The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora

Share Embed


Descrição do Produto

Molecular Microbiology (2007) 64(4), 923–937

doi:10.1111/j.1365-2958.2007.05694.x

The novel ER membrane protein PRO41 is essential for sexual development in the filamentous fungus Sordaria macrospora Minou Nowrousian,1 Sandra Frank,1 Sandra Koers,1 Peter Strauch,1 Thomas Weitner,1 Carol Ringelberg,2 Jay C. Dunlap,2 Jennifer J. Loros2 and Ulrich Kück2* 1 Lehrstuhl für Allgemeine und Molekulare Botanik, Ruhr-Universität Bochum, Bochum, Germany. 2 Departments of Genetics and Biochemistry, Dartmouth Medical School, Hanover, NH, USA. Summary The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41–EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41–EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi. Introduction Many filamentous fungi form fruiting bodies as an integral part of their sexual cycle. The fruiting bodies are complex multicellular structures that protect the sexual spores and Accepted 8 March, 2007. *For correspondence. E-mail [email protected] ruhr-uni-bochum.de; Tel. (+49) 0 234 3226212; Fax (+49) 0 234 3214184.

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd

ensure their proper discharge. In filamentous ascomycetes, fruiting bodies comprise one or more outer tissue layers that enclose the asci in which the sexual spores (ascospores) are formed. Thus, fruiting bodies usually contain many more specialized cell types than the vegetative mycelium from which they arise. For example, in the ascomycete Neurospora crassa, 15 of the 28 recognized cell types occur only during fruiting body formation (Bistis et al., 2003). In recent years, a number of genes that are involved in this developmental process have been identified from different ascomycetes. Among these are genes that play a role in signal transduction cascades or are involved in transcriptional or posttranscriptional regulation as well as genes for primary or secondary metabolism (Pöggeler et al., 2006a). Furthermore, several genes have been identified whose products localize to membrane-bounded organelles, thereby highlighting specific roles for these organelles during sexual development. One such gene is PaCox17 present in Podospora anserina. This gene encodes a copper chaperone that transports copper from the cytosol to the mitochondrial intermembrane space. Deletion of PaCox17 leads to a lack of mitochondrial copper, an essential cofactor for cytochrome oxidase (Beers et al., 1997; Stumpferl et al., 2004). Another protein that localizes both to mitochondria and the cytosol is RMP1, an essential protein for proper sexual development in P. anserina. RMP1 is localized in the cytosol or the mitochondria in a developmental stagespecific manner (Contamine et al., 2004). Another group of membrane-bounded organelles that are present in fungal hyphae are microbodies. Among these are, e.g. the peroxisomes that are involved in lipid metabolism or hydrogen peroxide detoxification (Titorenko and Rachubinski, 2004). P. anserina mutants in the genes pex2 (formerly car1), pex5 and pex7, all of which are involved in peroxisomal protein import, show defects in sexual development (Berteaux-Lecellier et al., 1995; Bonnet et al., 2006). Other membrane-bounded organelles characteristic for fungal cells are the vacuoles, and they too have been implicated to play a role in developmental processes. This was demonstrated by analysis of the vma-1 gene encoding the catalytic subunit of the vacuolar H+-ATPase from N. crassa. vma-1 mutants display several developmental

924 M. Nowrousian et al. Fig. 1. Complementation analysis of the pro41 mutant. A. The S. macrospora cosmids C6 and G2 as well as the N. crassa cosmid pMOcosXG20A10 complement mutant pro41. White arrows, predicted N. crassa open reading frame; black regions, elements that were verified to be present on the S. macrospora cosmids; light grey, smallest complementing region deduced from complementation analysis with cosmids. B. The pro41 open reading frame complements the developmental defects of mutant pro41. White arrows, predicted S. macrospora open reading frames; dark grey bar, region that is deleted in mutant pro41; white bars, complementing clone/fragment; light grey, smallest complementing region; black bars, non-complementing clones; hatched bars, regulatory regions from A. nidulans (gpd promoter, trpC terminator).

phenotypes, among which are female sterility and ascospore germination defects (Bowman et al., 2000). All membrane-bounded organelles need a supply of proteins during their biogenesis. Nuclear-encoded proteins destined to mitochondria are translated in the cytosol and imported post-translationally. Several pathways of post-translational protein import have also been characterized for peroxisomes; however, there is also evidence for a flow of proteins from the endoplasmic reticulum (ER) to the peroxisomes (Kunau and Erdmann, 1998). Other membrane-bounded organelles like the vacuole and the Golgi-like compartment as well as the plasma membrane receive most of their proteins through the ER which plays a central role in the distribution and post-translational modification of organelle- and outbound proteins. However, whether the ER plays a specific role in fungal sexual development has not yet been determined. Here, we present the analysis of a sterile mutant from Sordaria macrospora and the functional characterization of the developmental gene pro41 encoding a novel ER membrane protein that is dispensable for vegetative growth but essential for fruiting body formation. Results Complementation of the sterile mutant pro41 The sterile mutant pro41 isolated from the wild-type strain after ethyl methanesulfonate mutagenesis (Pöggeler and

Kück, 2004) displays normal vegetative growth but is blocked early in sexual development (Fig. S1). The mutant is unable to progress beyond the stage of protoperithecium formation and consequently does not form any ascospores. Mutant pro41 was complemented to fertility by transformation with an indexed cosmid library representing the S. macrospora genome (Pöggeler et al., 1997a). Two overlapping cosmids C6 and G2 were identified that are able to complement the developmental defects of the mutant strain (Fig. 1A). Additionally, the mutant could be complemented by transformation with a cosmid clone from a N. crassa cosmid library that covers ~15 kb of the orthologous region from N. crassa represented by cosmids C6 and G2 (Fig. 1A). This region in the N. crassa genome contains three predicted open reading frames (ORFs) that are named NCU02765.2, NCU02766.2 and NCU02767.2 (Galagan et al., 2003). 6.8 kb from the corresponding regions in the complementing S. macrospora cosmids were sequenced. This region includes homologues to NCU02765.2 and NCU02767.2, but there is no homologue to NCU02766.2 present in the corresponding position in the S. macrospora genome (Fig. 1B). Complementation studies with the regions subcloned from the S. macrospora cosmids or amplified from wild-type genomic DNA showed that the ORF orthologous to NCU02767.2 is sufficient to complement mutant pro41; thus, this gene was named pro41 (Fig. 1B). Fragments containing only sections of the

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 925 pro41 ORF were not able to complement the mutant strain (Fig. 1B). Analysis of the complementing pro41 gene in wild type and mutant pro41 The complementing pro41 ORF comprises 557 bp interrupted by two predicted introns of 64 and 58 nt. cDNA fragments covering the full-length pro41 mRNA were amplified by 5′- and 3′-RACE, and the location of the two introns was verified. The pro41 mRNA is about 2.2 kb including a 5′ UTR of 1069 nt and a 3′ UTR of 608 nt. The 5′ UTR contains an additional short ORF encoding a predicted polypeptide of 91 amino acids (Fig. 1). This ORF might constitute an upstream open reading frame (uORF) similar to what is found in a number of eukaryotic genes where uORFs have been shown to be involved in the regulation of gene expression (Morris and Geballe, 2000; Gaba et al., 2001). However, whether the predicted uORF upstream of pro41 is translated remains to be elucidated; our complementation analyses show that this uORF is not necessary for functional complementation of the pro41 mutant (Fig. 1). To investigate whether the mutant pro41 does indeed contain a mutation within the pro41 locus, genomic DNA from the mutant and the wild type was hybridized with a pro41 probe. We found a signal in the wild type while none was observed in the mutant strain, indicating that mutant pro41 harbours a deletion of the pro41 gene (data not shown). To map the extent of this deletion, a fragment of genomic DNA from the mutant strain was amplified by PCR and sequenced; thus, the deletion was found to encompass a stretch of 3998 bp including the pro41 ORF (Fig. 1B). These data demonstrate that pro41 is not a suppressor of the mutation in the pro41 mutant but rather complements the actual mutation in the mutant strain. The complementing pro41 ORF itself encodes a predicted protein of 144 amino acids (Fig. 2). BLAST searches (Altschul et al., 1997) in the public databases identified several predicted proteins as putative PRO41 orthologues in the fully sequenced genomes of all filamentous ascomycetes (Pezizomycotina) that were investigated, an alignment of a number of PRO41 orthologues is shown in Fig. 2. However, none of these orthologues has been functionally characterized. No possible homologues were identified in the genomes of Saccharomyces cerevisiae and related ascomycetes from the group of the Saccharomycetes like Candida albicans, Lodderomyces elongisporus or Ashbya gossypii. Similarly, no putative homologues were found among basidiomycetes, zygomycetes or other organisms. To learn more about the putative subcellular localization and possible functions of pro41, we performed in silico analyses using PSORT, TMPRED, HMMTOP and SIGNALP

(Hofmann and Stoffel, 1993; Nakai and Horton, 1999; Tusnady and Simon, 2001; Bendtsen et al., 2004). These programs predict an N-terminal signal sequence for co-translational insertion into the ER and two transmembrane domains (Fig. 2). A third transmembrane domain that overlaps with the predicted N-terminal signal sequence is also predicted; however, as the signal sequence was shown to be functional (see below), it is unlikely that this prediction is correct. PSORT additionally predicts the C-terminal sequence KSGR to be an ER retention signal of the KKXX-type (Jackson et al., 1990). However, the two lysine residues usually found in the consensus sequence are not present in PRO41, and the motif is not conserved in the putative PRO41 orthologues. Another putative ER retention signal might be found in the second predicted transmembrane domain (Fig. 2). This sequence consists of a hydrophobic core flanked by two polar residues (Q and Y), and sequences with these structural features have been demonstrated to act as retention signals for ER membrane proteins in yeast (Sato et al., 2003). Taken together, these predictions indicate that PRO41 might be an ER membrane protein. Analysis of the predicted N-terminal signal sequence In silico analyses of PRO41 indicate that PRO41 might be an ER membrane protein that is co-translationally inserted into the ER via a canonical N-terminal signal sequence (see above). To verify whether this putative signal sequence is functional, we expressed a fusion construct of the predicted pro41 signal sequence with egfp in the wild type. In case of a functional signal sequence, EGFP should be inserted into the ER, and in the absence of other signals should then be secreted out of the cell similar to what was previously shown for the signal sequence of the pheromone precursor gene ppg1 (Mayrhofer and Pöggeler, 2005). We used transformants expressing solely egfp as a negative control, transformants expressing the pro41 signal sequence in fusion with egfp, and transformants with the ppg1 signal sequence in fusion with egfp as a positive control (Fig. 3A). Microscopic analysis of the transformants revealed a cytoplasmic localization of EGFP in transformants expressing egfp alone, and fluorescence of vesicular structures within the cytoplasm in transformants with the ppg1 or pro41 signal sequences in fusion with egfp (data not shown). Such expression patterns are indicative of cytoplasmic or secreted EGFP respectively, as was shown previously (Mayrhofer and Pöggeler, 2005). We then performed Western blot analysis of culture media from the transformants (Fig. 3A). As expected, EGFP was not detected in culture media from transformants expressing egfp alone, but was secreted in transformants expressing the construct with the ppg1 signal sequence.

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

926 M. Nowrousian et al.

Fig. 2. Multiple alignment of PRO41 orthologues from filamentous fungi. The alignment was created using CLUSTALX (Thompson et al., 1997) with the S. macrospora PRO41 (S. m., emb|AM410183), and sequences from fully sequenced genomes of the following fungi: Nc, Neurospora crassa NCU02767.2; Cg, Chaetomium globosum CHG01547.1; Fg, Fusarium graminearum FG01268.1; Mg, Magnaporthe grisea MGG_09956.5; Ss, Sclerotinia sclerotiorum SS1G_04691.1; An, Aspergillus nidulans AN5458.3; Af, Aspergillus fumigatus Afu6g13340; Ci, Coccidioides immitis CIMG_10237.2; Hc, Histoplasma capsulatum HCAG_05179.1; Sn, Stagonospora nodorum SNOG_11389.1. The A. nidulans, A. fumigatus, H. capsulatum and S. nodorum PRO41 orthologues were manually re-annotated as the predicted proteins are shorter than all other PRO41 orthologues probably due to annotation errors. Sequences were obtained from the Aspergillus fumigatus sequence project (http://www.tigr.org/tdb/e2k1/afu1/) for A. fumigatus and from the genome databases of the Fungal Genome Initiative (http://www.broad.mit.edu/annotation/fungi/fgi/index.html) for all other sequences. Jalview was used to visualize the alignment (Clamp et al., 2004). Amino acid residues conserved in at least nine sequences are given in dark grey, residues conserved in at least seven sequences in medium grey, and in at least five sequences in light grey. The N-terminal signal sequence as predicted by PSORT and SIGNALP (Nakai and Horton, 1999; Bendtsen et al., 2004) is shown by a dark grey bar above the sequence, putative cleavage sites are indicated by black triangles. Transmembrane domains that were predicted by TMPRED (Hofmann and Stoffel, 1993) are shown by light grey bars below the sequences. A putative ER retention signal is indicated by an open box above the sequence. Amino acid identities in percentage of the PRO41 orthologues with each other are given at the end of the alignment.

In transformants expressing the construct with the pro41 signal sequence, EGFP was also present in the medium in high amounts, indicating that the predicted pro41 signal sequence is sufficient to mediate secretion of EGFP. This result correlates well with the finding that the predicted signal sequence is essential for complementation of the mutant strain as a construct lacking the N-terminal signal sequence (pE3-7Mr, Fig. 1) is not able to restore the mutant to fertility. Also, a PRO41–EGFP fusion protein lacking the signal sequence does not localize to the ER (see below). Microscopic analysis of PRO41 localization The in silico analyses described above predict that PRO41 should be an ER protein. To experimentally address the question of the subcellular localization of

PRO41, we performed fluorescence microscopy with transformants expressing a pro41–egfp fusion construct from plasmid pE3-5Mr (Fig. 3B). The plasmid is able to complement mutant pro41 to fertility, thus the fusion protein is functional (Fig. 1). EGFP fluorescence was observed in net-like structures within the hyphae of transformants expressing full-length PRO41 in fusion with EGFP (Fig. 3B, left). Net-like structures are typical of the ER in fungal hyphae (Maruyama et al., 2006). The structures also correspond to the ER morphology that was observed in hyphae from the wild type transformed with an ER-localized EGFP (Fig. 4, see below). Also, the PRO41–EGFP fusion protein colocalizes with an ER-localized DsRED (Fig. 3B, left), indicating that PRO41 is an ER protein. To address the question whether the N-terminal signal sequence that mediates insertion into the ER is necessary

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 927

Fig. 3. Analysis of the PRO41 protein. A. The predicted PRO41 signal sequence for co-translational insertion into the ER is functional. Constructs for expression of egfp (pEH3), and egfp fused with the signal sequences from ppg1 or pro41 (pSppg1-1 and pSpro41 respectively) were transformed into the wild type. Protein extracts from the culture medium of transformants were separated by SDS-PAGE and analysed for secreted EGFP by immunodetection with an anti-EGFP antibody. B. A PRO41–EGFP fusion protein localizes to the ER in a signal sequence-dependent manner. Mutant pro41 was co-transformed with pE3-5Mr and pDsREDKDEL (left) or with pE3-7Mr and pDsREDKDEL (right). pE3-5Mr expresses full-length pro41 fused to egfp, whereas in pE3-7Mr, the N-terminal signal sequence of pro41 is missing (pro41DS). pDsREDKDEL expresses ER-localized dsred. Transformants were analysed by fluorescence microscopy. Scale bar = 10 mm. C and D. A PRO41–EGFP fusion protein localizes to membranes. Mutant pro41 was transformed with pEH3 or pE3-5Mr (plasmids as described in A and B). C. Total protein extract (T) from the mycelia of transformants was separated into a pellet (P) containing the membrane fraction and a supernatant (S) containing the soluble fraction after centrifugation at 100 000 g. Western blot analysis was performed with an anti-GFP antibody. Analyses were performed with three independent transformants each. Results for only one representative transformant are shown. D. Total protein extract from a pro41–egfp-expressing transformant as described in C was subjected to differential centrifugation. Supernatants (S) and pellets (P) of the consecutive centrifugation steps (9k, 9000 g; 20k, 20 000 g; 40k, 40 000 g; 100k, 100 000 g) were separated by SDS-PAGE, and Western blot analysis was performed with an anti-GFP antibody and or anti-TIM23 antibody respectively.

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

928 M. Nowrousian et al.

Fig. 4. ER morphology is normal in mutant pro41. Plasmid pEGFPKDEL expressing ER-localized EGFP was transformed into the S. macrospora wild type and mutant pro41. Vegetative hyphae of transformants were analysed by fluorescence microscopy. The net-like structures representing the ER are similar in mutant pro41 and the wild type. Scale bar = 10 mm.

for PRO41 localization, we analysed the subcellular distribution of an EGFP fusion protein of a truncated PRO41 without the signal sequence (PRO41DS–EGFP). This protein is not present in net-like structures, but is distributed throughout the cytoplasm, sometimes accumulating in diffuse patches that do not colocalize with the ER marker (Fig. 3B, right). The patches might be caused by aggregation of misfolded proteins. This can occur when hydrophobic domains are exposed, e.g. when a normally membrane-localized protein does not reach its final destination and thus cannot be folded properly (Goldberg, 2003). Some yellow regions (Fig. 3B, right) indicating colocalization of PRO41DS–EGFP with the ER marker might be due to the fact that when fluorescent proteins are present in the cytoplasm, they often cause blurring due to fluorescing molecules above and below the focal plane. Thus, in the places where yellow colour seems to indicate colocalization, PRO41DS–EGFP might be present in the cytoplasm surrounding the ER structures. Overall, the distribution of PRO41DS–EGFP is different from that of the ER marker, indicating that the signal sequence is indeed essential for correct localization of PRO41. This is corroborated by the fact that plasmid pE3-7Mr from which pro41DS–egfp is expressed does not complement mutant pro41 (Fig. 1). Biochemical analysis of PRO41 localization Several programs predicted transmembrane domains within PRO41 (Fig. 2). To verify whether PRO41 is indeed a membrane protein, we analysed protein extracts from transformants expressing the pro41–egfp fusion construct

from plasmid pE3-5Mr that complements mutant pro41. Protein extracts from transformants expressing the fusion construct or egfp alone were used to separate a membrane-containing fraction from the soluble proteins (Fig. 3C). In transformants expressing only egfp, the EGFP protein of ~27 kDa was, as expected, detected in total protein extracts as well as in the supernatant containing the soluble proteins. In transformants expressing the fusion construct, a protein of the expected size for the fusion protein (~42 kDa) was present in total protein extracts as well as the pellet containing the membrane fraction but was missing from the soluble protein fraction. In addition, a band corresponding to the size of EGFP alone was detected in the total extract and the soluble protein fraction. The latter band most likely represents residual EGFP from partial degradation of the fusion protein. Previously, in other fusion proteins, we have also observed degradation of the fungal protein part of fusion proteins while EGFP remains. This observation is most likely due to the greater stability of EGFP compared with the endogenous fungal proteins (U. Kück et al., unpubl. data). These data show that the full-length PRO41–EGFP fusion protein is indeed localized within the membrane fraction indicating that PRO41 most likely is a membrane protein. Taken together with the finding that PRO41–EGFP colocalizes with an ER marker, these data make it likely that PRO41 is an ER membrane protein. To further test this hypothesis, we performed differential centrifugation with protein extracts from a transformant expressing pro41– egfp (Fig. 3D). As a control, we used an antibody against the N. crassa TIM23, a protein of the inner mitochondrial membrane (Mokranjac et al., 2003). As in N. crassa, the antibody detected a protein of ~25 kDa in S. macrospora extracts. As expected, TIM23 is present in the pellets from the first two centrifugation steps with centrifugation velocities of up to 20 000 g (Fig. 3D). These centrifugation conditions lead to sedimentation of larger organelles like mitochondria (de Duve and Berthet, 1954). TIM23 was not detected in fractions from later centrifugation steps, indicating that no significant mitochondrial contamination was present in these fractions. The PRO41–EGFP fusion protein was detected in all pellet fractions including the 100 000 g fraction (Fig. 3D). This 100 000 g fraction contains microsomes including ER vesicles. The fact that a large proportion of the fusion protein is detected in earlier fractions is inherent to the fractionation technique. Complete sedimentation of larger particles like mitochondria already leads to partial sedimentation of the lighter particles; more than 50% of the microsomal particles sediment with the first fractions during differential centrifugation (de Duve and Berthet, 1954; Bergeron et al., 1982). Thus, the fact that the PRO41–EGFP fusion protein is still present in the 100 000 g pellet during differ-

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 929 ential centrifugation indicates that the protein localizes to microsomes. Together with the microscopic data described above, there is good evidence that PRO41 is indeed an ER membrane protein as predicted by in silico analyses. Analysis of the ER in mutant pro41 The finding that PRO41 is localized in the ER led us to wonder whether there were any changes in overall ER morphology in mutant pro41 that lacks the PRO41 protein. To address this question, we transformed both the wild type and mutant pro41 with a construct expressing ER-localized EGFP. Transformants were analysed by fluorescence microscopy (Fig. 4). As expected, the ER was present in the form of net-like structures in wild-type hyphae. A similar pattern was also observed in hyphae from mutant pro41, indicating that the overall ER morphology is not affected in the mutant strain. However, the ER of mutant pro41 might still be impaired in critical functions. One of the many roles of the ER is the folding and modification of proteins that enter the secretory pathway or are targeted to membrane-bounded organelles. Defects in these functions or other ER stress situations lead to accumulation of misfolded proteins and induce an evolutionary conserved response, the unfolded protein response (UPR). During the UPR, genes whose products are involved in protein folding in the ER are transcriptionally upregulated (Xu et al., 2005). To test whether mutant pro41 suffers from ER stress, we investigated whether five genes whose homologues are upregulated during the UPR in Aspergillus niger display higher transcript levels in mutant pro41 than in the wild type. The A. niger genes encode an ER chaperone and four different foldases (Jeenes et al., 1997; van Gemeren et al., 1997; Ngiam et al., 2000; Wang and Ward, 2000; Derkx and Madrid, 2001). Expression data for the wild type and mutant pro41 were obtained by microarray analysis as described below. However, none of the genes is differentially regulated in the mutant strain indicating that the loss of pro41 does not lead to permanent ER stress in the mutant strain (Fig. S2). Expression analysis of pro41 and analysis of epistasis between pro41 and pro1 pro41 is one of several S. macrospora developmental mutants that have already been complemented. Among the developmental genes that were identified by mutant analyses are pro1 encoding a transcription factor, pro11 encoding a WD40 repeat protein, and pro22 that is a homologue of the N. crassa ham-2 gene and involved in hyphal fusion events (Masloff et al., 1999; Xiang et al., 2002; Pöggeler and Kück, 2004). The corresponding

Fig. 5. Expression analysis of the pro41 gene. Quantitative real-time PCR analysis of pro41 expression in the developmental mutants pro1, pro11 and pro22, as well as in the wild type growing vegetatively. Comparisons were against the wild type undergoing sexual development. Values given are mean expression ratios and standard deviations from at least two biological replicates (n = 2–6). Black bars indicate that pro41 is significantly downregulated under this condition (P < 0.05, calculated with REST) (Pfaffl et al., 2002).

mutants are blocked at the same developmental stage as pro41, and we therefore wondered whether there was any genetic relationship between pro41 and the other developmental pro genes. To address this question, we used quantitative real-time PCR to compare the expression of pro41 in the three mutants pro1, pro11 and pro22 as well as in the wild type growing vegetatively with the wild type undergoing sexual development (Fig. 5). pro41 transcript levels are not changed in mutants pro11 and pro22, but are strongly downregulated in mutant pro1 and in the wild type growing just vegetatively. These data led us to hypothesize that pro41 might be epistatic to pro1, in which case at least some of the defects observed in pro1 might be due to a lack of sufficient amounts of the pro41 gene product. If this were true, the pro1/41 double mutant should be more similar to the pro41 single mutant than to the pro1 single mutant. We obtained the double mutant by genetic crosses, and, as expected, the double mutant is also sterile. From phenotypic analysis alone, no conclusion with respect to epistasis could be reached as mutants pro1 and pro41 are very similar in their overall appearance and the double mutant is virtually indistinguishable from each of the single mutants. Thus, we decided to perform microarray analyses to determine a molecular phenotype for each single mutant and the double mutant, similar to an approach that was successfully performed for developmental mutants of the slime mould Dictyostelium discoideum (Van Driessche et al., 2005). For this purpose, we used cross-species microarray hybridization to hybridize the S. macrospora targets on N. crassa microarrays which was shown previously to work well with N. crassa cDNA microarrays (Nowrousian et al., 2005; Pöggeler et al., 2006b). In the

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

930 M. Nowrousian et al. present study, we used the newly available whole genome oligonucleotide microarrays for N. crassa (Kasuga et al., 2005). Cross-species hybridizations were performed with targets derived from the wild type undergoing sexual development, the wild type growing vegetatively, and the mutant strains pro1, pro41 and pro1/41. The number of genes with significant signals with S. macrospora targets on these arrays was somewhat lower than with the cDNA arrays, but we were able to identify between 180 and 700 differentially regulated genes (P < 0.05) for each mutant and the wild type growing vegetatively when compared with the wild type during sexual development. The expression of a number of differentially regulated genes was verified by quantitative real-time PCR to confirm that cross-species hybridization of S. macrospora targets on N. crassa whole genome oligonucleotides gives reliable results (M. Nowrousian et al., in preparation). To unravel the genetic relationships between the different pro mutants, we performed correspondence analysis (COA) on the 500 most differentially expressed genes identified from the microarray analyses (Fig. 6, Fig. S3). COA is used to identify genes whose differential expression is associated with a certain condition, in this case with a certain mutant strain or with the wild type growing vegetatively. Additionally, the strains or growth conditions are grouped according to their expression patterns, i.e. the more similar the expression patterns of two strains, the closer together they are placed in a dendrogram (Fig. 6A) and in a COA plot (Fig. 6B). In both the dendrogram and the COA plot, the double mutant pro1/41 is more closely related to mutant pro41 than to mutant pro1, and all three mutant strains are clustered together and are clearly separated from the wild type growing vegetatively. The fact that the double mutant pro1/41 is more similar to pro41 than to pro1 indicates that pro41 is indeed epistatic to pro1 (Fig. 6C). However, in the case of a classical epistatic relationship, the phenotypic distance between the expression patterns of pro41 and the double mutant would be expected to be zero, i.e. their expression patterns should be identical. Even though some of the differences between pro41 and the pro1/41 double mutant might be due to experimental noise, the fact that the expression patterns of the two mutants are clearly distinguishable indicates that pro1 and pro41 might have independent roles in addition to their epistatic relationship (see Discussion). Besides revealing the relationship between pro1 and pro41, the microarray analysis also showed that the pro mutants differ greatly in their overall expression pattern from vegetatively growing mycelium. These differences might be due to variations in the expression of genes that are regulated during the first stages of sexual development, perhaps including genes that are involved in early developmental events.

Fig. 6. Molecular epistasis analysis of pro1 and pro41 by microarray hybridizations. Gene expression in the wild type growing vegetatively as well as mutants pro1, pro41 and pro1/41 was compared with the wild type undergoing sexual development. Microarray data were analysed using the Bioconductor package ‘limma’ and correspondence analysis (COA) was performed with the package ‘made4’ (Fellenberg et al., 2001; Smyth, 2004; Culhane et al., 2005). A. Hierarchical clustering of targets (in this case the different strains pro1, pro41, pro1/41, and wt vegetatively) according to the similarity of gene expression patterns. B. COA of microarray data from the wild type and developmental mutants. Gene expression in the wild type growing vegetatively as well as mutants pro1, pro41 and pro1/41 were compared with the wild type undergoing sexual development. The 500 most differentially expressed genes in any of these comparisons were used for COA. A list of the genes used in this analysis is given in Fig. S3. The biplot shows genes as black dots, and the five most differentially expressed genes at both ends of each axis are labelled in blue, red, green and orange with the number of the corresponding N. crassa open reading frame indicated. Targets are given as grey ovals. Genes that show strong expression in a certain strain are located in the direction determined by the target of this strain. The farther away from the centre, the more pronounced is the association of the genes with that strain. Genes that are downregulated in this phase appear on the opposite site of the centroid. C. Model for the genetic interaction between pro1 and pro41 in fruiting body development.

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 931 Discussion The pro41 gene is essential for sexual development in S. macrospora The formation of fruiting bodies is one of the most complex developmental processes that filamentous fungi are capable of. It requires the aggregation of hyphae to form three-dimensional structures, and leads to the differentiation of a number of fruiting body-specific cell types not present in the vegetative mycelium (Bistis et al., 2003). Both forward and reverse genetic approaches have led to the identification of a number of genes involved in fungal development (Pöggeler et al., 2006a). Especially forward genetic approaches using sterile mutants have been instrumental in identifying novel developmental genes and unravelling their specific functions within the fungal differentiation process. By complementation of such mutants, developmental genes have been identified, e.g. from Aspergillus nidulans, P. anserina and S. macrospora (Berteaux-Lecellier et al., 1995; Masloff et al., 1999; Nowrousian et al., 1999; Han et al., 2001; Busch et al., 2003; Pöggeler and Kück, 2004; Kück, 2005). The advantage of this approach is that it is unbiased with respect to the cellular functions of the genes that are identified, and that it is possible to identify previously uncharacterized genes. Consequently, the developmental genes found by mutant complementation vary greatly with respect to the subcellular localization and function of their gene products, and thus provide insights into a variety of cellular processes all of which are necessary for co-ordinated multicellular development (Pöggeler et al., 2006a). The isolation of the novel gene pro41 implicates the ER as an organelle with a role in fungal sexual differentiation, and to the best of our knowledge, this is the first ER-resident protein found to be specifically involved in development of filamentous fungi. A further step in the investigation of novel developmental genes is the analysis of genetic or physical connections between different genes to provide a more holistic view of fruiting body formation. Microarray analyses of gene expression patterns in different sterile mutants provide one way to investigate relationships between genes essential for differentiation, and this has been applied successfully in S. macrospora, N. crassa and Gibberella zeae (Li et al., 2005; Nowrousian et al., 2005; Lee et al., 2006; Pöggeler et al., 2006b). In S. macrospora, it was found that the pro mutants pro1, pro11 and pro22 considerably differ in their overall expression patterns from a mutant in the mating-type gene Smta-1; even though all four mutant strains have a block at the same developmental stage. Thus, similar morphological phenotypes might be caused by quite different underlying molecular phenotypes. Here, we used microarrays to address the question whether pro1 and pro41 share

an epistatic relationship; similar approaches have been applied to investigate developmental mutants of D. discoideum and mutants of the mediator complex from Saccharomyces cerevisiae (van de Peppel et al., 2005; Van Driessche et al., 2005). Our analysis shows that expression in the double mutant pro1/41 is more similar to that of pro41 than that of pro1, indicating that pro41 is at least partly epistatic to pro1, i.e. pro1 might act upstream of pro41 in a developmental pathway (Fig. 6C). This is in accordance with the observation that pro41 transcript levels are strongly downregulated in mutant pro1 that lacks a transcription factor gene (Fig. 5, Masloff et al., 1999). Thus, PRO1 might directly or indirectly be responsible for the transcriptional activation of pro41, and lack of pro1 might thus lead to insufficient levels of the pro41 gene product. This might in turn be responsible for at least part of the developmental defects of mutant pro1. However, even though the expression pattern of pro1/41 is similar to that of pro41, it is not identical, indicating that in addition to their epistatic relationship, pro1 and pro41 probably contribute to one or more different genetic pathways leading to cumulative effects in the double mutant that distinguishes it from each single mutant. The transcription factor PRO1, for example, most likely activates other genes besides pro41 that contribute to fruiting body development. Also, the relationship that was unravelled by our microarray analyses is a genetic one; whether PRO1 directly upregulates pro41 has yet to be investigated. If PRO1 is not directly involved in pro41 activation, other factors that act between pro1 and pro41 will influence development and might cause different effects in different mutant backgrounds. Similar effects on expression profiles were observed in double mutants of the protein kinase A pathway that is essential for development in D. discoideum (Van Driessche et al., 2005). Our data show that similar to other systems, microarray analyses can be used as a novel tool to establish genetic relationships between developmental genes even if the mutants are morphologically similar and morphological phenotypes can thus not be used for epistasis analysis. pro41 encodes a novel ER membrane protein In silico analyses predicted PRO41 to be an ER membrane protein, and we could experimentally verify the functionality of the predicted N-terminal signal sequence as well as the membrane and ER localization of a PRO41–EGFP fusion protein. As there are no characterized PRO41 homologues available as yet, the possible function of PRO41 within the ER remains to be elucidated. The ER is the main cellular hub for protein folding, modification and distribution of proteins that are targeted to several membrane-bounded organelles, the plasma membrane, or the extracellular space. Furthermore, it is

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

932 M. Nowrousian et al. involved in Ca2+ signalling and lipid biosynthesis (Du et al., 2004; Federovitch et al., 2005). However, as mutant pro41 displays normal vegetative growth, and overall ER morphology is normal in the mutant too, pro41 does not seem to be necessary for basic ER functions, rather its role seems to be specifically related to sexual development. One possibility is that pro41 might be involved in the processing of proteins that enter the secretory pathway and are needed during sexual development. One such gene product that passes through the ER is PPG1 (Mayrhofer and Pöggeler, 2005). PPG1 is a peptide pheromone that is processed from a larger precursor molecule and secreted; however, a ppg1 deletion mutant is still fully fertile, thus, even a complete loss of mature PPG1 in the pro41 mutant would not explain the developmental phenotype of pro41. Also, PPG1 secretion is normal in mutant pro41 (S. Pöggeler, pers. comm.). A double knockout of both pheromone genes ppg1 and ppg2 of S. macrospora shows a drastic reduction in the number of mature fruiting bodies; however, the second pheromone PPG2 is thought to be secreted via an ER-independent pathway (Mayrhofer et al., 2006). Another class of proteins that are routed to their final destination via the ER are the G-protein-coupled transmembrane receptors (Stefan et al., 1998). Several of these have been shown to be involved in fruiting body development of filamentous fungi either as pheromone receptors or as receptors for yet to be determined ligands (Han et al., 2004; Kim and Borkovich, 2004; Seo et al., 2004; Krystofova and Borkovich, 2006; Mayrhofer et al., 2006). It might be speculated that PRO41 is involved in maturation or transport of one or more of such plasma membrane-localized receptors. Besides the plasma membrane, several intracellular organelles are surrounded by membranes and receive proteins and lipids from the ER. Among these are the vacuoles, and one of the beststudied proteins from this organelle is the vacuolar ATPase. The membrane-localized subunits that comprise the integral membrane part (Vo) of the protein are assembled in the ER (Malkus et al., 2004). In N. crassa, it was shown that mutations in several of the subunits result in defects in sexual development (Chavez et al., 2006). However, the mutants are rather pleiotropic and display a number of other phenotypes in addition to the developmental defects, e.g. altered morphology of the vegetative mycelium. As the vegetative growth of mutant pro41 is normal, it is unlikely that the mutant has any gross alterations in the amount of mature V-ATPase. Taken together, not many proteins that are ER-localized or pass through the ER en route to their final destination and are involved in fruiting body morphogenesis have been characterized to date; thus, the cellular function of PRO41 might involve yet unknown factors. Generally, the ER is a complex organelle with many different functions,

few of which have been analysed at the molecular level in filamentous fungi. Especially the role of the ER in fungal developmental processes is rather obscure. Therefore, it is even more interesting that with PRO41 we have identified an ER protein that is specifically involved in sexual development. Thus, further analysis of the cellular functions of PRO41 might lead to insights into fungal ER biology.

Experimental procedures Strains, growth conditions and transformation The following S. macrospora strains from our laboratory collection were used in this study: S48977 (wild type), M8871 (pro1), S24117 (pro11), S22528 (pro22), S46357 (pro41), S63146 (pro1/41). Unless stated otherwise, standard growth conditions and transformation protocols for S. macrospora were as described (Masloff et al., 1999; Nowrousian et al., 1999). For RNA extraction from cultures developing fruiting bodies, S. macrospora was grown for 4 days at 25°C in floating culture as described (Nowrousian et al., 2005). For extractions from vegetative mycelium, S. macrospora was inoculated into an Erlenmeyer flask with 100 ml of liquid medium and shaken at 130 r.p.m. for 4 days at 25°C as described before (Nowrousian and Cebula, 2005). For mycelial protein preparations, S. macrospora was grown for 2 days at 25°C in Fernbach flasks with 150 ml liquid cornmeal medium (Esser, 1982). For the analysis of secreted proteins, S. macrospora was grown for 3 days in Petri dishes with liquid CM medium as described (Nowrousian et al., 1999; Mayrhofer et al., 2006).

Cloning procedures Plasmids used in this investigation are given in Table 1 and oligonucleotides in Table 2. Subcloning of cosmid fragments containing pro41 was performed according to standard procedures (Maniatis et al., 1982), pro41 and adjacent sequences were deposited in the public databases under Accession No. emb|AM410183. Cloning of pro41 cDNA fragments by 5′- and 3′-RACE was done as described previously (Nowrousian et al., 2006). For verification of the deletion of the pro41 gene in mutant pro41, fragments spanning the deletion were amplified from genomic DNA of mutant pro41 using oligonucleotides pro41-1 and pro41-2. The PCR fragments were cloned into vector pDrive (Qiagen) and sequenced (MWG Biotech). For the construction of a fulllength pro41–egfp fusion construct, pro41 was amplified from genomic DNA with oligonucleotides 2767for2.1 and MrevL1. Thereby, NcoI sites were introduced at both ends whereas an NcoI site close to the end of the pro41 ORF was eliminated without changing the encoded amino acid. The PCR fragment was subcloned into pDrive (Qiagen), sequence-verified, and the NcoI fragment containing the pro41 ORF was cloned into vector pEH3/NcoI resulting in plasmid pE3-5Mr. This vector allows expression of the pro41–egfp fusion under control of the gpd promoter/5′ UTR and the trpC terminator of Aspergillus nidulans. These regulatory regions result in a constitutive

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 933 Table 1. Plasmids and cosmids used in this study. Plasmid/cosmid

Description

Reference

C6 and G2 pMOcosXG20A10

From S. macrospora cosmid library, complement mutant pro41 From N. crassa cosmid library, complements mutant pro41

pSF13, pSF19, pSF17, pSF12

Restriction fragments from cosmid C6 subcloned into pBluescriptII/KS+ (Stratagene) PCR fragments amplified from wild-type genomic DNA and cloned into pDrive (Qiagen) egfp expression vector for filamentous fungi pro41 in fusion with egfp in vector pEH3 pro41 without signal sequence for ER insertion in fusion with egfp in vector pEH3 Plasmid for expressing ER-localized DsRED Plasmid for expressing ER-localized EGFP ppg1 signal sequence for ER insertion in fusion with egfp in vector pEH3 pro41 signal sequence for ER insertion in fusion with egfp in vector pEH3

Pöggeler et al. (1997a) Fungal Genetics Stock Center (FGSC) This work

pSK8.10, pSK9.3, pSK10.1, pSK11.8 pEH3 pE3-5Mr pE3-7Mr pDsREDKDEL pEGFPKDEL pSppg1-1 pSpro41

expression in S. macrospora (Pöggeler et al., 2003). Construction of pE3-7Mr expressing pro41 without the N-terminal signal sequence in fusion with egfp was the same, oligonucleotide 2767for1.2 was used instead of 2767for2.1. For construction of plasmid pSpro41 that expresses a fusion of the pro41 N-terminal signal sequence with egfp, oligonucleotides pro41-Sfor and pro41-Srev were annealed and the resulting double-stranded fragment encoding the PRO41 signal sequence was ligated into vector pEH3/NcoI. Plasmid pEGFPKDEL encodes EGFP in fusion with an N-terminal signal sequence for co-translational insertion into the ER from ppg1 and the C-terminal ER retention signal KDEL (Pelham, 1990). It was constructed by amplification of a fragment containing the A. nidulans gpd promoter/5′ UTR, and the ppg1 signal sequence in fusion with egfp from plasmid pSppg1-1 (Pöggeler et al., 2003) using oligonucleotides gpdpst and egfpkdel thereby introducing the KDEL-encoding sequence at the 3′ end of egfp. The PCR fragment was cloned into pDrive (Qiagen), sequence-verified, and the PstI-BamHI fragment containing the egfp fusion construct was ligated into plasmid pSM2nat/PstI+BamHI, a derivative of EGFP reporter plasmid pSM2 (Pöggeler et al., 2003) where the hph resistance cassette was replaced with the

This work Pöggeler et al. (2003) This work This work This work This work Mayrhofer and Pöggeler (2005) This work

ApaI/EcoRI nourseothricin-resistance cassette from vector pD-NAT1 (Kück and Hoff, 2006). Plasmid pDsREDKDEL encodes DsRED in fusion with the N-terminal signal sequence for co-translational insertion into the ER from pro41 and the C-terminal ER retention signal KDEL. It was constructed by ligating the annealed oligonucleotides pro41-Sfor and pro41-Srev into vector pRHN3/NcoI which contains dsred under control of the A. nidulans gpd promoter/5′ UTR. The fragment containing the promoter, the pro41 signal sequence and dsred was amplified using oligonucleotides gpdpst and dsredkdel, subcloned into vector pDrive (Qiagen), and cloned into vector pSM2nat via BamHI and EcoRI restriction sites.

Preparation of nucleic acids and hybridization protocols DNA isolation was performed as described by Pöggeler et al. (1997b). RNA and poly(A) RNA were prepared as described previously (Nowrousian et al., 2005). The integrity of RNAs was verified by agarose gel electrophoresis and Northern blot analysis prior to extraction of poly(A) RNA. Southern and Northern blottings were performed and hybridized according

Table 2. Oligonucleotides used in this study. Oligonucleotide

Sequence 5′-3′

2767for1.2 2767for2.1 dsredkdel egfpkdel gpdpst MrevL1 pro41-1 pro41-2 pro41for pro41rev pro41-Sfor pro41-Srev

GCCATGGCACTCGAGGGCTTCTTCTG CCGCCATGGACATGGGAAAACTCATTAAG CGGATCCTAGAGCTCGTCCTTCAGGAACAGGTGGTGGCGGCCCTCGG TTAGAGCTCGTCCTTGTACAGCTCGTCCATGCCGAG GCTGCAGGTACAGTGACCGGTGACTCTTTCTG GCCATGGATACACGTCCGGACTTGCCACCACGCTGTGGTAGTGTCCAGGGCTTTGC TCCATAACGTGCGGGGAGCCAAGC AGGACTGGATGCCACGAAAACGCC GTGGCCGCTCGGTTTTATTG TCACCTGGTAAATCGCAGCGT CATGGGAAAACTCATTAAGAACCACTGGGCGAGGCTCATTATACTGGCTGCTGGAACTTACCAAGTCGCAGCCGCACT CATGAGTGCGGCTGCGACTTGGTAAGTTCCAGCAGCCAGTATAATGAGCCTCGCCCAGTGGTTCTTAATGAGTTTTCC

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

934 M. Nowrousian et al. to standard techniques (Sambrook et al., 2001) using labelled DNA probes.

32

P-

Microarray hybridization and data analysis The N. crassa microarrays used in these experiments were whole genome oligonucleotide microarrays (Kasuga et al., 2005) obtained through the Fungal Genetics Stock Center (http://www.fgsc.net). Cross-species microarray hybridization with Cy3 and Cy5 labelled S. macrospora probes was performed as previously described (Nowrousian et al., 2003; 2005) with the following modifications: dye coupling reactions were cleaned using the CyScribe GFX purification kit (Amersham), array slides were treated with the Pronto background reduction kit (Corning) prior to pre-hybridization, and hybridization of targets was done in hybridization solution containing 40% formamide, 5¥ SSC and 0.1% SDS. For each strain or growth condition, two independent experiments were carried out with a dye switch in the second experiment. Analysis of tiff-files from arrays was done with ScanAlyze (written by Michael Eisen, Stanford-University, CA, http://rana.lbl.gov/ EisenSoftware.htm). Statistical and graphical analysis was carried out in the R computing environment (version 2.3.1) using the ‘linear models for Microarray data’ (limma) package (Smyth, 2004) and the ‘multivariate analysis of microarray gene expression data’ (made 4) package (Culhane et al., 2005) which are part of the Bioconductor project (Gentleman et al., 2005): data were normalized and scaled between arrays using vsn (variance stabilization and calibration for microarray data) (Huber et al., 2002). Differential expression of genes was determined using an empirical Bayes approach within limma. Hierarchical clustering to determine the similarity of targets (i.e. different strains) according to their gene expression patterns, and COA to determine associations between differentially expressed genes and different targets was carried out with the made4 package. COA was performed with all genes on the arrays as well as the 500 most differentially expressed genes as ranked by a moderated F-statistic provided by the empirical Bayes approach, results in both cases were similar. Details of experimental procedures, raw data, and results of statistical analysis of microarray hybridizations were submitted to the public repository ArrayExpress (http://www.ebi. ac.uk/arrayexpress/) and can be retrieved under Accession No. E-MEXP-915. A more detailed description of the experimental conditions is given in Fig. S4.

Quantitative real-time PCR Quantitative real-time PCR was performed as described previously (Nowrousian et al., 2005; Pöggeler et al., 2006b). Primers pro41for and pro41rev (Table 2) were used for the amplification of the pro41 gene. Mean Ct values (threshold cycles) were calculated from triplicates and used for calculations of expression ratios according to Pfaffl (2001) with primer-specific efficiencies. The Ct values for an amplicon of the SSUrRNA were used as a reference for normalization. For each primer pair, real-time experiments were carried out at least twice with biologically independent samples, and the significance of differential expression was verified using REST (Pfaffl et al., 2002).

Preparation of protein extracts and immunodetection Analysis of secreted proteins was done as described previously (Mayrhofer and Pöggeler, 2005). Protein extraction from mycelia was performed as described previously (Kinghorn et al., 2005) with the following modifications: mycelium was harvested by filtration and was homogenized in liquid nitrogen. Ten millilitres of cold extraction buffer [25 mM MOPS pH 7.2, 0.25 M sucrose, 5% (v/v) glycerol, 1 mM MgCl2, 1 mM EDTA, 100 mM PMSF, 1 mM DTT, 1 complete mini protease inhibitor cocktail tablet (Roche Diagnostics)] was added, the mycelium was vortexed for 1 min, filtered through cheese cloth, and centrifuged for 10 min at 3000 r. p.m. The last two steps were repeated twice and the resulting supernatant was used as crude protein extract. The protein content of the crude extract was determined as described previously (Bradford, 1976). A membrane fraction was obtained from the crude protein extract by centrifugation for 1 h at 4°C at 100 000 g. For differential centrifugation, the crude protein extract was subjected to consecutive centrifugation steps with increasing speed and time (9000 g, 5 min; 20 000 g, 30 min; 40 000 g, 1 h; 100 000 g, 1 h). The pellets were dissolved in SDS buffer [0.1 M Tris pH 6.8, 4% SDS, 20% glycerol (v/v), 1 mM PMSF, 5% b-mercaptoethanol]. Five to ten micrograms of crude extract or supernatants or 7 ml of dissolved pellets was separated by SDS-PAGE (Laemmli, 1970). Immunodetection of EGFP fusion proteins was done with monoclonal anti-GFP antibody BD living colours JL-8 (Clontech) in a 1:4000 dilution according to the manufacturer’s instructions using an anti-mouse horseradish peroxidase (HRP)-linked secondary antibody (Cell Signaling Technologies). For immunodetection of the mitochondrial membrane protein TIM23, an antibody against the N. crassa TIM23 protein was used as described previously (Mokranjac et al., 2003) in a 1:1000 dilution using an anti-rabbit HRPlinked secondary antibody (Cell Signaling Technologies).

Microscopy For microscopy, S. macrospora strains were grown for 2 days on glass slides with a thin layer of corn meal extract (25 g corn meal per litre water, 12 h 60°C, diluted 1:1 in water) solidified with 0.8% agar. Slides were placed in Petri dishes on a spacer. Fluorescence and light microscopic investigations were carried out with an AxioImager microscope (Zeiss, Jena, Germany) using an XBO 75 xenon lamp for fluorescence excitation. Fluorescence was studied using Chroma filter sets 41017 and 41035 for detection of EGFP and DsRED respectively. Images were captured with a Photometrix Cool SnapHQ camera (Roper Scientific) and MetaMorph (Vers. 6.3.1, Universal Imaging). Recorded images were edited with MetaMorph and Adobe Photoshop CS2.

Acknowledgements We would like to thank Swenja Ellßel and Ingeborg Godehardt for excellent technical assistance and Prof. Dr. Hanspeter Rottensteiner and Christian Würtz for the antiTIM23 antibody. This study was supported by the Deutsche Forschungsgemeinschaft (Sonderforschungsbereich 480, Project A1) and by Grant PO1 GM068087 from the NIH.

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 935 References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389– 3402. Beers, J., Glerum, D.M., and Tzagoloff, A. (1997) Purification, characterization, and localization of yeast Cox17p, a mitochondrial copper shuttle. J Biol Chem 272: 33191–33196. Bendtsen, J.D., Nielsen, H., von Heijne, G., and Brunak, S. (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340: 783–795. Bergeron, J.J., Rachubinski, R.A., Sikstrom, R.A., Posner, B.I., and Paiement, J. (1982) Galactose transfer to endogenous acceptors within Golgi fractions of rat liver. J Cell Biol 92: 139–146. Berteaux-Lecellier, V., Picard, M., Thompson-Coffe, C., Zickler, D., Panvier-Adoutte, A., and Simonet, J.M. (1995) A nonmammalian homolog of the PAF1 gene (Zellweger syndrome) discovered as a gene involved in caryogamy in the fungus Podospora anserina. Cell 81: 1043–1051. Bistis, G.N., Perkins, D.D., and Read, N.D. (2003) Different cell types in Neurospora crassa. Fungal Genet Newls 50: 17–19. Bonnet, C., Espagne, E., Zickler, D., Boisnard, S., Bourdais, A., and Berteaux-Lecellier, V. (2006) The peroxisomal import proteins PEX2, PEX5 and PEX7 are differently involved in Podospora anserina sexual cycle. Mol Microbiol 62: 157–169. Bowman, E.J., Kendle, R., and Bowman, B.J. (2000) Disruption of vma-1, the gene encoding the catalytic subunit of the vacuolar H+-ATPase, causes severe morphological changes in Neurospora crassa. J Biol Chem 275: 167–176. Bradford, M.M. (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248– 254. Busch, S., Eckert, S.E., Krappmann, S., and Braus, G.H. (2003) The COP9 signalosome is an essential regulator of development in the filamentous fungus Aspergillus nidulans. Mol Microbiol 49: 717–730. Chavez, C., Bowman, E.J., Reidling, J.C., Haw, K.H., and Bowman, B.J. (2006) Analysis of strains with mutations in six genes encoding subunits of the V-ATPase: eukaryotes differ in the composition of the Vo sector of the enzyme. J Biol Chem 281: 27052–27062. Clamp, M., Cuff, J., Searle, S.M., and Barton, G.J. (2004) The Jalview Java alignment editor. Bioinformatics 12: 426–427. Contamine, V., Zickler, D., and Picard, M. (2004) The Podospora rmp1 gene implicated in nucleus-mitochondria cross-talk encodes an essential protein whose subcellular location is developmentally regulated. Genetics 166: 135– 150. Culhane, A.C., Thioulouse, J., Perriere, G., and Higgins, D.G. (2005) MADE4: an R package for multivariate analysis of gene expression data. Bioinformatics 21: 2789–2790. Derkx, P., and Madrid, S. (2001) The foldase CYPB is a component of the secretory pathway of Aspergillus niger and contains the endoplasmic reticulum retention signal HEEL. Mol Genet Genomics 266: 537–545.

Du, Y., Ferro-Novick, S., and Novick, P. (2004) Dynamics and inheritance of the endoplasmic reticulum. J Cell Sci 117: 2871–2878. de Duve, C., and Berthet, J. (1954) The use of differential centrifugation in the study of tissue enzymes. Int Rev Cytol 3: 225–275. Esser, K. (1982) Cryptogams – Cyanobacteria, Algae, Fungi, Lichens. London: Cambridge University Press. Federovitch, C.M., Ron, D., and Hampton, R.Y. (2005) The dynamic ER: experimental approaches and current questions. Curr Opin Cell Biol 17: 409–414. Fellenberg, K., Hauser, N.C., Brors, B., Neutzner, A., Hoheisel, J.D., and Vingron, M. (2001) Correspondence analysis applied to microarray data. Proc Nat Acad Sci USA 98: 10781–10786. Gaba, A., Wang, Z., Krishnamoorthy, T., Hinnebusch, A.G., and Sachs, M.S. (2001) Physical evidence for distinct mechanisms of translational control by upstream open reading frames. EMBO J 20: 6453–6463. Galagan, J., Calvo, S., Borkovich, K., Selker, E., Read, N., Jaffe, D., et al. (2003) The genome sequence of the filamentous fungus Neurospora crassa. Nature 422: 859–868. van Gemeren, I.A., Punt, P.J., Drint-Kuyvenhoven, A., Broekhuijsen, M.P., van’t Hoog, A., Beijersbergen, A., et al. (1997) The ER chaperone encoding bipA gene of black Aspergilli is induced by heat shock and unfolded proteins. Gene 198: 43–52. Gentleman, R., Carey, V.J., Huber, W., Irizarry, R.A., and Dudoit, S. (2005) Bioinformatics and Computational Biology Solutions Using R and Bioconductor. Heidelberg: Springer. Goldberg, A.L. (2003) Protein degradation and protection against misfolded or damaged proteins. Nature 426: 895– 899. Han, K.H., Han, K.Y., Yu, J.H., Chae, K.S., Jahng, K.Y., and Han, D.M. (2001) The nsdD gene encodes a putative GATA-type transcription factor necessary for sexual development of Aspergillus nidulans. Mol Microbiol 41: 299– 309. Han, K.-H., Seo, J.-A., and Yu, J.-H. (2004) A putative G protein-coupled receptor negatively controls sexual development in Aspergillus nidulans. Mol Microbiol 51: 1333– 1345. Hofmann, K., and Stoffel, W. (1993) TMbase – A database of membrane spanning proteins segments. Biol Chem Hoppe-Seyler 374: 166. Huber, W., von Heydebreck, A., and Sültmann, H. (2002) Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 18: S96–S104. Jackson, M.R., Nilsson, T., and Peterson, P.A. (1990) Identification of a consensus motif for retention of transmembrane proteins in the endoplasmic reticulum. EMBO J 9: 3153–3162. Jeenes, D.J., Pfaller, R., and Archer, D.B. (1997) Isolation and characterisation of a novel stress-inducible PDI-family gene from Aspergillus niger. Gene 193: 151–156. Kasuga, T., Townsend, J.P., Tian, C., Gilbert, L.B., Mannhaupt, G., Taylor, J.W., and Glass, N.L. (2005) Longoligomer microarray profiling in Neurospora crassa reveals the transcriptional program underlying biochemical and

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

936 M. Nowrousian et al. physiological events of conidial germination. Nucleic Acids Res 33: 6469–6485. Kim, H., and Borkovich, K.A. (2004) A pheromone receptor gene, pre-1, is essential for mating type-specific directional growth and fusion of trichogynes and female fertility in Neurospora crassa. Mol Microbiol 52: 1781–1798. Kinghorn, J.R., Sloan, J., Kana’n, G.J., Dasilva, E.R., Rouch, D.A., and Unkles, S.E. (2005) Missense mutations that inactivate the Aspergillus nidulans nrtA gene encoding a high-affinity nitrate transporter. Genetics 169: 1369–1377. Krystofova, S., and Borkovich, K.A. (2006) The predicted G-protein-coupled receptor GPR-1 is required for female sexual development in the multicellular fungus Neurospora crassa. Eukaryot Cell 5: 1503–1516. Kück, U. (2005) A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation. Mol Genet Genomics 274: 307–315. Kück, U., and Hoff, B. (2006) Application of the nourseothricin acetyltransferase gene (nat1) as dominant marker for the transformation of filamentous fungi. Fungal Genet Newsl 53: 9–11. Kunau, W.-H., and Erdmann, R. (1998) Peroxisome biogenesis: back to the endoplasmic reticulum? Curr Biol 8: R299–R302. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685. Lee, S.H., Lee, S., Choi, D., Lee, Y.W., and Yun, S.H. (2006) Identification of the down-regulated genes in a mat1-2deleted strain of Gibberella zeae, using cDNA subtraction and microarray analysis. Fungal Genet Biol 43: 295–310. Li, D., Bobrowicz, P., Wilkinson, H.H., and Ebbole, D.J. (2005) A mitogen-activated protein kinase pathway essential for mating and contributing to vegetative growth in Neurospora crassa. Genetics 170: 1091–1104. Malkus, P., Graham, L.A., Stevens, T.H., and Schekman, R. (2004) Role of Vma21p in assembly and transport of the yeast vacuolar ATPase. Mol Biol Cell 15: 5075–5091. Maniatis, T., Fritsch, E.F., and Sambrooke, J. (1982) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Maruyama, J., Kikuchi, S., and Kitamoto, K. (2006) Differential distribution of the endoplasmic reticulum network as visualized by the BipA–EGFP fusion protein in hyphal compartments across the septum of the filamentous fungus, Aspergillus oryzae. Fungal Genet Biol 43: 642–654. Masloff, S., Pöggeler, S., and Kück, U. (1999) The pro1+ gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development. Genetics 152: 191–199. Mayrhofer, S., and Pöggeler, S. (2005) Functional characterization of an {alpha}-factor-like Sordaria macrospora peptide pheromone and analysis of its interaction with its cognate receptor in Saccharomyces cerevisiae. Eukaryot Cell 4: 661–672. Mayrhofer, S., Weber, J., and Pöggeler, S. (2006) Pheromones and pheromone receptors are required for proper sexual development in the homothallic ascomycete Sordaria macrospora. Genetics 172: 1521–1533. Mokranjac, D., Paschen, S.A., Kozany, C., Prokisch, H., Hoppins, S.C., Nargang, F.E., et al. (2003) Tim50, a novel

component of the TIM23 preprotein translocase of mitochondria. EMBO J 22: 816–825. Morris, D.R., and Geballe, A.P. (2000) Upstream open reading frames as regulators of mRNA translation. Mol Cell Biol 20: 8635–8642. Nakai, K., and Horton, P. (1999) PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci 24: 24–26. Ngiam, C., Jeenes, D.J., Punt, P.J., Van Den Hondel, C.A.M. J.J., and Archer, D.B. (2000) Characterization of a foldase, protein disulfide isomerase A, in the protein secretory pathway of Aspergillus niger. Appl Environ Microbiol 66: 775–782. Nowrousian, M., and Cebula, P. (2005) The gene for a lectinlike protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora. BMC Microbiol 5: 64. Nowrousian, M., Masloff, S., Pöggeler, S., and Kück, U. (1999) Cell differentiation during sexual development of the fungus Sordaria macrospora requires ATP citrate lyase activity. Mol Cell Biol 19: 450–460. Nowrousian, M., Duffield, G.E., Loros, J.J., and Dunlap, J.C. (2003) The frequency gene is required for temperaturedependent regulation of many clock-controlled genes in Neurospora crassa. Genetics 164: 923–933. Nowrousian, M., Ringelberg, C., Dunlap, J.C., Loros, J.J., and Kück, U. (2005) Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora. Mol Genet Genomics 273: 137–149. Nowrousian, M., Piotrowski, M., and Kück, U. (2006) Multiple layers of temporal and spatial control regulate accumulation of the fruiting body-specific protein APP in Sordaria macrospora and Neurospora crassa. Fungal Genet Biol (in press). Pelham, H.R. (1990) The retention signal for soluble proteins of the endoplasmic reticulum. Trends Biochem Sci 15: 483–486. van de Peppel, J., Kettelarij, N., van Bakel, H., Kockelkorn, T.T.J.P., van Leenen, D., and Holstege, F.C.P. (2005) Mediator expression profiling epistasis reveals a signal transduction pathway with antagonistic submodules and highly specific downstream targets. Mol Cell 19: 511– 522. Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45. Pfaffl, M.W., Horgan, G.W., and Dempfle, L. (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30: e36. Pöggeler, S., and Kück, U. (2004) A WD40 repeat protein regulates fungal cell differentiation and can be replaced functionally by the mammalian homologue striatin. Eukaryot Cell 3: 232–240. Pöggeler, S., Nowrousian, M., Jacobsen, S., and Kück, U. (1997a) An efficient procedure to isolate fungal genes from an indexed cosmid library. J Microbiol Methods 29: 49–61. Pöggeler, S., Risch, S., Kück, U., and Osiewacz, H.D. (1997b) Mating-type genes from the homothallic fungus

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

An ER protein essential for fungal development 937 Sordaria macrospora are functionally expressed in a heterothallic ascomycete. Genetics 147: 567–580. Pöggeler, S., Masloff, S., Hoff, B., Mayrhofer, S., and Kück, U. (2003) Versatile EGFP reporter plasmids for cellular localization of recombinant gene products in filamentous fungi. Curr Genet 43: 54–61. Pöggeler, S., Nowrousian, M., and Kück, U. (2006a) Fruiting body development in ascomycetes. In The Mycota I. Kües, U., and Fischer, R. (eds). Berlin: Springer, pp. 325–355. Pöggeler, S., Nowrousian, M., Ringelberg, C., Loros, J.J., Dunlap, J.C., and Kück, U. (2006b) Microarray and real time PCR analyses reveal mating type-dependent gene expression in a homothallic fungus. Mol Genet Genomics 275: 492–503. Sambrook, J., Fritsch, E.F., and Maniatis, T. (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sato, K., Sato, M., and Nakano, A. (2003) Rer1p, a retrieval receptor for ER membrane proteins, recognizes transmembrane domains in multiple modes. Mol Biol Cell 14: 3605– 3616. Seo, J.-A., Han, K.-H., and Yu, J.-H. (2004) The gprA and gprB genes encode putative G protein-coupled receptors required for self-fertilization in Aspergillus nidulans. Mol Microbiol 53: 1611–1623. Smyth, G.K. (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 3: Article 3. Stefan, C.J., Overton, M.C., and Blumer, K.J. (1998) Mechanisms governing the activation and trafficking of yeast G protein-coupled receptors. Mol Biol Cell 9: 885–899. Stumpferl, S.W., Stephan, O., and Osiewacz, H.D. (2004) Impact of a disruption of a pathway delivering copper to mitochondria on Podospora anserina metabolism and life span. Eukaryot Cell 3: 200–211. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24: 4876–4882. Titorenko, V.I., and Rachubinski, R.A. (2004) The peroxi-

some: orchestrating important developmental decisions from inside the cell. J Cell Biol 164: 641–645. Tusnady, G.E., and Simon, I. (2001) The HMMTOP transmembrane topology prediction server. Bioinformatics 17: 849–850. Van Driessche, N., Demsar, J., Booth, E.O., Hill, P., Juvan, P., Zupan, B., et al. (2005) Epistasis analysis with global transcriptional phenotypes. Nat Genet 37: 471–477. Wang, H., and Ward, M. (2000) Molecular characterization of a PDI-related gene prpA in Aspergillus niger var. awamori. Curr Genet 37: 57–64. Xiang, Q., Rasmussen, C., and Glass, N.L. (2002) The ham-2 locus, encoding a putative transmembrane protein, is required for hyphal fusion in Neurospora crassa. Genetics 160: 169–180. Xu, C., Bailly-Maitre, B., and Reed, J.C. (2005) Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest 115: 2656–2664.

Supplementary material The following supplementary material is available for this article online: Fig. S1: Mutant pro41 has a block at the stage of protoperithecium formation Fig. S2: Microarray analysis of gene expression of putative UPR (unfolded protein response) genes in mutant pro41 Fig. S3: Microarray data that were used for correspondence analysis (COA) Fig. S4: Microarray hybridization experiments This material is available as part of the online article from: http://www.blackwell-synergy.com/doi/abs/10.1111/ j.1365-2958.2007.05694.x (This link will take you to the article abstract). Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 64, 923–937

Lihat lebih banyak...

Comentários

Copyright © 2017 DADOSPDF Inc.