Plant Cell Tiss Organ Cult DOI 10.1007/s11240-009-9602-2
ORIGINAL PAPER
Transgenic indica rice cultivar ‘Swarna’ expressing a potato chymotrypsin inhibitor pin2 gene show enhanced levels of resistance to yellow stem borer M. V. Ramana Rao Æ K. S. Behera Æ N. Baisakh Æ S. K. Datta Æ G. J. N. Rao
Received: 22 June 2009 / Accepted: 6 September 2009 Ó Springer Science+Business Media B.V. 2009
Abstract Transgenic rice was developed from ‘Swarna’, the most popular indica rice cultivar (Oryza sativa L.) in South East Asia, with a potato chymotrypsin inhibitor gene (pin2) through Agrobacteriummediated transformation. Four out of nine primary transgenic plants had a single-copy T-DNA insertion while other five plants had two copies. Mendelian pattern of inheritance of the transgene (pin2) was observed in the T1 generation progeny plants. Whole plant bioassays conducted at both vegetative and reproductive stages and cut stem assays showed enhanced levels of resistance of transgenic rice against yellow stem borer. The transgenic rice lines with plant derived proteinase inhibitor genes
M. V. R. Rao K. S. Behera G. J. N. Rao (&) Central Rice Research Institute, Cuttack 753006, India e-mail:
[email protected] Present Address: M. V. R. Rao Department of Plant Biotechnology, School of Biotechnology, Madurai Kamaraj University, Madurai, Tamil Nadu 625021, India N. Baisakh S. K. Datta International Rice Research Institute, DAPO Box 7777, Metro Manila, Philippines Present Address: N. Baisakh (&) School of Plant, Environmental, and Soil Sciences, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, USA e-mail:
[email protected] Present Address: S. K. Datta Division of Crop Science, Indian Council of Agricultural Research, New Delhi 110114, India
would develop into resistant cultivars to fit into resistance breeding strategies as an important component of integrated pest management in rice. Keywords Agrobacterium Indica rice Proteinase inhibitor Swarna Transformation
Introduction Yellow stem borer is a serious insect pest of rice causing significant annual yield loss up to 50% (Baisakh and Datta 2007). Conventional breeding has not been successful for developing resistant cultivars due to the lack of resistant donors in the available rice gene pool. Genetic engineering offers unique opportunity to incorporate agronomically useful genes into commercially popular cultivars having wider adaptability. Recently, transgenic rice have been developed with insectidal proteins that confer resistance against several insect pests e.g., soybean kunitz trypsin inhibitor (SKTI) and snow drop lectin gene for resistance to brown plant hopper (Lee et al.1999; Nagadhara et al. 2003), crystal protein (cry) genes (Tu et al. 1998; Khanna and Raina 2002; Huang et al. 2001) and proteinase inhibitor genes for resistance to stem borer (Xu et al. 1996; Duan et al. 1996; Irie et al. 1996; Vain et al. 1998). Cry protein is a natural insecticide used world-wide as a nonhazardous and environmentally compatible pest controlling agent. Proteinase inhibitors edge over Cry proteins for being of plant origin although both can easily be inactivated by heat. Therefore, introduction of proteinase inhibitor gene into new host crops can be regarded as a safe strategy for insect control from the food-safety standpoint (Duan et al. 1996).
123
Plant Cell Tiss Organ Cult
An efficient and reproducible Agrobacterium-mediated transformation method is a prerequisite for improving highly popular indica cultivars, which are often considered recalcitrant to genetic manipulation. Swarna is a widely adapted and highly popular indica rice variety with a yield potential of 8.0 t ha-1 (Rao et al. 1983) and is also extensively grown in Bangladesh and Myanmar, in addition to its wide coverage over eleven states of India, for its wide adaptability and good grain quality. However, Swarna is highly susceptible to yellow stem borer, a major insect pest of rice (Mishra 2000). Considering its wide coverage, the annual yield losses are substantial. Expression of proteinase inhibitor gene from potato and maize and a trypsin inhibitor gene from bean has been shown to confer enhanced resistance in transgenic rice against striped stem borer (Bu et al. 2006; Vila et al. 2005; Mochizuki et al. 1999). However, none of the studies showed the efficacy of these inhibitor genes against yellow stem borer in transgenic rice. Hence, the present investigation was carried out with an objective to develop yellow stem borer resistance in an indica rice cv. Swarna through genetic manipulation of an insecticidal chymotrypsin inhibitor pin2 gene.
Materials and methods Transformation vectors and Agrobacterium tumefaciens strain A plant transformation vector was constructed by cloning a potato chymotrypsin inhibitor gene (pin2) driven under the control of 35S/MAS dual promoter (Comai et al. 1990) into the binary vector pCAMBIA1301 at SmaI site. The resulting plasmid (pRAO 1; Fig. 1) was mobilized into the super virulent A. tumefaciens strain LBA4404 (pSB1) (Komari et al. 1996) by triparental mating using pRK2013 as a helper (Ditta et al. 1980). Tissue culture and plant transformation Mature dehusked grains of Swarna were surface sterilized (Vijayachandra et al. 1995) and were inoculated in culture tubes containing semisolid callus induction (CI) medium
[MS (Murashige and Skoog 1962) medium supplemented with 2 mg l-1 2, 4-dichlorophenoxy acetic acid (2, 4-D), 0.5 mg l-1 kinetin (Kn) 30 g l-1 maltose and 0.75% (w/v) agar (Hi-media, Mumbai, India)]. The cultures were incubated in dark at 25 ± 1°C for a period of 3 weeks. Scutellum-derived calluses were excised and subcultured on the same CI medium for another 4 days and clusters of highly embryogenic compact calluses (3–5 mm in diameter) were selected for transformation. Agrobacterium transformation was performed following the method described earlier (Datta et al. 2000) with minor modifications. Bacterial suspension was prepared by centrifuging the overnight culture (OD = 1.0) at 3500 rpm for 30 min followed by resuspending in AA medium supplemented with 50 lM acetosyringone (AS). The calluses were immersed in the bacterial suspension in Petri dishes (60 9 15 mm2) and were kept on an orbital shaker (80– 100 rpm) for 20 min. The calluses were blotted on a filter paper to remove excess bacterial suspension and were transferred to the co-cultivation (CI) medium supplemented with 50 lM AS and 0.8% (w/v) agar and were incubated for 3 days in dark at 25 ± 1°C. Following cocultivation, the calluses were washed five times in an aqueous solution of cefotaxime (150 mg l-1) and carbenicillin (150 mg l-1) with a final wash in CI liquid medium with cefotaxime (150 mg l-1), carbenicillin (150 mg l-1) and hygromycin (30 mg l-1). The calluses were then dried on sterile filter paper (Whatman filter paper no1) and were transferred to selection (CIS) medium i.e., CI medium with 0.8% (w/v) agar, and 30 mg l-1 hygromycin, 125 mg l-1 cefotaxime, and 125 mg l-1 carbenicillin (Baisakh et al. 2001). The calluses were subject to four selection cycles, each at 15 days interval. A small portion of the callus were analysed for their GUS activity (Rueb and Hensgens 1997) at the end of the fourth selection cycle. All the GUS? calli were transferred to hygromycin free regeneration medium [MS medium supplemented with 0.5 mg l-1 a-naphthalene acetic acid (NAA), 0.5 mg l-1 kinetin, and 1.5 mg l-1 6-benzyladenine (BA) and 1.2% (w/v) agar]. The regenerated green plants were transferred to rooting medium [MS medium with 1.0 mg l-1 a-naphthalene acetic acid (NAA), 0.1 mg l-1 Kinetin, 50 g l-1 maltose and 0.7% (w/v) agar]. The plants with well
Fig. 1 Partial map of the T-DNA region of the binary vector showing pin2 gene under the control of CaMV 35S-MAS dual promoter and hpt gene driven by the CaMV 35S promoter
123
Plant Cell Tiss Organ Cult
developed roots were then transferred to pots inside a greenhouse under institutional containment facilities and grown till maturity. At the time of flowering, all the emerging panicles were bagged to prevent cross pollination. The chemicals including plant growth regulators and antibiotics used in the study were purchased from Sigma Chemicals, Bangalore, India unless stated otherwise. Polymerase chain reaction (PCR) and Southern blot analysis Genomic DNA was isolated from the leaves of putative transgenic rice plants and non-transformed wild type (WT) plants by CTAB method (Murray and Thompson 1980). PCR amplification was performed using 100 ng of genomic DNA with primer pairs specific for coding sequences of pin2, gusA and hpt genes: pin2 F: 50 - TGGCTGTTCACAAGGAAAGTT -30 , Pin2 R: 50 - GGCTTGGGTTCA TCACTTTC -30 , gusA F: 50 - GG TGGGAAAGCGCGTTACAAG -30 , gusA R: 50 -GTTTAC GCGTTGCTTCCGCCA -30 , hpt F: 50 - GCCTGAACTCA CCGCGACG -30 , hpt R: 50 -CAGCCATCGGTCCAGACG - 30 . PCR was performed in a 25 ll reaction volume containing 17.5 ll sterilized nanopure water, 2.5 ll 109 PCR buffer, 1 ll (100 ng) each primer, 1 ll dNTPs mix (0.2 mM of each dNTP), and 1 ll (0.5 U) Taq polymerase and 1 ll (100 ng) template DNA in a programmable Thermal cycler (PTC-100; MJ-Research, MA, USA) under the following PCR profiles: for gusA gene 19 (94°C for 5 min), 369 (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), 19 (72°C for 10 min); for hpt gene 19 (94°C for 5 min), 409 (94°C for 1 min, 58°C for 1 min; 72°C for 1 min), 19 (72°C for 10 min); for pin2 gene 19 (94°C for 5 min), 369 (94°C for 30 s, 56°C for 60 s; 72°C for 1 min), 19 (72°C for 10 min). Fifteen microliter of PCR product was resolved in ethidium bromide-stained 0.8% agarose gel and visualized in a gel documentation system (Alpha Innotech imager 2200, CA, USA) . Southern blot analysis was performed as described before (Baisakh et al. 2001). Briefly, 10 lg of genomic DNA from the putative transgenic and WT plants were digested with PstI and SacI (Gibco-BRL, Gaithersburg, MD) and electrophoresed on 1.0% (w/v) agarose gel and was transferred to Hybond-N? nylon membrane (Amersham, Arlington Heights, IL) according to the manufacturer’s instructions. The coding regions of pin2 (0.63-kb) and hpt (1.1-kb) genes were labeled with (µ-32P)dCTP using the Rediprime labeling Kit (Amersham, Arlington Heights, IL) and used as hybridization probes. The blots were hybridized, washed, exposed to X-ray films, and autoradiographed following Baisakh et al. (2001).
Gus reporter assay Gus assay was performed following the method of Rueb and Hensgens (1997). Leaf segments of rice transgenics were incubated in phosphate buffer (50 mM NaPO4, pH 6.8) that contained 1% Triton X-100 at 37°C for 1 h. The buffer was removed and fresh phosphate buffer containing 1 mM 5bromo-4-chloro-3-indolyl-b-D-gluronide (X-Gluc) and 20% methanol was added to the segments. The reaction was initiated under a mild vacuum for 5 min and carried out overnight at 37°C, and then tissues were examined visually. Reverse transcription (RT)-PCR Total RNA was isolated from the leaves of 2-week-old T2 plants from four T0 transgenic lines (Sw3, Sw4, Sw7, Sw8) along with non-transformed control plants using RNeasy plant minikit (Qiagen, Genetix Biotech Asia Pvt Ltd, New Delhi, India). About 1 lg of total RNA was subject to RT– PCR with the primers specific to pin2 (as mentioned earlier) using the Enhanced Avian HS RT–PCR Kit (Sigma– Aldrich Corporation, Bangalore, India) as per the manufacturer’s protocol. The amplified cDNA were resolved in a 1.5% ethidium bromide-stained agarose gel and visualized and documented as described earlier for PCR analysis. Inheritance study of transgenes The seeds of primary transgenic (T0) plants carrying singlecopy (# Sw3) and two-copy (# Sw8) of pin2 transgene were germinated in Petri dishes that contained a double layer of filter paper. The T1 generation seedlings were transferred to pots in the transgenic greenhouse. Forty-day-old seedlings were screened for their GUS activity and the data was analyzed using a v2 test. Insect bioassays Yellow stem borer (YSB) moths were collected from the field and released on TN1, a susceptible rice cultivar, plants in the greenhouse for egg laying. Besides, egg masses laid on plants in the experimental fields were also collected and placed in 1.5 cm glass tubes and the open end was plugged with cotton. The tubes were incubated at room temperature for one week. Freshly hatched first instar larvae were used for infestation within 3 h of hatching for cut-stem or whole plant bioassays. Twenty-five-day-old homozygous transgenic and WT plants were divided into two sub-sets and potted separately. One such sub-set was tested for larval growth and mortality at vegetative stage (40–50 days) and the
123
Plant Cell Tiss Organ Cult
other for infestation at reproductive stage (booting stage), for presence of white-heads (fully formed panicles without any filled grains, a typical symptom of YSB damage). For whole plant bioassay (vegetative and reproductive stage), each plant was infested with 20–25 larvae (*2 larvae for tiller) and covered with mylar cages. After 15 days of infestation, the percentage dead hearts, mortality rate and growth of surviving larvae was recorded. For the reproductive stage assays, results were examined 21 days after infestation for % white heads. Insect bioassay was also done with T2 homozygous plants in Petri dishes using a cut-stem method. Three cut stems (*8 cm long) from each transgenic plant vis-a`-vis WT plant were collected at pre-booting stage and placed in moistened filter disc in a 90 mm Petri dish. Six neonate first instar larvae of YSB were left in each dish to feed on
Table 1 Development of transgenic indica rice cv. Swarna through Agrobacterium tumefaciens-mediated transformation Calli HygR and cocultivated GUS? calli
Plants Southern regenerated positive plants
115
10
a
4
9 (2a)
Independent lines confirmed by Southern blot analysis
Fertile plants 9
the cut stems. Petri dishes were incubated at 28°C in the dark for 4 days and then the mortality of larvae was recorded under a simple dissecting microscope by cutopening of the stem.
Results Development of transgenic rice plants Highly embryogenic calluses were isolated from the scutellum derived calluses of Swarna. A total of 115 calluses were transferred to the CIS medium after the co-cultivation with A. tumefaciens LBA4404 (pSB1, pRAO1) (Table 1). Four calluses survived the initial selection under 30 mg l-1 hygromycin. Nine putative transformants (# Sw1–Sw9) were obtained from two independently selected hygromycin-resistant calluses whereas the rest two calluses were escapes and died in the subsequent selection cycles. GUS histochemical assay of stem and roots of the nine T0 plants revealed that all plants were positive for the presence of gusA gene (Fig. 2). All the transgenic plants were fully fertile and were similar to the non-transformed WT plants for all the morphological and agronomic traits (data not shown).
Fig. 2 Representative picture showing blue stain indicative of gus A gene expression in the leaf (a) and root (b) tissues of transgenic rice cv ‘Swarna’. (Color figure online)
123
Plant Cell Tiss Organ Cult
Fig. 3 PCR gel pictures showing amplification products of 1.2-, 0.95-, and 0.53-kb confirming the integration of gusA (a), hpt (b), and pin2 (c) gene, respectively in the transgenic rice lines (Sw1–Sw9); no amplification was observed in non-transformed (NT). PC = plasmid positive control
Molecular analyses The polymerase chain reaction using gusA, hpt, and pin2 gene specific primers showed expected amplification products of 1.2-, 0.95-, and 0.53-kb size, respectively in the T0 transgenics, while no amplification product was observed in the WT plants (Fig. 3a,b,c), thus confirming the integration of T-DNA carrying all the three genes in the T0 transgenics.
Southern analysis of the genomic DNA was performed to determine the copy number of the integrated T-DNA. Genomic DNA was digested with PstI and SacI to generate one internal fragment of pin2 coding sequence and junction fragments of T-DNA and genomic (Rice) DNA region. Two probes, namely a 0.63-kb pin2 coding sequence and 1.1-kb hpt coding sequences were used to determine internal T-DNA fragment and left border junction fragment, respectively. All nine T0 lines showed the presence of the 0.63-kb expected internal T-DNA pin2 fragment (Fig. 4a). The hpt probe is expected to hybridize to a left-border junction fragment having a SacI site in the T-DNA and ending at either a SacI or PstI site in the genomic region of rice. With hpt probe, lines Sw3, Sw4, Sw6, and Sw9 showed singlecopy integration, while lines Sw1, Sw2, Sw5, Sw7, and Sw8 carried two T-DNA copies (Fig. 4b). The mRNA abundance of the transgene was evident from the reverse transcription with successful amplification of cDNA fragment (0.53-kb) corresponding to the pin2 gene in transgenic rice lines, which was absent in the nontransformed control plants (Fig. 5). Inheritance of transgenes The histochemical analysis of the T1 generation plants (at seedling stage) showed two kinds of segregation pattern for the gusA gene (Table 2). Of the two lines tested, Sw3 showed a single-gene mendelian segregation ratio of 3:1 (GUS?:GUS-), while in the progeny of Sw8 the segregation was 15:1 (GUS?:GUS-) suggesting the presence of two copies of gusA genes at two unlinked loci. Thirty-two T2 plants of Sw3 and Sw8 were germinated and GUS staining of all the seedlings confirmed the homozygous status of the two transgenic lines.
Fig. 4 A representative Southern picture showing single copy integration of pin2 gene (a) in Sw3, Sw4, Sw7, and Sw8 transgenic lines, and while Sw3 and Sw4 show single copy integration, Sw7 and Sw8 had two copies of hpt gene (b). Genomic DNA was digested with PstI and SacI and hybridized with 0.63-kb (a) and 1.1-kb (b) probes corresponding to pin2 and hpt genes, respectively. NT = nontransformed control
123
Plant Cell Tiss Organ Cult
Resistance of transgenics against yellow stem borer
Table 3 Bioassay of Swarna homozygous transgenic lines against yellow stem borer at the vegetative stage
The T2 homozygous progenies of Swarna transgenics (Sw3, Sw8) were selected for assaying their resistance
T0 progeny Plants tested Total tillers infected Mean % dead heart Swarna 3
Fig. 5 Ethidium bromide-stained gel picture showing the amplification of a 0.53-kb cDNA fragment corresponding to the expression of pin2 gene in Sw3, Sw4, Sw7, and Sw8 transgenic rice plants but not in the non-transformed (NT) control. M = 1-kb plus DNA ladder (Invitrogen BioServices India Pvt Ltd, Bangalore, India) Table 2 Segregation of gusA gene in transgenics of Swarna in T1 generation T0 plant number
v2 valuea
Seedlings ?
GUS
P
-
Total
GUS
Swarna 3
50
36
14
0.24 (3:1)
[0.5
Swarna 8
50
46
4
0.261 (15:1)
[0.5
a
2
v value is calculated for inheritance of one gene (3:1) or two genes (15:1) Fig. 6 Representative photo showing the dead heart (a) and white heads (b) in nontransformed (NT) rice cv ‘Swarna’ plant whereas a progeny of the transgenic (T) Sw3 plant showed resistance with no dead heart or white head after two weeks of artificial insect feeding
123
30
296 (69a)
23.24 ± 2.32b
Swarna 8
30
270 (50)
18.41 ± 1.38
WT
30
272 (164)
60.51 ± 2.17
a
No. of tillers showed symptoms
b
Standard error of means
reaction against YSB through whole plant bioassay at both vegetative (maximum tillering stage) and reproductive stages. At vegetative stage, in general, Swarna transgenics showed enhanced levels of resistance to YSB when compared to the WT plants (Table 3; Fig. 6). The progenies derived from Sw3 (23.3%) and Sw8 (18.4%) had less number of damaged tillers (dead hearts) whereas the WT plants had 60.30% tiller damage. In the whole plant assays at reproductive stage, the plants that had shown susceptibility at the vegetative stage, showed less damage in terms of the number of white heads, but number of panicle bearing tillers got significantly reduced (Table 4). The transgenic progenies of Sw3 (2.2%) had white heads much lesser than WT Swarna plants (10%), and Sw8 progenies showed complete resistance with no white head (Table 4). Similarly, the larvae fed on progeny lines showed mortality rate of 74% (Sw3) and 85% (Sw8) when compared to WT (0%). Furthermore, the whole plant and cut-stem bioassay results showed that the larvae fed on transgenics stopped growing after 3 days and died eventually whereas the larvae feeding on WT tissues grew normal and healthy (Fig. 7).
Plant Cell Tiss Organ Cult Table 4 Bioassay of Swarna homozygous transgenic lines against yellow stem borer at reproductive stage T0 progeny
Plants tested
Total tillers bearing panicles
Total tillers bearing panicles infected
Swarna 3
30
132
129 (3a) 126 (0)
Swarna 8
30
126
WT
30
120
a
No. of white heads bearing panicles
b
Standard error of means
60 (10)
Mean % white head 2.17 ± 1.21b 0.00 ± 0.0 10.00 ± 5.11
Fig. 7 Yellow stem borer larva (e) showing reduced growth and mortality after feeding on transgenic rice leaf tissue (a, b, c) as compared to healthy, normal larvae (d) feeding on the non-transformed control rice leaf tissue
Discussion Swarna is the most widely grown and popular rice cultivar of South and Southeast Asia. This premium variety of India, Bangladesh, and Myanmar was recently introgressed with Sub1 gene for submergence tolerance (Xu et al. 2006). Previously, transgenic Swarna has been developed with chitinase gene, which confers tolerance against sheath blight fungus (Baisakh et al. 2001). We successfully introduced a protease inhibitor gene (pin2) into Swarna through Agrobacterium-mediated transformation to develop YSB-resistant transgenics. The lower transformation efficiency in Swarna, as found in the present study, has been explained to its higher sensitivity to hygromycin selection, although Swarna has shown to be highly responsive to somatic cell culture (Baisakh et al. 2001). Studies are underway to increase the transformation efficiency of Swarna through the manipulation of factors that activate the vir genes such as acetosyringone, monosaccharides and factors that enhance the susceptibility of cells of Swarna against Agrobacterium. The transgenics showed stable integration of all the three genes within the T-DNA region. More than single
copy integration of hpt genes as revealed in the present study was also observed in Agrobacterium- mediated rice transgenics (Datta et al. 2000), which was explained by the integration of a short, truncated T-DNA following integration of a full length T-DNA into the rice genome. The transgenic also showed stable expression of pin2 gene at the mRNA level. The whole plant bioassay results revealed variable levels of protection to YSB in the tested transgenics of Swarna at both vegetative and reproductive stages, which conformed to earlier published reports (Datta et al. 1998; Baisakh 2000) where the authors demonstrated varied protection of transgenic rice progenies carrying cry 1Ab/1Ac genes. Further, the damage levels (*21% dead hearts) at vegetative stage were very low in all the transgenic progenies in comparison to control plants (*60%) (Table 3), which indicated the transgenics produced the chymotrypsin inhibitor protein at level sufficient for providing enhanced levels of protection against YSB. Most of the progeny lines that had shown enhanced levels of resistance at vegetative stage also displayed enhanced resistance at the flowering stage. However, a few transgenic plants did produce white ear heads. Such appearance of white heads in transgenic
123
Plant Cell Tiss Organ Cult
rice expressing pin2 gene (Duan et al. 1996) as well as Bt (Khanna and Raina 1999) was also recorded earlier. This indicated that the larvae managed to inflict the damage with initial feeding before they have consumed enough proteinase inhibitor to make them ineffective/mortal. This could be either due to the access of the larvae to the developing panicles through the gaps in the leaf sheaths enclosing the panicles or due to the decline in the level of proteinase inhibitor expression at the flowering stage in the developing panicles, which has also been reported in maize (Mellon and Rissler 1998). Toxic effects of chymotrypsin inhibitor enzyme on the growth and development of neonate larvae was quite obvious. The few recovered larvae (from whole plant and cut stem assays) were generally dead, showing varying degrees of degeneration. Further, the surviving larvae were less than half the size of those fed on WT plants (Fig. 7). Interestingly, the number of unrecovered larvae was very high, even for WT plants despite the mylar cages tucked right into the soil of the pots to prevent escapes, and the number of such larvae was comparatively higher in the case of transgenics (data not shown). Neonate larvae were reported to disperse from the plants on which they hatch, even on normal susceptible plants (Cluster et al. 1996). In whole plant assays, they have been found to climb over the mylar cages and also disperse through the nylon-mesh windows of such cages (Ghareyazie et al. 1997). Dirie (1998) observed that such dispersal behavior was particularly more severe in the case of neonates of Scirophaga incertulas than in those of Chilo suppressalis. However, comparatively higher number of unrecovered larvae in transgenic plants was most likely due to the early mortality followed by decomposition. As is evident from Fig. 7, some larvae seem to die very early and undergo rapid degeneration. Larvae may be additionally stimulated to disperse from transgenic plants after having ingested some transgenic tissue and beginning to suffer the toxic effects (Ghareyazie et al. 1997). Our findings are in agreement with the earlier reports where enhanced levels of resistance to stem borer was achieved through the expression of protease inhibitor genes in transgenic rice (Duan et al. 1996; Irie et al. 1996). This study further established the utility of proteinase inhibitor genes for the control of yellow stem borer in rice. In future, the transgenic insect resistant rice could be used to develop gene pyramids with other genes chi11, Sub 1 and Xa21 for multiple resistances against biotic as well as abiotic stresses. Acknowledgments We thank Dr Richard A. Jefferson, CAMBIA, Australia for providing pCAMBIA1301 and Dr. K. Veluthambi, Madurai Kamaraj University, India for Agrobacterium strains. We thank Prof. Clarence A. Ryan, Washington State University, USA for gifting us the pin2 gene. MVR, KSB, and GJNR are thankful to the Director, CRRI and Head, Division of Crop Improvement, CRRI for the laboratory and field facilities used in the research. This work was
123
supported by the Rockefeller foundation and IRRI in the form of a grant (ICAR/IRRI/CRRI collaborative project grant) and a senior research fellowship to MVR.
References Baisakh N (2000) Improvement of rainfed lowland indica rice through in vitro culture and genetic engineering. Thesis submitted to Utkal University, Orissa, India Baisakh N, Datta SK (2007) Stem borer resistance: Bt rice. In: Datta SK (ed) Rice in genomics era. Taylor & Francis publishers, London, pp 139–177 Baisakh N, Datta K, Oliva N, Ona I, Rao GJN, Mew TW, Datta SK (2001) Rapid development of homozygous transgenic rice using anther culture harboring rice chitinase gene for enhanced sheath blight resistance. Plant Biotechnol 18:101–108 Bu QY, Wu L, Yang SH, Wan JM (2006) Cloning of a potato proteinase inhibitor gene PINII-2x from diploid potato (Solanum phurejia L.) and transgenic investigation of its potential to confer insect resistance in rice. J Integr Plant Biol 48:732–739 Cluster PD, Odell M, Metzlaff M, Flavell RB (1996) Details of TDNA structural organization from a transgenic petunia population exhibiting co-suppression. Plant Mol Biol 32:1197–1203 Comai L, Moran P, Maslyar D (1990) Novel and useful properties of a chimeric plant promoter combining CaMV 35S and MAS elements. Plant Mol Biol 15:373–381 Datta K, Vasquez A, Tu J, Torrizo L, Alam MF, Oliva N, Abrigo E, Khush GS, Datta SK (1998) Constitutive and tissue-specific differential expression of the cry1Ab gene in transgenic rice plants conferring resistance to rice insect pest. Theor Appl Genet 97:20–30 Datta K, Koukolikova-Nicola Z, Baisakh N, Oliva N, Datta SK (2000) Agrobacterium-mediated engineering for sheath blight resistance of indica rice cultivars from different ecosystems. Theor Appl Genet 100:832–839 Dirie A (1998) Dispersal behavior of stem borers relative to the design of resistance management strategies for transgenic Bt rice. PhD Dissertation, University of Philippines, Los Banos Ditta G, Stanfield S, Corbin D, Helinski DR (1980) Broad host range DNA cloning system for gram-negative bacteria: construction of gene bank of Rhizobium meliloti. Proc Natl Acad Sci USA 77:7347–7351 Duan X, Li X, Xue Q, Abo-ei-saad M, Xu D, Wu R (1996) Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant. Nature Biotechnol 14:494– 498 Ghareyazie B, Alinia F, Menguito CA, Rubia LG, de Palma JM, Lapwing EA (1997) Enhanced resistance to two stem borers in an aromatic rice containing a synthetic cry1a(b)gene. Mol Breed 3:401–405 Huang J, Wei QZM, Long H, Yu A, Zhu X (2001) Agrobacterium tumefaciens-mediated transformation of rice with the spider insecticidal gene conferring resistance to leaf folder and striped stem borer. Cell Res 11:149–155 Irie K, Hosoyama H, Takeuchi T, Iwabuchi, Watanabe H, Abe M, Abe K, Arai S (1996) Transgenic rice established to express corn cystatin exhibits strong inhibitory activity against insect gut proteinases. Plant Mol Biol 30:149–157 Khanna HK, Raina SK (1999) Agrobacterium-mediated transformation of indica rice cultivars using binary and super binary vectors. Aust J Plant Physiol 26:311–324 Khanna HK, Raina SK (2002) Elite indica transgenic rice plants expressing modified Cry 1Ac endotoxin of Bacillus thuringiensis show enhanced resistance to yellow stem borer (Scirpophaga incertulas). Transgenic Res 11:411–423
Plant Cell Tiss Organ Cult Komari T, Hiei Y, Murai N, Kumashiro T (1996) Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J 10:165–174 Lee SI, Lee SH, Koo JC, Chun HJ, Lim CO, Mun JH, Song YH, Cho MJ (1999) Soybean kunitz trypsin inhibitor (SKTI) confers resistance to the brown planthopper (Nilaparvata lugens Stal) in transgenic rice. Mol Breed 5:1–9 Mellon M, Rissler J (1998) Now or never: serious new plants to save a natural pest control. MA: Union of Concerned Scientists, Cambridge Mishra B (2000) High yielding rice varieties of India–2000, Directorate of rice research (DRR) Bulletin 2001, Mishra B (ed), pp. 1 Mochizuki A, Nishizawa Y, Onodera H, Tabei U, Toki S, Habu Y, Ogaki M, Ohasi Y (1999) Transgenic rice plants expressing a trypsin inhibitor are resistant against rice stem borers, Chilo suppressalis. Entomol Exp Appl 93:173–178 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 Murray MG, Thompson WF (1980) Rapid isolation of higher molecular weight plant DNA. Nucl Acids Res 8:4321–4325 Nagadhara D, Ramesh S, Pasalu IC, Rao KY, Krishnaiah NV, Sarma NP, Brown DP, Gatehouse JA, Reddy VD, Rao KV (2003) Transgenic indica rice resistant to snap-sucking insects. Plant Biotechnol J 1:231–240 Rao VR, Reddy PS, Murthy N, Rao I, Rao PS, Rao CB, Rao GM (1983) Swarna (MTU 7029)–a new stable hybrid with wide adaptation. Oryza 20:240–242
Rueb S, Hensgens LAM (1997) Improved histochemical staining for b-D-glucuronidase activity in monocotyledonous plants. Rice Genet Newslett 6:168 Tu J, Datta K, Alam MF, Fan Y, Khush GS, Datta SK (1998) Expression and function of a hybrid Bt toxin gene in transgenic rice conferring resistance to insect pest. Plant Biotechnol 15:195–203 Vain P, Worland B, Clarke MC, Richard G, Beavis M, Liu H, Kohli A, Leech M, Snape J, Christou P (1998) Expression of an engineered cysteine proteinase inhibitor (Oryzacystatin-Idelta D86) for nematode resistance in transgenic rice plants. Theor Appl Genet 96:266–271 Vijayachandra K, Palanichelvam K, Veluthambi K (1995) Rice scutellum induces Agrobacterium tumefaciens vir genes and Tstrand generation. Plant Mol Biol 29:125–133 Vila L, Quilis J, Meynard D, Breitler JC, Marfa V, Murillo I, Vassal JM, Messeguer J, Guiderdoni E, Segundo BS (2005) Expression of the maize proteinase inhibitor (mpi) gene in rice plants enhances resistance against the striped stem borer (Chilo suppressalis): effects on larval growth and insect gut proteinases. Plant Biotechnol J 3:187–202 Xu DP, Xue DQZ, McElory Y, Hilder VAM, Wu R (1996) Constitutive expression of a cowpea trypsin inhibitor gene, CpTI, in transgenic rice plants confers resistances to 2 major rice insect pests. Mol Breed 2:67–173 Xu K, Xia X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AI, Bailey-Serres J, Ronald PC, Mackill DJ (2006) Sub1A is an ethylene response factor like gene that confers submergence tolerance to rice. Nature 442:705–708
123
