Titanium dioxide nanoparticles cause apoptosis in BEAS-2B cells through the caspase 8/t-Bid-independent mitochondrial pathway

Share Embed


Descrição do Produto

Toxicology Letters 196 (2010) 21–27

Contents lists available at ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Titanium dioxide nanoparticles cause apoptosis in BEAS-2B cells through the caspase 8/t-Bid-independent mitochondrial pathway Yongli Shi a,1 , Feng Wang a,1 , Jibao He b , Santosh Yadav a , He Wang a,∗ a b

Environmental Health Science & Cancer Center, 1440 Canal Street, Tulane University, New Orleans, LA 70112, USA Coordinated Instrumentation Facility, 6823 St. Charles Avenue, Tulane University, New Orleans, LA 70118, USA

a r t i c l e

i n f o

Article history: Received 21 September 2009 Received in revised form 17 March 2010 Accepted 24 March 2010 Available online 1 April 2010 Keywords: Titanium dioxide nanoparticles Apoptosis Caspases BEAS-2B

a b s t r a c t To understand the underlying mechanism for apoptosis induced by titanium dioxide nanoparticles (TNP), human airway epithelial cell line was cultured to investigate the relevant apoptosis pathways. Our results showed that the levels of reactive oxygen species and morphological apoptosis increased in a dosedependent manner whereas cell viability decreased in a similar manner in response to TNP exposure in the BEAS-2B cells. The activities of caspase 3 and PARP were also increased in parallel to the morphological apoptosis. Levels of caspase 9 increased significantly whereas there were no detectable changes in caspase 8 and t-Bid in the TNP treated cells. Caspase 9 inhibition blocked the TNP-induced activation of caspase 3 significantly. The levels of bax, cytochrome C, p53 and bcl-2 also changed reflecting the activation of intrinsic apoptosis pathway. Our results provide solid evidence that apoptosis in BEAS-2B cells exposed to TNP occurred via a mitochondrial apoptosis pathway independent of caspase 8/t-Bid pathway. © 2010 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Nanotechnology is rapidly developing and expanding all over the industrial world with increasing production of nano-materials. Because of their extremely small size and poorly understood biological potential, exposure to nanoparticles is emerging as an important public health issue. Among the nano-materials, titanium dioxide nanoparticles (TNP) are used in numerous products, including cosmetics, sunscreen, toothpaste and pharmaceuticals (Gheshlaghi et al., 2008). The widespread production and consumption of TNP lead to the exposure of human respiratory system to the particles. TNP has been shown to induce respiratory disorders in animal models, including lung inflammation (Grassian et al., 2007), emphysema-like lung injury (Chen et al., 2006) and lung cell death (Warheit et al., 2007) and tumor formation (Roller, 2009). The underlying mechanisms of these adverse effects, however, have not yet been characterized. TNP has been shown to induce apoptosis and oxidative stress in pulmonary epithelial cells (Park et al., 2008; Plataki et al., 2005) which might be associated with these effects. Apoptosis plays a crucial role in physiological growth control, tissue homeostasis, and surveillance of tumor formation (Fulda and Debatin, 2004), and epithelial apoptosis is associ-

ated with the development of a number of respiratory diseases (Drakopanagiotakis et al., 2008; Kuwano et al., 2002). However, the pathways of TNP-induced apoptosis are not well clarified, which hinders the understanding of association between TNP-induced apoptosis and adverse effects. There is a need to characterize the pathways of TNP-induced apoptosis to better understand the association between TNP-initiated respiratory disorders and airway epithelial apoptosis, since airway epithelia are the area where nanoparticles persist and lung tumor originates. Apoptosis of human cells mainly follows two well characterized routes, extrinsic and intrinsic pathways. In extrinsic pathway, apoptosis occurs upon the stimulation of death receptors in the cell surface to activate caspase 8. Caspase 8 can further activate caspase 3 directly leading to apoptosis or induce truncation of Bid activating caspase 3 indirectly through the release of cytochrome C from mitochondria. In intrinsic pathway, by contrast, apoptosis is driven by internal stimuli without the involvement of death receptors and caspase 8. Presumably, apoptotic processes through the two different pathways lead to different consequences in biological effects. This study is designed to investigate the pathways of the apoptosis in cultured BEAS-2B cells induced by TNP. The clarification of the pathways is to benefit the understanding of TNP-induced effects and assessment of TNP related health risks. 2. Materials and methods

∗ Corresponding author at: Environmental Health Science, Suite 2129 of Tidewater Building, 1440 Canal Street, Tulane University, New Orleans, LA 70112, USA. Tel.: +1 504 988 1081; fax: +1 504 988 1726. E-mail address: [email protected] (H. Wang). 1 These authors contributed equally to the study. 0378-4274/$ – see front matter © 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.toxlet.2010.03.014

2.1. Cell culture BEAS-2B cell line, derived from human bronchial epithelial cells, was purchased from the American Type Culture Collection (ATCC). BEAS-2B cells were maintained in Dulbecco’s-modified Eagle’s medium (DMEM) containing FBS (10%), penicillin

22

Y. Shi et al. / Toxicology Letters 196 (2010) 21–27

(100 U/ml), and streptomycin (100 ␮g/ml). Cells were grown and maintained in T75 cell culture flasks at 37 ◦ C in a 5% CO2 humidified incubator. 2.2. Reagents TNP powder: Anatase titanium dioxide nanopowder was purchased from sigma (St. Louis, MO). Antibodies for western blot: All the following antibodies used in this experiment were purchased from Cell Signaling Technology (Boston, MA). The antibodies are those for: caspase 3, cleaved caspase 3, PARP, cleaved PARP, caspase 9, cleaved caspase 9, caspase 8, cleaved caspase 8, cytochrome C, bcl-2, bax, p53, voltagedependent anion channel (VDAC), ␤-actin and GAPDH. Chemicals: Z-IETD-FMK and Z-LEHD-FMK were obtained from MP Biomedicals (Solon, OH). N-acetylcysteine (NAC) was obtained from Sigma (St. Louis, MO). YO-PRO® -1(YP), Dulbecco’s-modified Eagle’s medium (DMEM) and penicillin/streptomycin were purchased from Invitrogen (Carlsbad, CA). Fetal bovine serum (FBS) was obtained from Atlanta Biologicals (Lawrenceville, GA). 2.3. TNP solution preparation and treatment The stock solution of titanium dioxide nanoparticles (2 mg/ml) was prepared in deionized water and dispersed for 10 min by using a sonicator to prevent aggregation. The stock solution of titanium dioxide nanoparticles was kept at 4 ◦ C and used within 1 week for the experiments. Prior to each experiment, the stock solution was sonicated on ice for 10 min, then immediately diluted into the working concentrations with 0.5% FBS medium. For RNA and protein isolation, 1 × 106 cells were seeded in 100 mm dish. For YP staining, cells were seeded in 12 well plates with a cellular density of 1 × 105 . After seeding overnight to adhere, cells were treated with TNP working solution for specific time point as indicated in each experiment. Before each treatment, cells were starved with 0.5% FBS medium overnight. For inhibitor treatment, NAC in PBS, Z-IETD-FMK and Z-LEHD-FMK in DMSO were pretreated before treatment with TNP for 6 h and 1 h, respectively. 2.4. EDS analysis and DLS measurements Energy dispersive X-ray spectrometers (EDS) were obtained using a Hitachi S3400 scanning electron microscope (SEM) and an Oxford INCA EDS System operating at 20 kV. Nanoparticle samples for EDS were mounted on carbon tape. Dynamic light scattering (DLS) measurements were carried out by using 90Plus Particle Size Analyser (Brookhaven Instruments Corporation, USA). A scattering angle of 90◦ was used. The TNP solutions were prepared in DMEM medium. The scattering data were collected and computed by a data processor with 90Plus Particle Sizing software. 2.5. MTT assay

of TNP for 24 h. After washing, the cells were incubated with 40 ␮M DCFH-DA for 45 min in dark. At the end of DCFH-DA incubation, cells were washed with PBS, lysed with 1N NAOH, and aliquots were transferred to a black well plate (BD Falcon). The fluorescent intensity was measured using a multidetection microplate reader (FLUOstar Optima Microplate Reader, BMG LABTECH) with excitation and emission wavelengths of 485 nm and 520 nm, respectively. Three independent experiments were conducted. 2.8. Western blot assay BEAS-2B cells were treated with various concentrations of TNP for indicated time points. Cells were washed 3 times with ice-cold PBS (pH 7.2) and lysed in 1× SDS sample buffer containing 62.5 mM Tris–HCl (pH 6.8), 2% (w/v) SDS, 10% glycerol and 0.01% bromophenol blue, supplied with 42 ␮M dithiothreitol (DTT) for 10 min on ice. The cells were scraped off from the dish and extracted to a microcentrifuge tube for sonication (15 s). The solution was spun at 14,000 × g for 5 min at 4 ◦ C. The samples were stored at −70 ◦ C for experiments. The proteins of mitochondrial and cytosolic fraction were isolated by Qproteome Mitochondria Isolation Kit (Qiagen, MD, USA) according to the manufacturer instructions. Proteins were separated by 12% SDS-PAGE gel and immunoblot analysis was performed according to the manufacturer’s instruction (Cell signaling, MA). Briefly, after electrotransferring, membrane was blocked in TBS/0.1% Tween 20 with 5% (w/v) nonfat dry milk for 1 h at room temperature, then incubated with various primary antibodies overnight on a shaker at 4 ◦ C. The proteins were visualized by using the odyssey infrared imaging system (LI-COR Biosciences) after incubation with the appropriate secondary antibodies for 1 h at room temperature. 2.9. Quantitative real-time polymerase chain reaction (PCR) analysis After treatment, total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacture’s instruction. All extracted total RNA samples were degraded with DNase (Invitrogen) to avoid DNA contamination. cDNAs were generated by reverse-transcription with Script III TM RT-PCR system (Invitrogen). Primers were designed according to human gene sequence and the sequences of the specific primer used are as follows: caspase 3 (NM032991, forward: CTCGGTCTGGTACAGATGTCG, reverse: CACGCATCAATTCCACAATTTCT), PARP (NM001618, forward: TTGAAAAAGCCCTAAAGGCTCA, reverse: CTACTCGGTCCAAGATCGCC). The human ␤actin was amplified at the same time as reverse-transcription control (NM001101, forward: CATGTACGTTGCTATCCAGGC, reverse: CTCCTTAATGTCACGCACGAT). Realtime PCR was performed by using a IQ5 PCR system (Bio-Rad) with a 3 min initial denaturation at 95 ◦ C and 30–40 cycles of 10 s at 95 ◦ C, 40 s at 63 ◦ C, and followed by melting curve cycles of 30 s at 65 ◦ C. These cycles were followed by a 1 min extension at 72 ◦ C. 2.10. siRNA knockdown of Bid expression

To investigate the cell viability exposed to different concentrations of TNP in BEAS-2B cells, MTT assay was conducted according to manufacturer’s instruction (sigma, St. Louis, MO) with slight modification. Briefly, 1 × 105 cells were seeded in 12-well plate, when 80% confluence, cells were starved overnight. After treatment with different concentrations (0, 5, 50 or 100 ␮g/ml) of TNP for 24 h, 80 ␮L of thiazolyl blue tetrazolium bromide solution (5 mg/ml) was added into each well and incubated for 3 h at 37 ◦ C. Then, we removed the medium and added 800 ␮L MTT solubilization solution (10% Triton-X-100 in acidic isopropanol). When the formazan was completely dissolved, suspension was transferred into a microtube and centrifuged for 1 min at 10,000 × g. The supernatant was transferred to a 96 well plate for the measurement of absorbance at a wavelength of 550 nm (Bio-Rad microplate reader).

BEAS-2B cells were transfected with Bid siRNA, which was synthesized by Invitrogen. Bid siRNA (sequences: 5 -GAG CUG CAG ACU GAU GGC AAC CGC A-3 ) or nonspecific control siRNA (Invitrogen) was transfected by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Briefly, Lipofectamine 2000 was incubated with OPTI-MEM for 15 min. Subsequently, a mixture of siRNA and transfection reagents were incubated for 15 min at room temperature, this mixture was then added to cells and allowed to incubate for 24 h before cells were treated with or without TNP. After treatment, cells were harvested 24 h later for protein expression measurements. The final concentration of siRNA in each well was 100 nM. The silencing efficiency was detected by western blot analyses using the respective antibodies.

2.6. Apoptosis assay

2.11. Statistical analysis

YP staining was performed as described in literature (Zhao et al., 2009) with slight modifications. Briefly, BEAS-2B cells were seeded in 12 well plates overnight to adhere. After starving overnight, cells were treated with indicated concentrations of TNP as described above for 24 h. YP was added into the cultures (0.5 ␮M) for 10 min at room temperature and cells were washed twice with 0.5% FBS medium. Apoptotic cells were monitored by using fluorescence microscope (Nikon). Percentage of apoptotic cells (YP positive cells) were calculated. The apoptosis was also determined by annexin V/propidium iodide staining, The Vybrant® Apoptosis Assay Kit #2 (Invitrogen, Carlsbad, CA) was used. BEAS2B cells were cultured in 8-well slide and treated with different concentrations of TNP for 24 h, staining was performed according to the manufacturer’s instructions. Under the fluorescence microscopy, apoptotic cells should show a significantly higher degree of surface labeling. Dead cells will show both membrane staining by annexin V and strong nuclear staining from the propidium iodide.

Data are expressed as mean ± standard error. Intergroup differences were tested by analysis of variance (ANOVA), followed by the Tukey’s test procedure for multiple comparisons. A p value of less than 0.05 was considered as significant difference. Result representation of 3 or more separate experiments.

2.7. ROS assay To measure ROS generation, 2 ,7 -dichlorofluorescin-diacetate (DCFH-DA) was utilized. Briefly, after starvation, cells were treated with different concentrations

3. Results 3.1. TNP character EDS analysis of the particle surface chemical composition revealed that the TiO2 nanoparticles contained 54% titanium (Ti) and 46% oxygen (O) elements (Fig. 1C). The size of the TNP as measured by DLS as showed in Fig. 1B, the average size of TNP used in this study was 27.39 ± 0.031 nm in diameter with a polydispersity index of 0.143, which is almost in agreement with the size obtained from TEM measurements (TEM

Y. Shi et al. / Toxicology Letters 196 (2010) 21–27

23

Fig. 1. (A) Cell viability (MTT assay), apoptotic cells (YP staining) and ROS generation in BEAS-2B cells treated with different concentrations of TNP for 24 h. Dose-dependent decrease in cell viability and increases in ROS and morphological apoptosis are observed (**p < 0.01 versus vehicle control). (B) DLS assay for TNP. (C) Element analysis of TNP.

image not shown). Other properties (diameter:
Lihat lebih banyak...

Comentários

Copyright © 2017 DADOSPDF Inc.