A total of 0.5 × 106 cells were incubated with specific individual monoclonal antibodies (1:200 dilutions), conjugated with fluorescein isothiocyanate (FITC) or phycoerythrin (PE) in 200 μl PBS for 30 min in the dark at room temperature. The primary antibodies used were CD34 (Beckmann Coulter), CD44 (Caltag, Invitrogen), CD45 (Immunotech, Beckmann Coulter), CD73 (BD Pharmingen), CD90 (BD Pharmingen) and CD105 (Caltag, Invitrogen). The cells were then diluted in 4 ml PBS, centrifuged and then resuspended with 600 μl PBS–formaldehyde (2%). Acquisition and analysis were performed using a flow cytometer (Coulter Epics XL, Beckman Coulter, Gainesville, FL, USA) and System II Software (Beckman Coulter). The isotype controls used were immunoglobulin G (IgG)1 FITC and IgG1 PE monoclonal antibodies.
2.6. Intracellular determination of TGFβ3 Cells were fixed and permeabilized with Fix and Perm® reagents (Invitrogen) and incubated with TGFβ3 monoclonal antibody (RandD Systems, USA), followed by washing steps and incubation with AlexaFluor 488 secondary antibody (Invitrogen).
2.7. 3D culture 2.7.1. In fibrin A fibrin clot was prepared using a fibrinogen solution (54 mg/ml) consisting of lyophilized fibrinogen [78% protein, 87% clottable protein (Sigma)] in sterile milliQ (mQ) water at 37°C and a thrombin solution (300 NIH/ml), which was prepared by dissolving thrombin (MP ICN Biomedicals, USA) in sterile mQ water at 37°C with CaCl2 (30 mM) and NaCl to adjust the osmolarity to 300 mOsM. Passage 4 cells (4 × 105 cells/ml) were suspended in the thrombin solution and mixed with an equal volume of fibrinogen solution (25 μl each). The fibrin capsules were cultured on standard medium (DMEM 10% FBS) for different time periods. Copyright © 2015 John Wiley & Sons, Ltd.
2.8. In integrated implant system (IIS) IIS is a chitosan–gelatin–hyaluronan polymeric scaffold, which was prepared using the method described by Liu et al. (2004). Briefly, a 1% gelatin solution (USP grade, Merck, Germany) was mixed with chitosan (2% in 1% acetic acid) and hyaluronic acid (0.01%) at 50°C in proportions of 7:2:1, respectively. The polymers solution was then poured into a Petri dish, cooled, frozen and lyophilized using a LioBras L101 (Brazil). The matrix was crosslinked by the use of a 50 mM 2-morpholino-ethanesulphonic acid (MES), 20 mM 1-ethyl-(3,3-dimethyl-aminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) (MES–EDC–NHS) solution. The scaffold was then cut into 1 × 1 cm pieces and disinfected by incubation with 75% ethanol for 24 h. The cells were integrated onto the scaffold by in situ gelification of fibrin (20 mg/ml fibrinogen and 130 NIH/ml thrombin plus 30 mM CaCl2).
2.9. Conditioned media Media were collected at different time points (24, 48 and 72 h) from the different culture conditions (triplicates), centrifuged at 2500 × g, stored at –80°C and thawed at the time of analysis. Lactate production and glucose consumption by cells were measured in triplicate in the conditioned media, using commercial enzymatic kits (Sentinel Diagnostic, Italy).
2.10. ELISA assay Levels of active TGFβ3 in the conditioned media were quantified using an ELISA kit (DuoSet ELISA, RandD Systems, Minneapolis, MN, USA), according to the manufacturer’s directions. Prior to ELISA determination, TGFβ3 present in the conditioned medium was activated with 1 N HCl and then the solution was neutralized with 1.2 N NaOH and HEPES. The optical density (OD) at 450 nm was read using a Bio-Rad 550 microplate reader. J Tissue Eng Regen Med (2015) DOI: 10.1002/term
R. A. Somoza et al.
2.11. RT–PCR analysis Total RNA was isolated using TRIZOL® reagent (Invitrogen) according to the manufacturer´s instructions. RNA concentration was determined spectrophotometrically, followed by treatment with RNase-free DNase (Invitrogen). Then, 1 μg total RNA was used for reversetranscription of mRNA molecules to DNA copies. Real-time PCR was performed in a capillary containing cDNA, PCR LightCycler-DNA Master SYBR Green reaction mix (Roche, Indianapolis, IN, USA), 3–4 mM MgCl2 and 0.5 mM of each specific primer (see Table 1), using a LightCycler® thermocycler (Roche). To ensure that amplicons were derived from mRNA and not from genomic DNA amplification, negative controls without reverse transcriptase were performed. Negative PCR results were validated by amplification of the housekeeping gene GAPDH. All primers were designed using AmplifX software (Nicolas Jullien; CNRS, Aix-Marseille Université, France).
2.12. Biostatistical analysis Biostatistical analyses were performed using a multivariate approach. Analyses were done using SIMCA-P (UMETRICS, Sweden) and Multiexperimental Viewer (TM4) software (Saeed et al., 2003). The statistical tools used included principal component analysis (PCA), contribution analysis based on PCA, hierarchical clustering (Ward dendrogram) and Pearson’s correlation analysis. Cross-validation was performed to determine the optimal number of principal components (Bro et al., 2008). Eleven kinds of variables were used: biomass, cell growth rate, glucose (concentration and consumption), lactate (concentration and production), TGFβ3 (concentration, production and mRNA), EGF mRNA and PDGF mRNA. The data (observation) used to fit the statistical models were obtained from different states of cell cultures studied: monolayer cell culture, fibrin cell culture and alginate cell culture (each being sampled at 24, 48 and 72 h).
3. Results 3.1. Cell isolation and compliance with the stemness definition Based on the Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy
recommendations for the minimal criteria to define human MSCs (Dominici et al., 2006), the cells were characterized based on their morphology, adherence to plastic, tri-mesenchymal lineage differentiation potential (adipogenic, osteogenic and chondrogenic) and expression of CD105, CD73, CD90 and CD44 surface markers and lack of expression for haematopoietic markers, such as CD34 and CD45 (Figure 1). Explant-derived cells from DAP were sorted using immunomagnetic beads, based on CD271 and CD105 co-expression. Expression of both markers was confirmed by immunocytofluorescence after the cell-sorting procedure (data not shown). Although most cells were CD105-positive (CD105+), CD271 expression was not observed in all CD105+ cells and probably we had a heterogeneous population of cells based on the expression of these two markers. The CD271+CD105+ sorted cells exhibited different properties compared with their CD271–CD105– counterparts, which is in agreement with the MSC definition, i.e. they adhere to plastic (Figure 1A), show higher proliferation rates and differentiate through mesodermal lineages (Figure 1B–D, Table 2).
3.2. TGFβ3 production by hSCAP-derived CD105+CD271+ cells Preliminary data based on dot–blot analysis suggested that monolayer cultures of hDAP-derived CD105+CD271+ cells did not secrete TGFβ3 into the medium (data not shown). However, intracellular flow-cytometry analysis revealed that these cells were in fact producing TGFβ3 but were not secreting it into the medium (Figure 2).
3.3. Three-dimensional (3D) culture of hSCAP-derived CD105+CD271+ cells The results shown in Figure 2 prompted the search for culture conditions that could allow these cells to secrete TGFβ3 to the medium. For the study of the effects of 3D culture conditions on hSCAP-derived CD105+CD271+ cells, they were immobilized on three different types of matrix: alginate, fibrin and a chitosan-based scaffold. Alginate is a polysaccharide derived from algae, which does not provide adequate signalling to cells, since it lacks adhesion ligands such as the arginine–glycine– aspartic acid (RGD) peptide sequence. This is not the case of fibrin and chitosan, both containing
Table 1. Primer sequences used for GF gene expression analysis Gene TGFβ3 EGF FGF-2 VEGF PDGF GAPDH
Forward primer (5′–3′)
Reverse primer (5′–3′)
Amplicon (bp)
Accession No.
agcgctatatcggtggcaagaatc tggcccagtggaataacgattgac gtgctaaccgttacctggctatga ttgcttgccattccccacttga tgagatgctgagtgaccactcgat caaaatcaagtggggcgatgctg
cctccaagttgcggaagcagtaat caccaagcagttccaagcctcttt tatagctttctgcccaggtcctgt gaacagcccagaagttggacgaaa cactgtctcacacttgcatgcca tgtggtcatgagtccttccacgat
390 308 206 390 460 283
NM_003239.2 NM_001963.4 NM_002006.4 NM_003376.5 NM_002608.2 NM_002046.4
Copyright © 2015 John Wiley & Sons, Ltd.
J Tissue Eng Regen Med (2015) DOI: 10.1002/term
TGFβ3 secretion by hSCAPs
+
+
+
+
Figure 1. Characterization of hSCAP-derived CD105 CD271 cells. (A) Adherent layers of cultured hSCAP-derived CD105 CD271 cells. (B) Alizarin red staining as an indication of calcium deposition after osteogenic induction. (C) Lipid accumulation was detected with oil red O staining after adipogenic induction. (D) Safranin O staining as an indicator of proteoglycan production and micromass formation after chondrogenic induction. (E) Flow-cytometry data, showing expression of the MSC surface markers CD105, CD90, CD73 and CD44 and negative for CD34 and CD45. Black-filled histograms represent cells incubated with unrelated isotype-matched antibodies
+
+
Table 2. Properties of CD271 CD105 hSCAPs
hSCAP +
+
CD271 CD105 – – CD271 CD105
–
–
and CD271 CD105
Mesenchymal differentiation
Populaton-doubling time (PDT) (h)
A
O
C
35 51
+ –
+ +
+ –
A, adipocytes; O, osteoblasts; C, cartilage.
adhesion-signalling moieties. The cell immobilization procedure did not affect the viability of the cells (data not shown). However, changes in proliferative capacity and metabolic activity were seen in immobilized cells
(Figure 3). Proliferation in 3D culture conditions slightly decreased relative to monolayer culture (Figure 3A) and the lowest proliferation rate was seen in cells immobilized in alginate. To measure metabolic activity, glucose consumption and lactate production on cells cultured under the different conditions were determined (Figure 3B, C). Cells in 3D conditions, regardless of the type of scaffold, consumed less glucose, whereas lactate production was variable among the conditions. In order to quantify the differences in metabolic activity among the growth conditions, the lactate/glucose yield was calculated (Ylactate/glucose, Figure 3D): a value in the range 0–2 implies a normal cell metabolism, whereas a Ylactate/glucose > 2 indicates that the cell energetic metabolism changed drastically, which could mean, for example, that cells under these culture
+
+
Figure 2. Intracellular expression of TGFβ3 by hSCAP-derived CD105 CD271 . Intracellular expression of TGFβ3 was assessed by flow cytometry; the majority of the cells expressed TGFβ3 protein intracellularly (96.95% of CD105-positive cells) Copyright © 2015 John Wiley & Sons, Ltd.
J Tissue Eng Regen Med (2015) DOI: 10.1002/term
R. A. Somoza et al.
+
+
Figure 3. Metabolic state of hSCAP-derived CD105 CD271 cells. (A) 3D cultured cells showed similar proliferation rates. (B) Lactate production on 3D cultured cells decreased compared to monolayer, except for IIS cultured cells (*p < 0.05). (C) Monolayer cultures showed higher glucose consumption levels (*p < 0.05). (D) The lactate/glucose yield (Ylactate/glucose) was higher on alginate and IIS immobilized cells, which represent a drastic change in their metabolic activity; this yield corresponds to the slope of the plotted values of glucose vs lactate for each condition; data were collected from at least three independent experiments. PDT, populationdoubling time
conditions metabolized more glutamine than glucose. The cells cultured under monolayer and fibrin conditions showed a Ylactate/glucose < 2, indicating a normal metabolism, as opposed to alginate- or chitosanimmobilized cells, which showed higher values for this index (Figure 3D).
3.4. TGFβ3 secretion by hSCAP-derived CD105+CD271+ cells cultured under 3D conditions TGFβ3 present in the conditioned media was quantified to determine whether different culture conditions stimulate cells to release the protein into the extracellular milieu. For quantification, triplicate calibration curves were performed in each determination. Secreted TGFβ3 concentrations were expressed as pg/ml/104 cells (Figure 4). A significant difference was observed between monolayer culture compared with 3D conditions. However, no differences were observed between the different matrices, suggesting that the change in status from monolayer to 3D culture provided the necessary signalling for TGFβ3 to be secreted into the extracellular medium. On the other hand, it was also observed that the levels of secreted TGFβ3 significantly decreased after 24 h. Significant changes in TGFβ3 secretion between monolayer culture and 3D cultures were noted at all times studied (Figure 4). Copyright © 2015 John Wiley & Sons, Ltd.
3.5. Gene expression of TGFβ3 and other GFs RNA extraction from cultured cells in the matrices was performed using a modification of the protocol described by Wang and Stegemann (2010), which is optimized to isolate RNA from complex samples where ion complexes form between matrix molecules and nucleic acids, which result in low yields of RNA. The amount of RNA extracted from cells seeded in IIS was not sufficient to obtain cDNA for analysis, due to the complexity of the polymeric matrix. We increased the cell density in the IIS; however, we could not extract sufficient good-quality RNA from these samples, even using the modified protocol (Wang and Stegemann, 2010). Quantitative gene expression analysis did not show significant differences between positive samples because of this; only qualitative gene expression of different GFs is shown in Table 3. TGFβ3 expression was observed under all the conditions, confirming that the control of TGFβ3 production and liberation to the extracellular medium is controlled upstream, probably at the secretion machinery level.
3.6. Biostatistical modelling In order to find associations between the different variables measured in the culture conditions, we performed biostatistical modelling based on multivariate analysis J Tissue Eng Regen Med (2015) DOI: 10.1002/term
TGFβ3 secretion by hSCAPs
+
+
Figure 4. TGFβ3 secretion by hSCAP-derived CD105 CD271 cells. TGFβ3 secretion was upregulated nine-fold in 3D cultured cells compared to monolayer culture. Secretion decreased at 48 and 72 h. Measures were made in triplicate on independent experiments. Significant changes were observed between monolayer and 3D cultures at all time points (p values are shown). Secretion in all 3D # conditions significantly decreased at later time points compared to values at 24 h ( p < 0.05)
Table 3. Expression of GF in hSCAPs cultured under different conditions
TGFβ3 EGF FGF2 VEGF PDGF
Time (h)
M
F
A
24 48 72 24 48 72 24 48 72 24 48 72 24 48 72
+ + + – ± + + + + – – – – – –
+ + + – – + + + + – – – + + –
+ + + – + – + + + – – – + + –
The results are shown qualitatively as: +, positive expression; –, no expression; ±, one negative sample (n = 3). M, monolayer; F, fibrin; A, alginate.
(Figure 5). PCA showed four types of cellular behaviour (Figure 5; PC1–PC2 hyperplane). The latter was corroborated using clustering analysis, which showed four defined groups (Figure 5; dendrogram). Accordingly, with PCA, monolayer cultures (24, 48 and 72 h) are very different compared with other cell culture conditions. No differences were observed in cell behaviour between 3D culture conditions (fibrin and alginate) at the same time points (24, 48 and 72 h); therefore, these conditions are located in separate quadrants within the analysis. The PCA modelling emphasizes that fibrin and alginate culture conditions at 24 h were most influential on the production of TGFβ3 and, to a lesser extent, on its gene expression (Figure 5; PCA loadings). At 48 h in alginate and fibrin culture, the most affected variables were glucose concentration, TGFβ3 concentration and PDGF expression (Figure 5; PCA loadings). Copyright © 2015 John Wiley & Sons, Ltd.
We performed a contribution analysis with respect to the change in culture conditions (Figure 5; contribution analysis). This allowed us to establish the contribution of the chemical composition of the matrix to each change of variable. Within this analysis we observed that fibrin encapsulation had a higher contribution to the alteration of the variables when the conditions were modified from a monolayer culture towards a 3D culture condition. We found a number of significant (p < 0.05) correlations between variables (Figure 5; Pearson’s correlation analysis). Interestingly, there was a strong positive correlation between TGFβ3 production and its concentration (r = 0.61; p = 0.04). PDGF gene expression was correlated with TGFβ3 concentration (r = 0.87; p = 0.001) and TGFβ3 mRNA (r = 0.60; p = 0.04). TGFβ3 concentration was correlated with glucose (r = 0.75; p = 0.001) and lactate (r = –0.73; p = 0.01). Thus, the correlation analysis shows a strong relationship among TGFβ3, PDGF and glycolysis.
4. Discussion To date, many studies have shown that adult stem cells are present in various tissues, including bone marrow, neural tissue, skin, retina, adipose tissue and umbilical cord, among others (Mimeault and Batra, 2008). This property of many adult tissues is certainly a great advantage for cell therapy applications; however, many of these tissues are difficult to obtain and isolation of stem cells can be methodologically complicated and have adverse side-effects. In the present investigation, we isolated adult stem cells from hDAP obtained from third molars, using immunomagnetic cell sorting based on the co-expression of CD271 and CD105. Both markers are expressed in bone J Tissue Eng Regen Med (2015) DOI: 10.1002/term
R. A. Somoza et al.
Figure 5. Biostatistical modelling. Observations modelled were: monolayer cell culture, fibrin cell culture and alginate cell culture, each observed at 24, 48 and 72 h. Variables modelled were: biomass, cell growth rate, glucose (concentration and consumption), lactate (concentration and production), TGFβ3 (concentration, production and mRNA), EGF mRNA and PDGF mRNA
marrow-derived-MSCs (BM-MSCs). MSCs expressing CD271 have been shown to have a higher proliferative capacity (Quirici et al., 2002; Jarocha et al., 2008). Moreover, it has been suggested that CD271 is probably one of the most selective markers for obtaining more homogeneous populations of BM-MSCs (Jones and McGonagle 2008) and could eventually be used as a sole marker for MSCs identification (Flores-Torales et al., 2010). On the other hand, CD105 is one of the traditional MSC markers; cells expressing this marker have favourable properties, such as higher proliferation and differentiation capacities (Roura et al., 2006; Jarocha et al., 2008). We verified that hSCAPs have properties comparable to those of BM-MSCs. Copyright © 2015 John Wiley & Sons, Ltd.
hSCAPs were isolated and described for the first time (Sonoyama et al., 2006) from third molars of adults aged 18–20 years. Several studies have reported the presence of MSC-like cells in numerous tissues (da Silva Meirelles et al., 2008). These have led to the hypothesis that the true niche of MSCs is perivascular. There is evidence that supports a perivascular location for MSCs (Crisan et al., 2008). This has led to suggestion that all MSCs are pericytes (Caplan, 2008). CD146 is a classic pericyte marker, used to isolate and expand pericytes in vitro (Crisan et al., 2008). hSCAPs also express CD146 (Laberge and Cheung, 2011). Furthermore, Stro-1 staining of apical papilla has J Tissue Eng Regen Med (2015) DOI: 10.1002/term
TGFβ3 secretion by hSCAPs
shown that the positive stain is located in the perivascular region as well as other regions dispersed in the tissue, suggesting that hSCAPs also have a perivascular niche (Sonoyama et al., 2008). Therefore, it has been proposed that MSCs present as pericytes in all vascularized tissues, including dental tissues, could have the ability to sense the environment and thus change their phenotype according to the needs of a particular tissue, for example by the secretion of various factors, triggering a regenerative micro-environment in the affected tissues (Caplan and Correa, 2011). The specific signals that activate the medicinal phenotype of MSCs are not known, although there is evidence that certain inflammatory and mechanical signals could be involved (Bilodeau and Mantovani, 2006; Liu et al., 2006a). There is a change in the concept regarding the clinical potential of MSCs, and this is reflected in the fact that most MSCs-based clinical trials currently under development rely on the known trophic capabilities of MSCs (http://clinicaltrials.gov). As far as it is known, there are no data concerning the secretion profile of hSCAPs, in contrast to the abundant existing information about the BM-MSCs secretome (Meirelles et al., 2009). The most commonly secreted GFs by BM-MSCs are FGF2, VEGF, PDGFBB, TGFβ1 and various other cytokines (Caplan and Dennis, 2006; Liu et al., 2006). Comparative studies have shown that MSCs isolated from bone marrow, umbilical cord blood and adipose tissue show comparable characteristics with respect to growth factor expression profiles (Schinköthe et al., 2008). These precedents suggest that dental tissuederived MSCs may also produce many of the factors described for MSCs from other tissues. There are not many studies regarding the expression/secretion of TGFβ3, as most of the published work regarding TGFβ3 and MSCs is related to chondrogenic induction (Minguell et al., 2001) and has not been considered as part of the MSC secretion profile. High-throughput studies have reported low levels of TGFβ3 expression by MSCs (Liu and Hwang, 2005; Smiler et al., 2010). Although we were not able to detect TGFβ3 by dot–blot immunoassay, cells constitutively secrete a small amount of TGFβ3 which can be detected by ELISA (Figure 4). This has been reported for MSCs isolated from other tissues (Liu and Hwang, 2005; Smiler et al., 2010). Our results suggest that these cells require an external stimulus to activate TGFβ3 secretion through a particular pathway. The mechanism by which TGFβ3 is secreted has not been described. It is known that the precursor protein of TGFβ is proteolysed within the cell from the C-terminal, but remains non-covalently attached to the latency peptide, forming a small latency complex. This complex is exported from the cell, where it binds to the latent TGFβ-binding protein (Flanders and Burmester 2003). The classical (or canonical) secretory pathway is involved in constitutive secretion of small amounts of proteins from the trans-Golgi network to the cell surface (Duitman et al., 2011). In some cell types, such as macrophages, this constitutive pathway can be upregulated to increase the secretion of certain proteins Copyright © 2015 John Wiley & Sons, Ltd.
when the cells are activated (Stow et al., 2009). The proteins to be secreted transit from the trans-Golgi system to the plasma membrane and may be stored in granules until their secretion is activated by specific signals (Duitman et al., 2011).
4.1. Phenotype induction: TGFβ3 secreting cells Previous studies have shown that 3D culture can provide signals for cells to exert more complex functions, such as secretion of GFs (Acevedo et al., 2010). Moreover, it is known that, as the first event of cellular response to a material, cell adhesion influences cell morphology, viability, proliferation and differentiation (Kang et al., 2011). Additionally, 3D culture enables cells to adopt a native morphology, facilitating cell–ECM interactions enhancing signalling processes (Grayson et al., 2006); therefore, the signals to which cells are exposed are different from those to which they are exposed during conventional monolayer culture. Fibrin is a bioactive scaffold for cells as it contains specific signal moieties, such as the RGD sequence, that cells recognize via integrins (Janmey et al., 2009). It has been observed that cell immobilization in fibrin triggers specific cell responses, including changes in protein secretion (Acevedo et al., 2010; Sporn et al., 1995). Previous work has demonstrated that fibrin immobilization overproduces TGFβ and PDGF in human keratinocytes, and that glycolysis is significantly correlated with TGFβ secretion (Acevedo et al., 2010). Cell response to a fibrin surface is dependent on specific aspects of the structure of the fibrin molecule (signals mediated by integrin recognition), as well as events generated during the polymerization process (release of fibrinopeptides A and B). It has been shown that fibrinopeptides can trigger changes in the cellular responses of cells in contact with fibrin (Sporn et al., 1995). In contrast, alginate does not produce this type of signal; therefore, we do not expect to provide an adequate chemical environment for cells to exert advance functions mediated by interactions with the alginate matrix. The integrated implant system (IIS) used in this study corresponds to a tissue-engineered product that has been successful in preclinical studies in the treatment of wounds (WeinsteinOppenheimer et al., 2010). The polymer matrix is formed by chitosan, gelatin and hyaluronic acid. As in the case of fibrin, biomaterials comprising this polymer matrix have bioactive properties because they contain specific domains, such as the RGD signal (Tan et al., 2007). Unlike fibrin and alginate encapsulation, the cells seeded on the IIS are arranged within the porous mesh. Cells are incorporated into the scaffold using fibrin as a vehicle, by in situ gelation (Weinstein-Oppenheimer et al., 2010). Since fibrin is used as a carrier and is polymerized with the cells within it, the overall physiological effect on cells may be similar to that of capsule formation. By ELISA quantitation we found a significant change in the secretion of TGFβ3 to cells cultured under 3D conditions at all times analysed, compared with monolayer culture J Tissue Eng Regen Med (2015) DOI: 10.1002/term
R. A. Somoza et al.
(Figure 4; t-test, *p < 0.05). This change corresponded to a secretion increase of approximately nine-fold at 24 h of culture (19 pg/ml/104 cells in monolayer to 174 pg/ml/ 104 in the matrices) and nearly four-fold at 48 and 72 h. The levels of TGFβ3 secreted are in agreement with those reported for this and other GFs (Acevedo et al., 2010; Engler et al., 2006; Eshghi and Schaffer, 2008; Liu et al., 2006; Rehman et al., 2004). No significant differences were observed in TGFβ3 secretion among 3D culture conditions at different time points, suggesting that the matrix chemical composition has a minor role in this phenomenon. Effects due to cell immobilization are often not considered, and many of the differences we observed between monolayer and 3D culture conditions may be due to the effects of cell–ECM interactions, such as cellular stress produced by the immobilization process (Schneider et al., 1996; Sun et al., 2007), changes in cellular metabolism (Constantinidis et al., 1999; Simpson et al., 2006) or mechanical stimulation (Constantinidis et al., 1999; Bilodeau and Mantovani, 2006). Because cellular metabolism is altered in 3D culture compared to monolayer culture (Figure 3), this may have significant implications in the use of matrices, because metabolism affects all cell physiology (Deorosan and Nauman, 2011). Our results suggest that the different chemical compositions of the
matrices do not a priori influence TGFβ3 secretion. Activation of the cells to a secretory phenotype could be produced by the physiological changes that cells experience when moving from a monolayer culture condition to a 3D condition (Constantinidis et al., 1999; Simpson et al., 2006). Cell dynamic interactions, where the adhesive connections between the cells and the ECM are created and simultaneously removed, can lead to cellular responses that are not observed under conventional culture conditions (Bilodeau and Mantovani 2006). These dynamic interactions may increase immediately after the immobilization process, which could explain the increased secretion of TGFβ3 at 24 h (Figure 4). At later times this dynamic state between the matrix and the cells decreases, because the cells are adapted to the new condition. It has been shown that periodontal ligament-derived cells respond to mechanical deformation (Pinkerton et al., 2008). In this study the authors observed an overexpression of TGFβ1 and TGFβ3 upon mechanical deformation. This is especially relevant for the cells that comprise the dental tissues, which are much more exposed to mechanical forces (Pinkerton et al., 2008). Along with assessing the secretion of TGFβ3, we studied the metabolic changes that cells undergo when they are immobilized, compared to the monolayer culture condition. We also evaluated the expression of other GFs
Figure 6. Proposed model for TGFβ3 secretion by hSCAPs. When culture conditions are altered (2D to 3D culture), cells are exposed to stimuli that produce physiological changes. During the immobilization process, the cells undergo surface tension produced by mechanical forces during matrix polymerization. These forces could activate intracellular signalling pathways that influence the measured phenomena (glycolysis, secretion of TGFβ3, gene expression). Dynamic changes between cell–matrix interactions early during the immobilization process could also be involved. Glucose and lactate concentrations appear to have some influence in the process: glucose on PDGF gene expression and TGFβ3 secretion and lactate on the protein stability in solution. Autocrine signalling by TGFβ3 could also affect its own secretion (positively at the beginning and negatively at later times). Specific interactions given by the chemical composition of the matrix, such as RGD signal, could be affecting the observed changes. Finally, there was a constitutive expression of TGFβ3 mRNA, which may be an indication that these cells are in a preconditioned state to produce the growth factor. In this system the availability of nutrients is not restricted due to diffusive phenomena (data not shown). Figure made with images available at Servier Medical Art (www.servier.fr) Copyright © 2015 John Wiley & Sons, Ltd.
J Tissue Eng Regen Med (2015) DOI: 10.1002/term
TGFβ3 secretion by hSCAPs
under the different culture conditions. With these data we built a TGFβ3 secretion model based on changes that cells experience when they move from a 2D (monolayer) towards a 3D culture condition (Figure 6). This research has focused on TGFβ3, due to its relevance in tissue regeneration. The results of this study showed that changes in the culture system could generate significant changes in cell biology. The study of these interactions is provided as a cornerstone in designing future strategies in tissue engineering and cell therapy that are more efficient and effective for repair/regeneration of damaged tissues. We are currently studying the particular mechanism(s) that could be involved in the phenomenology we describe here.
Conflict of interest The authors declare no conflicts of interest.
Acknowledgements We thank Dr Maximo Hernandez and Megasalud for providing technical support with dental samples and Donald Lennon for critical reading of the manuscript. This research was supported by Comisión Nacional de Investigación Científica y Tecnológica (CONICYT; Grant No. Fondef D07i1075). R.A.S. is the recipient of a doctoral fellowship from CONICYT.
Author contributions R.A.S., M.E.Y. and C.W.O. designed the research; R.A.S. performed experiments; C.A.A. performed biostatistical analysis; F.A. synthesized the IIS and provided data interpretation; P.A.L. performed flow-cytometry analysis, experimental design and data interpretation; and F.C., R.A. S., M.E.Y., C.W.O. and C.A.A. analysed data and wrote the paper.
References Acevedo CA, Somoza RA, Weinstein-Oppenheimer C et al. 2010; Growth factor production from fibrin-encapsulated human keratinocytes. Biotechnol Lett 32: 1011–1017. Barrientos S, Stojadinovic O, Golinko MS et al. 2008; Growth factors and cytokines in wound healing. Wound Repair Regen 16: 585–601. Bilodeau K, Mantovani D. 2006; Bioreactors for tissue engineering: focus on mechanical constraints. A comparative review. Tissue Eng 12: 2367–2383. Bro R, Kjeldahl K, Smilde A et al. 2008; Cross-validation of component models: a critical look at current methods. Anal Bioanal Chem 390(5): 1241–1251. Caplan AI. 2008; All MSCs are pericytes? Cell Stem Cell 3: 229–230. Caplan AI, Correa D. 2011; The MSC: an injury drugstore. Cell Stem Cell 9: 11–15. Caplan AI, Dennis JE. 2006; Mesenchymal stem cells as trophic mediators, J Cell Biochem 98: 1076–1084. Laberge T, Cheung HS. 2011; Multipotent dental stem cell source for regenerative medicine. In Embryonic Stem Cells-Differentiation and Pluripotent Alternatives, Kallos MS (ed). InTech: Rijeka, Croatia. Constantinidis I, Rask I, Long RC et al. 1999; Effects of alginate composition on the metabolic, secretory, and growth characteristics of entrapped βTC3 mouse insulinoma cells. Biomaterials 20: 2019–2027. Crisan M, Yap S, Casteilla L et al. 2008; A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell 3: 301–313. Da Silva Meirelles L, Chagastelles PC, Nardi NB. 2006; Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci 119: 2204–2213. Da Silva Meirelles L, Caplan AI, Nardi NB. 2008; In search of the in vivo identity of mesenchymal stem cells. Stem Cells 26: 2287–2299. Deorosan B, Nauman EA. 2011; The role of glucose, serum, and three-dimensional cell culture on the metabolism of bone
Copyright © 2015 John Wiley & Sons, Ltd.
marrow-derived mesenchymal stem cells. Stem Cells Int 2011: 429187. Dominici M, Le Blanc K, Mueller I et al. 2006; Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8: 315–317. Duitman EH, Orinska Z, Bulfone-Paus S. 2011; Mechanisms of cytokine secretion: a portfolio of distinct pathways allows flexibility in cytokine activity. Eur J Cell Biol 90: 476–483. Engler AJ, Sen S, Sweeney HL et al. 2006; Matrix elasticity directs stem cell lineage specification. Cell 126: 677–689. Eshghi S, Schaffer DV. 2008; Engineering microenvironments to control stem cell fate and function. In StemBook: Harvard Stem Cell Institute: http://www.ncbi.nlm.nih. gov/books/NBK27048/. Ferguson MWJ, O’Kane S. 2004; Scar-free healing: from embryonic mechanisms to adult therapeutic intervention. Phil Trans R Soc Lond B Biol Sci 359: 839–850. Ferguson MWJ, Duncan J, Bond J et al. 2009; Prophylactic administration of avotermin for improvement of skin scarring: three double-blind, placebo-controlled, phase I/II studies. Lancet 373: 1264–1274. Flanders KC, Burmester JK. 2003; Medical applications of transforming growth factor-β. Clin Med Res 1: 13–20. Flores-Torales E, Orozco-Barocio A, Gonzalez-Ramella OR et al. 2010; The CD271 expression could be alone for establisher phenotypic marker in bone marrow derived mesenchymal stem cells. Folia Histochem Cytobiol 48: 682–686. Grayson WL, Zhao F, Izadpanah R et al. 2006; Effects of hypoxia on human mesenchymal stem cell expansion and plasticity in 3D constructs. J Cell Physiol 207: 331–339. Hao J, Varshney RR, Wang DA. 2008; TGF-β 3: a promising growth factor in engineered organogenesis. Expert Opin Biol Ther 8: 1485–1493.
Huang GT-J, Gronthos S, Shi S. 2009; Mesenchymal stem cells derived from dental tissues vs those from other sources: their biology and role in regenerative medicine. J Dent Res 88: 792–806. Janmey PA, Winer JP, Weisel JW. 2009; Fibrin gels and their clinical and bioengineering applications. J R Soc Interface 6: 1–10. Jarocha D, Lukasiewicz E, Majka M. 2008; Advantage of mesenchymal stem cells (MSCs) expansion directly from purified + + and CD271 bone marrow CD105 cells. Folia Histochem Cytobiol 46: 307–314. Jones E, McGonagle D. 2008; Human bone marrow mesenchymal stem cells in vivo. Rheumatology (Oxford) 47: 126–131. Kang SW, Cha BH, Park H et al. 2011; The effect of conjugating RGD into 3D alginate hydrogels on adipogenic differentiation of human adipose-derived stromal cells. Macromol Biosci 11: 673–679. Liu CH, Hwang SM. 2005; Cytokine interactions in mesenchymal stem cells from cord blood. Cytokine 32: 270–279. Liu H, Mao J, Yao K et al. 2004; A study on a chitosan–gelatin–hyaluronic acid scaffold as artificial skin in vitro and its tissue engineering applications. J Biomater Sci Polym Ed 15: 25–40. Liu Y, Dulchavsky DS, Gao X et al. 2006; Wound repair by bone marrow stromal cells through growth factor production. J Surg Res 136: 336–341. Meirelles LDS, Fontes AM, Covas DT et al. 2009; Mechanisms involved in the therapeutic properties of mesenchymal stem cells. Cytokine Growth Factor Rev 20: 419–427. Mimeault M, Batra SK. 2008; Recent progress on tissue-resident adult stem cell biology and their therapeutic implications. Stem Cell Rev 4: 27–49. Minguell JJ, Erices A, Conget P. 2001; Mesenchymal stem cells. Exp Biol Med (Maywood) 226: 507–520.
J Tissue Eng Regen Med (2015) DOI: 10.1002/term
R. A. Somoza et al. Occleston NL, Laverty HG, O’Kane S et al. 2008; Prevention and reduction of scarring in the skin by transforming growth factor-β3 (TGFβ3): from laboratory discovery to clinical pharmaceutical. J Biomater Sci Polym Ed 19: 1047–1063. Oh JY, Kim MK, Shin MS et al. 2009; Cytokine secretion by human mesenchymal stem cells cocultured with damaged corneal epithelial cells. Cytokine 46: 100–103. Park HW, Shin JS, Kim CW. 2007; Proteome of mesenchymal stem cells. Proteomics 7: 2881–2894. Pinkerton MN, Wescott DC, Gaffey BJ et al. 2008; Cultured human periodontal ligament cells constitutively express multiple osteotropic cytokines and growth factors, several of which are responsive to mechanical deformation. J Periodont Res 43: 343–351. Quirici N, Soligo D, Bossolasco P et al. 2002; Isolation of bone marrow mesenchymal stem cells by anti-nerve growth factor receptor antibodies. Exp Hematol 30: 783–791. Rehman J, Traktuev D, Li J et al. 2004; Secretion of angiogenic and antiapoptotic factors by human adipose stromal cells. Circulation 109: 1292–1298. Roura S, Farré J, Soler-Botija C et al. 2006; Effect of aging on the pluripotential capac+ ity of human CD105 mesenchymal stem cells. Eur J Heart Fail 8: 555–563.
Copyright © 2015 John Wiley & Sons, Ltd.
Saeed AI, Sharov V, White J et al. 2003; TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34: 374–378. Schinköthe T, Bloch W, Schmidt A. 2008; In vitro secreting profile of human mesenchymal stem cells. Stem Cells Dev 17: 199–206. Schneider M, Marison IW, von Stockar U. 1996; The importance of ammonia in mammalian cell culture. J Biotechnol 46: 161–185. Schrementi ME, Ferreira AM, Zender C et al. 2008; Site-specific production of TGFβ in oral mucosal and cutaneous wounds. Wound Repair Regen 16: 80–86. Simpson NE, Grant SC, Gustavsson L et al. 2006; Biochemical consequences of alginate encapsulation: a NMR study of insulin-secreting cells. Biomaterials 27: 2577–2586. Smiler DG, Soltan M, Soltan C et al. 2010; Growth factors and gene expression of stem cells: bone marrow compared with peripheral blood. Implant Dent 19: 229–240. Somoza RA, Rubio FJ. 2012; Cell therapy using induced pluripotent stem cells or somatic stem cells: this is the question. Curr Stem Cell Res Ther 7: 191–196. Sonoyama W, Liu Y, Fang D et al. 2006; Mesenchymal stem cell-mediated functional tooth regeneration in swine. PLoS One 1: e79.
Sonoyama W, Liu Y, Yamaza T et al. 2008; Characterization of the apical papilla and its residing stem cells from human immature permanent teeth: a pilot study. J Endod 34: 166–171. Sporn LA, Bunce LA, Francis CW. 1995; Cell proliferation on fibrin: modulation by fibrinopeptide cleavage. Blood 86: 1802–1810. Stow JL, Low PC, Offenhäuser C et al. 2009; Cytokine secretion in macrophages and other cells: pathways and mediators. Immunobiology 214: 601–612. Sun ZJ, Lv GJ, Li SY et al. 2007; Differential role of microenvironment in microencapsulation for improved cell tolerance to stress. Appl Microbiol Biotechnol 75: 1419–1427. Tan H, Gong Y, Lao L et al. 2007; Gelatin/chitosan/hyaluronan ternary complex scaffold containing basic fibroblast growth factor for cartilage tissue engineering. J Mater Sci Mater Med 18: 1961–1968. Wang L, Stegemann JP. 2010; Extraction of high quality RNA from polysaccharide matrices using cetyltrimethylammonium bromide. Biomaterials 31: 1612–1618. Wang JHC, Thampatty BP. 2008; Mechanobiology of adult and stem cells. Int Rev Cell Mol Biol 271: 301–346. Weinstein-Oppenheimer CR, Aceituno AR, Brown DI et al. 2010; The effect of an autologous cellular gel–matrix integrated implant system on wound healing. J Transl Med 8: 59.
J Tissue Eng Regen Med (2015) DOI: 10.1002/term
