Parasitol Res (2009) 105:1223–1229 DOI 10.1007/s00436-009-1542-6
ORIGINAL PAPER
Trans-sialidase from Trypanosoma brucei as a potential target for DNA vaccine development against African trypanosomiasis Marcelo Sousa Silva & Duarte Miguel F. Prazeres & Andreia Lança & Jorge Atouguia & Gabriel Amaro Monteiro
Received: 30 January 2009 / Accepted: 15 June 2009 / Published online: 7 July 2009 # Springer-Verlag 2009
Abstract African trypanosomiasis (AT), also known as sleeping sickness in humans and Nagana in animals, is a disease caused by the protozoan parasite Trypanosoma brucei. AT is an extremely debilitating disease in human, cattle, and wild animals, and the treatment is difficult with frequent relapses. This work shows that BALB-c mice immunized intramuscularly with a single dose (100 μg) of a plasmid DNA encoding the 5′-terminal region of the transsialidase (nTSA) gene of T. brucei brucei are able to produce IgG antibodies that bind to the bloodstream form of T. brucei-protein extract and recognize the recombinant nTSA protein, expressed in Escherichia coli. Furthermore, this DNA vaccination process was able to protect 60% of mice submitted to a challenge assay with the infective form of T. brucei brucei parasites. These results demonstrate that a DNA vaccine coding for trans-sialidase from T. brucei is potentially useful in the prophylaxis of AT.
M. S. Silva (*) : A. Lança : J. Atouguia Unidade de Ensino e Investigação de Clínica das Doenças Tropicais—Centro de Malária e Outras Doenças Tropicais (CMDT), Instituto de Higiene e Medicina Tropical—IHMT, Av. da Junqueira, 96, 1349-008 Lisboa, Portugal e-mail:
[email protected] M. S. Silva : D. M. F. Prazeres : G. A. Monteiro IBB—Institute for Biotechnology and Bioengeenering, Centre for Biological and Chemical Engineering, Instituto Superior Técnico, Lisbon, Portugal
Introduction Several research reports have demonstrated that plasmid DNA immunization is able to induce a diversity of immune responses against a variety of infectious and non-infectious diseases (reviewed by Stenvenson et al. 2004; Donnelly et al. 2005; Anderson and Schneider 2007). The administration of plasmid DNA encoding a target gene via different routes (e. g., intramuscular, intradermal, subcutaneous) and vehicles is capable of generating cytotoxic T lymphocyte, T helper (Th) cells, and antibody responses in a variety of animal models (Doolan et al. 1996; Donnelly et al. 1997; Garg and Tarleton 2002; Otten et al. 2004; Speiser et al. 2005). However, a Th1 immune response profile is preferentially produced by this genetic immunization methodology probably due to the effect of the plasmid DNA adjuvant, which is also responsible for the selective activation of CD4+ T cells with a Th1 phenotype generation (Raz et al. 1996; Leclerc et al. 1997). The balance between Th1 and Th2 immune response activation may be an important question to be addressed during the rational vaccine development process. In this context, African trypanosomiasis (AT) may be a good example of polarized Th1 immune response activation. The causative agent of AT is an extra-cellular protozoan called Trypanosoma brucei that is transmitted by the bite of the infected tsetse fly (Glossina sp.). There are three subspecies of these parasites, denominated T. brucei brucei, T. brucei gambiense, and T. brucei rhodesiense. T. brucei brucei causes animal trypanosomiasis; T. brucei gambiense and T. brucei rhodesiense are the causative agents of human AT and denominated sleeping sickness. The World Health Organization estimates that several hundred thousand people are currently infected with T. brucei and live in endemic areas (Simarro et al. 2008).
1224
In the natural course of the AT infection, the interactions between the T. brucei and the host, preferentially induce an early Th1 polarized immune response profile, characterized by the release of inflammatory mediators and the secretion of gamma-interferon (IFN-γ), tumor necrosis factor (TNF), and interleukin (IL)-2 cytokines in response to some of the parasite’s antigens (Hertz et al. 1998; Namangala et al. 2001; Drennan et al. 2005). Thus, the Th1 immune response may be important in the immunopathological consequences of AT and which relative resistance to AT is associated with a strong Th1 immunity with IFN-gamma cytokines production, which is a contribute linker to host resistance. To find appropriate parasites targets for vaccine and drugs, development is a constant challenge in biomedical research, albeit the difficulty in the identification and characterization of these targets. The trans-sialidase enzyme may represent a promising target for the development of therapeutics to treat infections caused by Trypanosoma parasites (Neres et al. 2008). In this context, T. brucei and several microorganisms make use of nTSA, a membrane-associated enzyme that transfers sialic acid from sialylated glycoconjugates present in the host’s cell surface to acceptor molecules on the parasites’ surface (Schenkman et al. 1991). The sialic acid confers a negative charge that may dramatically change the biological properties of a given surface molecule. In Trypanosoma cruzi parasites, the etiological agent of Chagas disease, these sugar residues have been implicated in some biological processes, including cell–cell interactions and T-cell activation, a key for their survival in the blood (Tribulatti et al. 2005). However, the biological function and molecular characterization of the trans-sialidase from T. brucei is poorly investigated. Thus, trans-sialidase from T. brucei (TbTSA) may be a potential antigen target for vaccine development due to its fundamental role in the production of sialylated glycoconjugates on the parasites surface, constantly interacting with host’s immune system. In order to investigate this hypothesis, we studied in this work the ability of a plasmid DNA vaccine encoding a TbTSA sequence to induce humoral and protective immune responses against T. brucei brucei parasites in the murine model.
Materials and methods Reagents and buffers Reagents: LB Broth (Sigma—USA), LB Agar (Sigma— USA), o-phenylenediamine (OPD; Sigma—USA), prestained SDS-PAGE standards (Bio-Rad—USA), protein stain (Coomassie brilliant blue R 0.25% w/v, 40% v/v methanol, and 7% v/v acetic acid—Sigma—USA), Tween®
Parasitol Res (2009) 105:1223–1229
20 (Sigma—USA), T4 DNA ligase (Promega—USA). Buffers: citrate buffer pH5.0 (0.1 M citric acid and sodium phosphate), phosphate buffer saline (PBS) pH7.4 (0.13 M NaCl, 0.002 M KCl, 0.01 M Na2HPO4, and 0.001 M KH2PO4), Tris-acetate-EDTA (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH8.0), blotting buffer (25 mm Tris, 192 mM glycine, pH8.3), SDS-sample buffer (62.5 mM Tris-HCl, pH6.8, 2/SDS, 25% glycerol, 0.01% bromophenol blue). Animals and parasites BALB-c mice used in this work were obtained from Instituto de Higiene e Medicina Tropical, Lisbon—Portugal. These mice were used in the experimental infection with T. brucei brucei and the DNA immunization protocols. Mice were inoculated intraperitoneally with approximately 5.0×102 trypanosomes prepared by dilution of the frozen stabilate with PBS-glucose 20 mM pH7.4. The cloned stabilate was T. brucei brucei GVR 35/1.5 which had been derived from trypanosomes originally isolated from a wildebeest in the Serengeti in 1966. This stabilate produces a chronic infection in mice, allowing them to survive for at least 30 days (Jennings 1993). In addition, this trypanosome mouse model has been extensively used to assess the efficacy of trypanocidal drug regimens to eliminate CNS trypanosomes (Jennings 1993; Atouguia et al. 1995; Fernandes et al. 1997). Trans-sialidase gene amplification and cloning Genomic DNA from T. brucei brucei was used as DNA template for TSA gene amplification by polymerase chain reaction (PCR) assay. The reaction was performed with 100 ng of genomic DNA, 100 pmol of each primer, 0.5 mM of each dNTPs (Bioline—Germany), 3 mM de MgCl 2 , 5 U Taq DNA polymerase—Biotaq™ DNA polymerase (Bioline—Germany), and NH4 buffer (Bioline—Germany). Specific primers (sense: 5′ATT ATAGCTAGCATGGAGGAACTCCACCAAC′3 and antisense: 5′TAATCCCTTAAGTCAGTGCAGACAATAA′3) were designed to amplify the first 1,416 bp from the TSA gene (Gene Bank®—National Library of Medicine— National Center for Biotechnology Information, Bethesda —USA) with gene identification 11141754 (Montagna et al. 2002), denominated nTSA gene. The nTSA fragment was digested with NheI and AflII endonucleases (Fermentas—USA) and cloned in the commercial plasmid DNA vaccine backbone pVAX1 (Invitrogen, USA) and subsequently subcloned in a pET28a plasmid (Novagen— USA). Restriction analysis assays and automatic nucleotide sequence (outsourced to StabVida, Oeiras—Portugal) were used to assess the cloning of the nTSA into pVAX1 and pET28a plasmids.
Parasitol Res (2009) 105:1223–1229
1225
Plasmid purification and DNA vaccination protocol
Electrophoresis and Western blotting
Plasmid DNA used for DNA immunization in BALB-c mice was prepared from 250 mL of Escherichia coli DH5α in 20 g/L LB Broth medium with 30 μg/mL (w/v) kanamycin (Bioline—UK). Plasmid purification was performed by standard alkaline lysis followed by hydrophobic interaction chromatography (Diogo et al. 2000). A group of five mice was immunized by injecting 100 μg (200 μl) of plasmid DNA encoding nTSA gene by intramuscular route. As a control groups, five mice were injected with 100 μg of plasmid pVAX1LacZ (Invitrogen—USA) and with 200 μl of PBS by the same route. After 12, 35, and 50 days, postimmunization blood samples were collected from terminal tail of the mice. The sera were pooled and stored at −20°C until further use.
The recombinant nTSA protein expression in E. coli cells was analyzed by SDS-PAGE under reducing conditions (samples were denatured for 5 min in boiling water) and immunobloting assays. E. coli BL21 (DE3) cells were transformed with pET28a encoding the nTSA gene, and protein expression was induced with 0.5 mM IPTG. After 3 h of induction, cells were centrifuged and the pellet was suspended in PBS. Subsequently, cells were suspended in SDS sample buffer and subjected to SDS-PAGE and then stained with Coomassie Brilliant Blue. Gels were blotted onto PVDF membranes (Bio-Rad, USA) which were blocked three times with PBS 1% BSA. The membranes were incubated with sera from immunized and unimmunized mice diluted in PBS (1:1,000) for 1 h at room temperature on shaking. Membranes were washed three times with PBS 0.05% Tween-20 for 10 min. Finally, the antigen-antibody reaction was developed by addition of goat anti-mouse IgG alkaline phosphate-conjugate antibody (Novagen—USA) using NBT/BCIP substrates, according to the manufacturer’s instructions.
Total protein extract from T. brucei brucei Blood collected from mice infected with T. brucei brucei was used to purify the bloodstream forms of the parasites using a gravity-operated DEAE-cellulose chromatography column (Lanham and Godfrey 1970) equilibrated with PBS-glucose 20 mM pH 7.4. The parasite-containing fractions were centrifuged, and the pellets were washed three times. A crude parasite lysate was obtained by three freeze-thaw cycles. The total protein content was measured using the BCA™ Protein Assay (Pierce, Rockford— USA). Enzyme-linked immunosorbent assay (ELISA) Total IgG antibody was measured by ELISA using sera samples from mice in the immunized and control groups. Previously, 96-well microplates (Nunc—Denmark) were coated with 100 ng/well of total protein extract from T. brucei brucei in carbonate buffer pH8.5 overnight at 4°C. The microplates were washed three times with PBS= 0.05% Tween (Promega—USA) and blocked for 1 h at room temperature with 5% (w/v) powder milk suspension in PBS. After three washes, serial dilution of each pool of the immunized mice sera were added in duplicate and incubated for 2 h at room temperature with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma Chemical Co.—USA) diluted 1:4,000 (v/v). The HRPconjugated antibodies containing microplates were left to develop for 30 min with a substrate solution made up of 10 mL of citrate buffer pH5.0 with 10 mg of OPD and 10 μL of hydrogen peroxide 30% (v/v; both from Sigma— USA). Finally, the reaction was stopped by the addition of 4 N sulfuric acid and the absorbance was measured at 492 nm.
Protective assay in vaccinated mice After 175 days of immunization, mice in vaccinated and control groups were submitted to the challenge assay, performed by intraperitoneal injection of 500 parasites (T. b. brucei GVR 35 1.5) per animal. The period of survival, defined as the number of days after infection that the infected animals remain alive, was evaluated. The presence or absence of T. brucei in the blood was monitored daily by optical microscopy and survival assessed.
Results Gene cloning and plasmid construction Blood obtained from BALB-c mice infected with T. brucei brucei parasites was used to isolate genomic DNA from T. brucei brucei. This material was then used as a template to amplify by PCR (result not shown) the 5-terminal segment from the nTSA gene, constituted by 1,416 bp. This segment (denominated here nTSA) which codes for a 50 kDa N-terminal fragment of the trans-sialidase protein was then cloned into the plasmid DNA vaccine backbone, pVAX1, and into the prokaryotic expression plasmid, pET28a. The first plasmid, nTSApVAX1, was used as a DNA vaccine prototype, whereas the second one, nTSApET28a, was used to express recombinant nTSA protein in
1226
Parasitol Res (2009) 105:1223–1229
E. coli bacteria. Following characterization by restriction analysis and nucleotide sequencing (results not shown), the nTSApVAX1 plasmid was synthesized in vivo in E. coli cells and subsequently purified by column chromatography. Anti-trypanosoma IgG antibodies measured in vaccinated mice In order to analyze the humoral immune response induced by DNA vaccination with nTSApVAX1 plasmid, sera samples were obtained after 12, 35, and 50 days postimmunization from three groups of five BALB-c mice immunized intramuscularly with a single dose of 100 μg of nTSApVAX1, 100 μg of pVAX1LacZ, or 100 μL PBS. ELISA assay was conducted using a total protein extract from T. brucei brucei as an antigen source. The humoral immune response was measured and results are represented from pool of sera from each group. The anti-trypanosoma IgG antibody titers are shown in Fig. 1 as a plot of the relation between optical density (OD) and the course of immunization. These data demonstrate that OD increase in function of the time in sera samples obtained from mice vaccinated with nTSApVAX1, when compared with control groups (PBS and pVAX1LacZ). These results suggest that the titer of IgG antibody anti-trypanosoma increases as a function of the days post immunization, whereas maximum OD was obtained after 50 days post-immunization with nTSApVAX1 (Fig. 1c). Additionally, both control groups constituted of the PBS and pVAX1LacZ show minimal OD during the whole time of immunization. nTSA recombinant protein production and immunoidentification The immunoreactivy of anti-Trypanosoma IgG antibody from immunized mice with nTSApVAX1, previously measured by ELISA (Fig. 1), was determined by Western Blotting with nTSA recombinant protein express in E. coli and visualized by SDS-PAGE after stimulated with IPTG (Fig. 2b). The Fig. 2c shows that the pool of sera obtained from nTSApVAX1 immunized group after 50 days post immunization reacts with a band about 50 kDa, equivalent to nTSA recombinant protein. This reaction was not detectable in control groups, constituted by PBS and pVAX1LacZ (results not shown). These results show that the protein of about 50 kDa is the recombinant nTSA expressed in E. coli under IPTG induction. Additionally, these results suggest that the reactivity of the antitrypanosoma IgG antibodies detected by ELISA against T. brucei total protein is mainly that of anti-nTSA antibodies, since they react with the nTSA recombinant protein.
Fig. 1 IgG humoral immune response elicited by DNA vaccination. Three groups of mice were immunized with 100 μg of nTSApVAX1 plasmid, 100 μg of pVAX1LacZ plasmid, and 100 μl of phosphate buffer saline alone by intramuscular way. Humoral immune response was measured 12 (a), 35 (b), and 50 days after immunization (c). These results are represented from pool of sera from five animals per group
Protective effect of DNA vaccination against T. brucei infection In order to analyze the protective response vaccinated with nTSApVAX1 plasmid and control groups (PBS and pVAX1LacZ), challenge assay was performed after 175 days post-immunization. The infection was monitored by evaluating survival and the presence or absence of parasites in the blood during infection with T. brucei, determined by optical microscopy. After 45 days postinfection (PI), 100% of control groups (PBS and pVAX1LacZ) were dead, whereas immunized group with nTSApVAX1 remained alive, with a protection rate of 60% (Table 1). For all groups, deaths were observed after 25 days PI, whereas 100% of mortality was observed after 35 and 45 days PI for control groups injected with pVAX1LacZ and PBS, respectively (Fig. 3). In the case of immunized group with nTSApVAX1, 40% of mortality was
Parasitol Res (2009) 105:1223–1229
kDa
a.
1227
b.
c.
200 116 50 37
29 Fig. 3 Survival after testing challenge of the animals immunized Balb-c in the days post infection with T. brucei brucei
Fig. 2 Immunodetection of antibodies in the sera of Balb-c mice immunized intramuscularly with a single 100 μg dose of nTSApVAX1 plasmid DNA vaccine. An SDS-PAGE was run with a protein extract of E. coli cells transformed with plasmid nTSApET28a and grown without (a) or with (b) IPTG induction. Samples run on the adjacent SDS-PAGE gel were blotted on PVDF membranes and made to react with sera of immunized mice collected 50 days postimmunization (c)
observed after 30 days PI (Fig. 3). These results demonstrated the influence of nTSApVAX1 DNA vaccination during the mortality and survival of infection caused by T. brucei brucei parasites.
Discussion The experimental murine model of human African sleeping sickness has been extensively applied to the study of immunopathological reactions, similar to those shown in Table 1 The mortality and protection race of different groups challenged by T. brucei brucei Groups
# Deaths after 45days PI
# Affecteda
Mortality b (%)
Protection ratec (%)
PBS
5/5
5/5
100
0
pVAX1lacZ nTSApVAX1
5/5 2/5
5/5 3/5
100 40
0 60
a
Affected was determined by directly count
b
Mortality was recorded for each day after challenge and is presented as total number of dead mouse in each group c
Percent protection was determined by the number of unaffected mouse
larger mammalian hosts using T. brucei brucei infections (Eckersall et al. 2001; Kennedy 2000). In this work, this model was used to study humoral immune response after DNA vaccination and allowed us to analyze the progress of African trypanosomiasis infection in vaccinated mice. We have selected the TbTSA as an antigenic candidate on the basis of the promising results obtained by others with the TSA from T. cruzi (TcTSA) when developing a DNA vaccine against Chagas’ disease (Costa et al. 1998 and 1999; Pereira-Chioccola et al. 1999; Araújo et al. 2005; Hoft et al. 2007). Because TbTSA has a significantly high degree of structural and biochemical similarity with TcTSA, we expected that this approach could yield similar results. In T. cruzi, TcTSA is highly immunogenic, is expressed as a surface protein, and represents an important antigen recognized by sera from patients with Chagas’ disease (Pereira-Chiocola et al. 2003). In addition, several works show that TcTSA is able to stimulate cellular immune response, as TcTSA can stimulate murine macrophages and human monocyte to produce pro-inflammatory cytokines (Golgher and Gazzinelli 2004; Gao and Pereira 2001). Different from T. cruzi, some studies show that TbTSA is expressed only on the surface of the procyclic forms of T. brucei (Montagna et al. 2002, 2006). However, the immunogenic properties and the function of TbTSA are not completely reveled. Our work provides evidence that DNA immunization of BABL-c mice with 100 μg of a plasmid (nTSApVAX1) which encodes the catalytic and amino-terminal domain of TbTSA induces a humoral immune response. This response is characterized by the production of IgG antibodies that bind specifically to a total protein extract purified from bloodstream forms of T. brucei brucei parasites and to a recombinant TbTSA produced in E. coli. Additionally, the immunization conferred a 60% protection to vaccinated BALB-c mice challenged with infective form of T. brucei brucei, when compared with control groups.
1228
Although the precise mechanism which governs the antibody production and protective response were not addressed, our results show that antibodies that recognize TbTSA are involved in this protective immune response against T. brucei infection. In addition, a probable Th1 immune response activation may be involved in the immunoprotection phenomenon presented by nTSApVAX1 intramuscular vaccination. This speculation is based on the evidence that bacterial DNA containing CpG motifs are potent activators of the immune system and that this phenomenon may play a critical role in the efficacy of the DNA vaccine to induce preferentially a Th1 phenotype (Halpern et al. 1996; Krieg et al. 1995). Thus, the critical protective effect of nTSApVAX1 vaccination could be due to immunostimulatory CpG sequence, antigen encoding nTSA sequence, or both. However, we can conclude here that the protective activity presented by nTSApVAX1 immunization must be the nTSA gene expression, once that the control plasmid (pVAX1LacZ) that has the same CpG content, does present the similar protective activity as nTSApVAX1. In experimental African trypanosomiasis, several studies have emphasized the importance of Th1/Th2 cytokines balance in the modulation the immune response and controlling the intensity of the disease. The relative resistance to African trypanosomiasis is associated with a strong Th1 immune response to parasite antigens and that gamma-interferon (IFN-γ) but not interleukin (IL)-4 is linked to host resistance (Liu et al. 1999; Uzonna et al. 1998; Hertz et al. 1998; Schopf et al. 1998). Another study shows that resistance to T. brucei brucei has been correlated with the ability of infected animals to produce Th1 cytokines, such as (IFN-γ) and TNF, in an early phase of infection, followed by IL-4 and IL-10 in late and chronic stages of the disease (Namangala et al. 2001). In addition, the participation of Th2 cytokines (e.g., IL-4, IL-5, and IL10) in the immune response of infected mice is attributed to the control of exacerbated Th1 cytokines production in order to prevent the excessive production of Th1 cytokines. Thus, the cytokine production may maintain the balance between pathogenic and protective immune responses during the infection. The current idea in which Th1 immune response is associated with the resistance to the African trypanosomiasis in murine model supports our hypothesis that vaccination with plasmid DNA, while inducing a Th1 immune response, may be responsible for the protective event observed in mice vaccinated with nTSApVAX1 and challenged with T. brucei brucei parasites. Another interesting finding of our study is the fact of immunized sera (nTSApVAX1) binding to total proteins of the bloodstream forms of T. brucei. This fact suggests (1) that TbTSA is also expressed in the bloodstream forms of T. brucei (similarly that it happens with T. cruzi) or (2) the presence of a TbTSA-like protein in the bloodstream
Parasitol Res (2009) 105:1223–1229
forms of the T. brucei, with cross-reactivity property to antinTSA antibodies. However, this phenomena needs to be investigated. In conclusion, this work shows that intramuscular immunization with a plasmid DNA encoding N-terminal TbTSA is able to induce an IgG antibody able to bind to total protein extract from T. brucei brucei parasites and recombinant nTSA protein. An important observation in our study was the fact that 60% of mice immunized with nTSApVAX1 were protected from infection. Thus, this work opens up the possibility of new investigation for AT vaccine development using TSA as a promising antigen target for immune intervention strategies in AT. Acknowledgements This work is supported by Fundação para a Ciência a Tecnologia—FCT (POCI/CVT/61090/2004 and PTDC/ CVT/72624/2006). Marcelo Sousa Silva thanks to FCT by a postdoctoral fellowship (SFRH/BPD/26491/2006). We also thank to Karina P. Sousa for helpful suggestions on the manuscript. We declare that the animal experiments presented in this work comply with the current laws of the ethic committee from Institute of Hygiene and Tropical Medicine, Lisbon—Portugal.
References Anderson RJ, Schneider J (2007) Plasmid DNA and viral vector-based vaccines for the treatment of cancer. Vaccine 25S:B24–B34 Araújo AFS, Alencar BCG, Vasconcelos JRC, Hiyane MI, Marinho CRF, Penido MLO, Boscardin SB, Hoft DF, Gazzinelli RT, Rodrigues MM (2005) CD8+-T-cell-dependent control of Trypanosoma cruzi infection in a highly susceptible mouse strain after immunization with recombinant proteins based on amastigote surface protein 2. Infec Immun 73:6017–6025 Atouguia JM, Jennings FW, Murray M (1995) Successful treatment of experimental murine Trypanosoma brucei infection with topical melarsoprol gel. Trans Royal Soc Trop Med Hyg 89:531–533 Costa F, Franchin G, Pereira-Chiocola VL, Ribeirão M, Schenkman S, Rodrigues MM (1998) Immunization with a plasmid DNA containing the gene of trans-sialidase reduces Trypanosoma cruzi infection in mice. Vaccine 16:768–774 Costa F, Pereira-Chioccola VL, Ribeirão M, Schenkman S, Rodrigues MM (1999) Trans-sialidase delivered as a naked DNA vaccine elicits na immunological response similar to a Trypanosoma cruzi infection. Braz J Med Biol Res 32:235–239 Diogo MM, Queiroz JA, Monteiro GA, Martins SAM, Ferreira GNM, Prazeres DMF (2000) Purification of a cystic fibrosis plasmid vector for gene therapy using hydrophobic interaction chromatography. Biotechnol Bioeng 68:576–583 Donnelly JJ, Friedman A, Ulmer JB, Liu MA (1997) Further protection against antigenic drift of influenza virus in a ferret model by DNA vaccination. Vaccine 15:865–868 Donnelly JJ, Wahren B, Liu MA (2005) DNA vaccines: progress and challenges. J Immunol 175:633–639 Doolan DL, Sedegah M, Hedstrom RC, Hobart P, Charoenvit Y, Hoffman SL (1996) Circumventing genetic restriction of protection against malaria with multigene DNA immunization: CD8+ T cell-, interferon gamma, and nitric oxide-dependent immunity. J Exp Med 83:1739–1746 Drennan MB, Stijlemans B, Abbeele JVD, Quesniaux VJ, Barkhuizen M, Brombacher F, De Baetselier P, Ryffel B, Magez S (2005)
Parasitol Res (2009) 105:1223–1229 The induction of a type 1 immune response following a Trypanosoma brucei infection is MyD88 dependent. J Immunol 175:2501–2509 Eckersall PD, Gow JW, McComb C, Bradley B, Rodgers J, Murray M, Kennedy PGE (2001) Cytokines and the acute phase response in post-treatment reactive encephalopathy of Trypanosoma brucei brucei infected mice. Parasit Intern 50:15–26 Fernandes JH, Atouguia JM, Peleteiro MC, Jenning FW, Rosário VE (1997) Post-treatment hind-leg paralysis in mice infected with Trypanosoma brucei brucei: a light microscopic study. Acta Trop 63:179–184 Gao W, Pereira MA (2001) Trypanosoma cruzi trans-sialidase potentiates T cell activation through antigen-presenting cells: role of IL6 and Bruton’s tyrosine kinase. Eur J Immunol 31:1503–1512 Garg N, Tarleton RL (2002) Genetic immunization elicits antigenspecific protective immune responses and decreases disease severity in Trypanosoma cruzi infection. Infect Immun 70:5547–5555 Golgher D, Gazzinelli RT (2004) Innate and adquired immunity in the pathogenesis of Chagas disease. Autoimmunity 37:399–409 Halpern MD, Kurlander RJ, Pisetsky DS (1996) Bacterial DNA induces murine interferon-gamma production by stimulation of interleukin12 and tumor necrosis factor-alpha. Cell Immunol 167:72–78 Hertz CJ, Filutowicz H, Manstield JM (1998) Resistance to the African trypanosomes is IFN-gamma dependent. J Immunol 161:6775–6783 Hoft DF, Eickhoff CS, Giddings OK, Vasconcelos JR, Rodrigues MM (2007) Trans-sialidase recombinant protein mixed with CpG motifcontaining oligodeoxynucleotide induces protective mucosal and systemic Trypanosoma cruzi immunity involving CD8+ CTL and B cell-mediated cross-priming. J Immunol 179:6889–6900 Jennings FW (1993) Combination chemotherapy of CNS trypanosomiasis. Acta Trop 54:205–213 Kennedy PGE (2000) The pathogenesis and modulation of posttreatment reactive encephalopathy in a mouse model of human African trypanosomiasis. J Neuroimmunol 100:36–41 Krieg AM, Ak YI, Matison S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM (1995) CpG motifs in bacterial DNA trigger direct B-cell actvation. Nature (Lond) 374:546–549 Lanham SM, Godfrey DG (1970) Isolation of salivarian trypanosomes from man and other mammals using DEAE-cellulose. Exp Parasitol 28:521–534 Leclerc C, Dériaud E, Rojas M, Whalen RG (1997) The preferential induction of a Th1 immune response by DNA-based immunization is mediated by the immunostimulatory effect of plasmid DNA. Cel Immunol 179:97–106 Liu Y, Ragaa E, Li Z, Nuortio L, Mustafa A, Bakhiet M (1999) Interferon-gamma and interleukin-12 genes are preferentially expressed during early experimental African trypanosomiasis and suppressed by denervation of the spleen. Scand J Immunol 50:485–491 Montagna G, Cremona ML, Paris G, Amaya MF, Buschuazzi A, Alzari PM, Frasch AC (2002) The trans-sialidase from the African trypanosome Trypanosoma brucei. Eur J Biochem 269:2941–2950 Montagna GN, Donelson JE, Frasch ACC (2006) Procyclic Trypanosoma brucei expresses separate sialidase and trans-sialidase
1229 enzymes on its surface membrane. J Biol Chem 281:33949– 33958 Namangala B, Noel W, De Baetselier P, Brys L, Beschin A (2001) Relative contribution of interferon-gamma and interleukin-10 to resistance to murine African trypanosomosis. J Infect Dis 183:1794–1800 Neres J, Bryce RA, Douglas KT (2008) Rational drug design in parasitology: trans-sialidase as a case study for Chagas disease. Drug Disc Today 13:110–117 Otten G, Schaefer M, Doe B, Liu H, Srivastava I, Megede JZ, O’Hagan D, Donnelly J, Widera G, Rabussay D, Lewis MG, Barnett S, Ulmer JB (2004) Enhancement of DNA vaccine potency in rhesus macaques by electroporation. Vaccine 22:2489–2493 Pereira-Chioccola VL, Costa F, Ribeirão M, Soares IS, Arena F, Schenkman S, Rodrigues MM (1999) Comparison of antibody and protective immune responses against Trypanosoma cruzi infection elicited by immunization with a parasite antigen delivered as naked DNA or recombinant protein. Parasitol Immunol 21:103–110 Pereira-Chiocola VL, Fragata-Filho AA, Levy AM, Rodrigues MM, Schenkman S (2003) Enzyme-linked immunoassay using recombinant trans-sialidase of Trypanosoma cruzi can be employed for monitoring of patients with Chagas’ disease after drug treatment. Clin Diagn Lab Immunol 10:826–830 Raz E, Tighe H, Sato Y, Corr M, Dudler JA, Roman M, Swain SL, Spiegelberg HL, Carson DA (1996) Preferential induction of a Th1 immune response and inhibition of specific IgE antibody formation by plasmid DNA immunization. Proc Natl Acad Sci USA 93:5141–5145 Schenkman S, Jiang M, Hart GW, Nussenzweig V (1991) A novel cell surface trans-sialidase of Trypanosoma cruzi generates a stagespecific epitope required for invasion of mammalian cells. Cell 65:1117–1125 Schopf LR, Filutowicz H, Bi X, Mansfield JM (1998) Interleukin-4 dependent immunoglobulin G1 isotypes switch in the presence of a polarized antigen-specific Th1-cell response to the trypanosome variant surface glycoprotein. Infect Immun 66:451–461 Simarro PP, Jannin J, Cattand P (2008) Eliminating human African trypanosomiasis: where do we stand and what comes next? PLoS Medicine 5:174–180 Speiser DE, Liénard D, Rufer N, Rubio-Godoy V, Rimoldi D, Lejeune F, Krieg AM, Cerottini J, Romero P (2005) Rapid and strong human CD8+ T cell responses to vaccination with peptide, IFA, and CpG oligodeoxynucleotide 7909. J Clin Invest 115:739–746 Stenvenson FK, Ottensmeier CH, Johnson P, Zhu D, Buchan SL, McCann KJ, Roddick JS, King AT, McNicholl F, Savelyeva N, Rice J (2004) DNA vaccines to attack cancer. Proc Natl Acad Sci USA 101:14646–14652 Tribulatti MV, Mucci J, Rooijen NV, Leguizámon MS, Campetella O (2005) The trans-sialidase from Trypanossoma cruzi induces thrombocytopenia during acute Chagas’ disease by reducing the platelet sialic acid contents. Infect Immun 73:201–207 Uzonna JE, Kaushik RS, Gordon JR, Tabel H (1998) Experimental murine Trypanosoma congolense infections. I. Administration of anti-IFN-gamma antibodies alters trypanosome-susceptible mice to a resistance-like phenotype. J Immunol 161:5507–5515