Autocrine VEGF-A/KDR loop protects epithelial ovarian carcinoma cells from anoikis

Int. J. Cancer: 124, 553–561 (2009) ' 2008 Wiley-Liss, Inc.

Autocrine VEGF-A/KDR loop protects epithelial ovarian carcinoma cells from anoikis Ifat Sher, Sirin A. Adham, James Petrik and Brenda L. Coomber* Department of Biomedical Sciences, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada Epithelial ovarian carcinoma (EOC) patients are usually diagnosed at an advanced stage, characterized by interperitoneal carcinomatosis and production of large volumes of ascites. Vascular endothelial growth factor-A (VEGF-A) and its main signaling receptor VEGFR2 (KDR) are coexpressed in primary ovarian tumors, ascitic cells and metastases, suggesting the existence of an autocrine VEGF-A/KDR loop in EOC cells. In the present study, we examined this possibility and explored the role of this autocrine loop in protecting EOC cells from apoptosis under anchorage free growth conditions (anoikis). We found that 3 different EOC cell lines (Caov3, OVCAR3, SKOV3) express both VEGF-A and its receptors, including KDR. In these cells, KDR is constitutively phosphorylated and is detected both in the cell plasma membrane and in the nucleus. Treating EOC cells with specific internal inhibitors of KDR kinase activity or a VEGF-A neutralizing antibody abolished KDR autophosphorylation and resulted in significant increase in apoptosis when cells were grown in single-cell, anchorage-free conditions. By contrast, these blocking reagents had no effect on cell viability when EOC cells were grown in adhesive monolayers. In summary, our results indicate that an autocrine VEGF-A/KDR loop exists in EOC cells and that it plays a role in protecting the cells from anoikis. Our results imply that treating EOC patients with VEGF blocking agents may potentially reduce peritoneal dissemination by decreasing vascular permeability as well as inducing apoptosis of shed ovarian cancer cells in ascites. ' 2008 Wiley-Liss, Inc. Key words: anoikis; KDR; VEGF; epithelial ovarian cancer

Epithelial ovarian cancer (EOC) is the 2nd most common type of female genital tract malignancy and has the worst prognosis of all gynecological cancers, with low survival rates. Over 70% of EOC patients are diagnosed at an advanced stage, with tumor spread beyond the ovary.1 In these patients, the peritoneal cavity accumulates large amounts of ascites containing tumor cells that exist either as single cells or as multicellular aggregates. These cells are shed from the primary tumor and are considered a nonadhesive subset of tumor cells. Subsequently these shed cells can attach and invade the peritoneal mesothelial wall, forming secondary lesions throughout the peritoneal cavity.2,3 As the extensive intra-abdominal disease is difficult to eradicate completely by surgery, most patients require aggressive chemotherapy and suffer from relapsed cancer, which is ultimately resistant to all currently available salvage therapies.1 Better understanding of the mechanisms involved in the survival and implantation of the malignant ascites cells is crucial for improved treatment of this disease. EOC cells secrete extensive amounts of the vascular endothelial growth factor (VEGF) family members.4–7 This family consists of VEGFA, B, C, D and placenta growth factor that bind in overlapping affinities to 3 receptor tyrosine kinases (RTKs), designated VEGF receptor-1 (VEGFR1 or flt-1), VEGFR2 (KDR) and VEGFR3. In addition, VEGFs bind coreceptors that lack catalytic activity such as neuropilin-1 and neuropilin-2, as well as heparan sulfate proteoglycans.8 VEGF and its receptors are key regulators of the cardiovascular system, controlling angiogenesis, blood vessel permeability and lymphangiogenesis.9 In different types of cancer including ovarian cancer, VEGF is over-expressed by the cancer cells, and facilitates tumor growth and metastasis by acting in a paracrine manner on endothelial cells, increasing tumor blood vessel density as well as the formation of lymphatic vessels.10,11 Substantial evidence indicates that VEGF plays a distinct role in ovarian cancer, promoting ascites formation through stimulation Publication of the International Union Against Cancer

of vascular permeability. VEGF (also known as vascular permeability factor) is secreted from tumor cells and increases permeability of blood vessels of the peritoneal lining, resulting in accumulation of malignant ascites.12–15 Significantly higher concentrations of VEGF were detected in ascites from EOC patients compared to benign peritoneal fluids and ascites-derived VEGF levels are inversely correlated with poor prognosis.16,17 Blocking VEGF signaling was shown to completely inhibit ascites formation in several EOC models in mice.18–25 Moreover, recent Phase II clinical trials with a monoclonal antibody directed against human VEGF (Avastin/Bevacizumab, Genentech, San Francisco, CA) either as a single agent (15 mg/kg every 21 days) or combined with standard chemotherapy (10 mg/kg every 14 days; cyclophosphamide 50 mg/day), have demonstrated stabilization of the disease and symptomatic relief of ascites in advanced recurrent ovarian cancer patients.26–28 EOC cells that detach from the solid tumor must survive in ascites in the absence of proper contacts with the extracellular matrix (ECM). In normal and immortalized cells, detachment from the ECM induces a special type of apoptosis, which is referred to as anoikis.29,30 Acquisition of resistance to anoikis is therefore a prerequisite for the ovarian cancer cells to survive in the ascites. Furthermore, the existence of single cells in EOC patient’s ascites suggests that the cells can also survive without cell–cell contacts, which has been shown in several cell types to support cell survival when cells are detached from the ECM.31–33 Ovarian carcinoma cells were found to coexpress both VEGF-A and KDR, raising the possibility of an autocrine activation loop of the receptor in these cancer cells.34,35 We have recently shown that ovarian granulosa cells express KDR, and that KDR provides VEGF-mediated survival pathways in the cells.36 We hypothesized that the coexpression of KDR and VEGF-A by EOC cells could provide a similar autocrine survival function. Specifically, we hypothesized that VEGF-A/KDR autocrine loop may facilitate the ability of EOC cells to grow in the absence of substrate adhesion and intercellular contacts, i.e., under single cell ascitic conditions. Here, we demonstrate the existence of autocrine activation of KDR in 3 different human EOC cell lines, when grown either as adherent monolayers or in anchorage-free conditions. We show that blocking this autocrine loop results in a significant increase in cell apoptosis when cells are detached from ECM but not when they are grown under

Abbreviations: BSA, bovine serum albumin; DMEM, Dulbeco’s modified medium; DMSO, dimethyl sulfoxide; ECM, extracellular matrix; EGFR, epithelial growth factor receptor; ELISA, enzyme-linked immunosorbent assay; EOC, epithelial ovarian cancer; HUVEC, human umbilical vein endothelial cells; KDR Inh I, KDR inhibitor-I; KDR, kinase insert domain receptor; LPA, lysophosphatidic acid; NGS, normal goat serum; PDGFR, platelet derived growth factor receptor; PFA, paraformaldhyde; PI3K, phosphatidylinositol 3-kinase; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor. Grant sponsor: The Canadian Cancer Society, National Cancer Institute of Canada; Grant number: #016117; Grant sponsor: The Ontario Institute for Cancer Research. Ifat Sher and Sirin A. Adham contributed equally to this work. *Correspondence to: Department of Biomedical Sciences, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada N1G 2W1. Fax: 1519-767-1450. E-mail: [email protected] Received 19 March 2008; Accepted after revision 30 July 2008 DOI 10.1002/ijc.23963 Published online 2 September 2008 in Wiley InterScience (www.interscience. wiley.com).

554

SHER ET AL.

adherent conditions, suggesting a role for VEGF-A in protection of EOC cells from anoikis.

PCR products were resolved on agarose gels and sequenced following extraction from the gel.

Material and methods Cell cultures Epithelial ovarian cancer cells Caov3, NIH:OVCAR3 and SKOV3, and the colorectal carcinoma cell line DLD-1, were purchased from the ATCC, Manassas, VA. Cells were grown in DMEM (Sigma-Aldrich, Oakville, ON, Canada) supplemented with 10% heat-inactivated fetal bovine serum, 50 lg/ml gentamicin and 1 mmol/l sodium pyruvate, at 37!C in a humidified atmosphere containing 5% CO2. Cells were grown as adhesive monolayers, in 3-dimensional suspension as spheroids or in single cell suspension (see later).

Induction of anoikis in the presence of KDR inhibitors One hundred millimeter dishes were coated with a film of polyhydroxyethylmethacrylate polymer (poly-HEMA) following a protocol reported by Valentinis et al.31 Briefly, poly-HEMA (Sigma-Aldrich) was solubilized in 95% ethanol (60 mg/ml) and diluted in 95% ethanol to a final concentration of 12 mg/ml. Five milliliters of poly-HEMA solution were placed in 100 mm dishes and dried in a tissue culture hood. Before use, poly-HEMA coated dishes were washed twice with PBS (Sigma-Aldrich) and once with DMEM. Anoikis was induced by culturing 3 3 104 cells on poly-HEMA coated 100 mm dishes in 5 ml DMEM containing the appropriate treatment. These single-cell suspension cultures were maintained in a humidified 5% CO2 incubator at 37!C. After 24 hr, culture plates were examined under the microscope to make sure that the cells did not adhere to the substratum or form aggregates during the incubation period. Cells were collected, centrifuged and spread on a slide using a cytospin (Shandon Cytospin 3, Thermo Fisher Scientific, Mississauga, CA) for subsequent immunostaining or TUNEL reaction. VEGF-A/KDR blocking reagents used in this study: KDR Inhibitor-I (VEGFR2 kinase inhibitor I(Z)-3-[(2,4-dimethyl-3-(ethoxycarbonyl)pyrrol-5-yl)methylidenyl]indolin-2-1; Calbiochem, VWR Canlab, Mississaga, ON, Canada) was diluted in dimethyl sulfoxide (DMSO) and added in a final concentration of 0.1 lM. ZM323881 hydrochloride (5{[7-(benzyloxy) quinazolin-4-yl]amino}-4-fluoro-2-methylphenol, from TOCRIS biosciences, Ellisville, MO) was diluted in DMSO and added in a final concentration of 2 nM. Identical volumes of DMSO were added as control for these inhibitors. Human VEGFA neutralizing antibody and IgG control (R&D Systems) were reconstituted with PBS to a final concentration of 1 mg/ml and added in a final concentration of 10 lg/ml.

ELISA for VEGF-A Fifty-thousand EOC cells were seeded in complete growth medium in 24-well plates. After 24 hr the cells were washed, and the media changed to DMEM plus 1% FBS (0.5 ml/well). The cells were incubated for 48 hr, and the conditioned media was collected, centrifuged and stored at 280!C. VEGF-A levels in conditioned media were determined using the Human VEGF ELISA kit (R&D Systems, Minneapolis, MN) according to manufacturer’s protocol. Protein isolation, immunoprecipitation and western blotting Cells were washed twice with cold phosphate buffer saline (PBS) and lysed with 200 ll of protein lysis buffer: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2 EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM b-glycerophosphate, 1 mM Na3VO4, 1 lg/ml leupeptin 1 mM phenylmethylsulfonyl fluoride, 2 lg/ml aprotinin, vortexed and centrifuged (12,000g at 4!C for 20 min). The supernatant was aliquoted and stored at 280!C. Immunoprecipitation of KDR was performed by incubating 50 ll Protein G dynabeads (Invitrogen, Carlsbad, CA) with a KDR specific antibody (1:50; Cell Signaling Technology, Danvers, MA) and 500 lg of total protein cell lysate. The eluted protein was run on a 7.5% polyacrylamide gel under reducing conditions. Protein was then transferred to PVDF membranes followed by blocking in 5% skim milk protein diluted in 0.1% Tween-20 in tris buffer saline. The membrane was probed first with phospho-KDR rabbit monoclonal antibody (1:1,000; Cell Signaling), followed by secondary antibody POD-conjugated goat anti rabbit (1:5,000; Sigma-Aldrich), developed using BM Chemiluminescence Western Blotting Substrate (POD) (Roche Diagnostics, Laval, QC, Canada) and exposed to highly sensitive ECL X-ray medical film (Konica, Mississauga, ON, Canada) to visualize bands. Blots were then stripped and reprobed for KDR using KDR rabbit monoclonal antibody (1:1,000; Cell Signaling) and goat anti rabbit POD secondary antibody (1:10,000; Sigma-Aldrich) and processed as described earlier. Growth of OVCAR3 cells in 3-dimensional suspension in vitro and in vivo In vitro spheroid cultures were generated by seeding 5 3 106 OVCAR3 cells in agarose-coated 48-well plates; as described in Ref. 37. For generation of ascites in vivo, 4 female immunodeficient RAG-1 null mice38 were injected intraperitoneally with 1 3 107 OVCAR3 cells suspended in 100 ll PBS containing 0.1% bovine serum albumin (BSA). After 12 weeks, the mice were euthanized by CO2 asphyxiation, and ascites were collected from the peritoneal cavity. Cells were collected by gravity sedimentation and lysed for western blotting as described earlier. Sequencing of KDR kinase domain Messenger RNA was obtained from monolayer cultures of the 3 EOC lines and converted by reverse transcriptase into cDNA. KDR kinase domain was amplified using the following primers: Forward 50 AATGGAGGGGAACTGAAGACA30 ; Reverse 50 GAGGTAGGCAGAGAGAGTCCAGA30 .

Indirect immunofluorescence For immunofluorescence studies, cells were either grown on cover-slips or cytospun onto a slide. Cells were fixed in 4% paraformaldehyde (PFA) for 12 min at room temperature and washed with PBS. For KDR detection, slides were washed 3 times with 0.1% Triton-X-100 solution, blocked with 2% BSA (SigmaAldrich) and 4% normal goat serum (NGS; Sigma-Aldrich) for 30 min and incubated overnight at 4!C with an anti-KDR antibody (1:50; Millipore, Billerica, MA). For phospho-KDR detection, slides were blocked with 5% NGS in 0.3% Triton X-100 solution for 1 hr, and incubated overnight at 4!C with an anti-phosphoKDR (Tyrosine 1175) antibody (1:200; Cell Signaling Technology). Slides were incubated for 30 min in a 1:400 dilution of either Alexa Fluor 488 (Invitrogen, Carlsbad, CA) or Cy3-conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) followed by a 2 min nuclear counter-staining with DAPI (40 ,6-diamidino-2-phenylindole), and mounting in DakoCytomation Fluorescent Mounting Medium (Dako, Mississauga, ON, Canada). TUNEL assay Apoptotic cells were detected by TUNEL staining following the manufacturer’s protocol (In situ cell death detection kit, Fluorescein; Roche Diagnostics, Laval, QC, Canada). The percentage of TUNEL-positive nuclei from the total cell nuclei number was calculated following DAPI counter staining, from at least 2 independent experiments in duplicates or triplicates. Between 750 and 1,000 nuclei in random fields of view were counted for each data point. For adherent cultures, 100,000 cells were seeded on coverslips in 24-well dishes. Twenty-four hours later, the cells were washed twice with DMEM and incubated in serum free DMEM for 24 hr. Then, 500 ll DMEM containing the appropriate treatment were added to each well, in triplicates. After 24 hr, the wells were extensively washed with ice cold PBS and cells were fixed

VEGF-A/KDR PROTECTS EOC CELLS FROM ANOIKIS

555

with 4% PFA. The cover slips were removed from the dish and TUNEL staining was performed. Alamarblue assay Cell viability was determined using AlamarBlue Assay (Invitrogen, Carlsbad, CA), following the manufacturer’s protocol. Briefly, 1.5–3 3 104 cells were seeded in 96-well dishes in normal growth medium. Twenty-four hours later, cells were washed twice with DMEM, then 100 ll serum-free DMEM containing the appropriate treatment were added to each well. After 24 hr, AlamarBlue reagent was added to each well in a final concentration of 10%. Several hours later, the absorbance at 570 and 630 nm was determined, and AlamarBlue reduction was calculated based on manufacturer’s instructions. Each experiment was repeated at least twice in quadruplicates. Statistical analysis Statistically significant differences were determined by twotailed unpaired student’s t test or one-way ANOVA and were defined as p < 0.05. All statistical analyses were carried out with GraphPad InStat 3 Software. Results To examine the role of VEGF-A signaling in ovarian cancer, we chose to use the well-characterized human ovarian carcinoma cell lines Caov3, SKOV3 and OVCAR3. RT-PCR analysis demonstrated the mRNA expression of the 2 VEGF-A tyrosine kinase receptors VEGFR1 and KDR as well as the coreceptors neuropilin-1 and neuropilin-2 in all 3 cell lines (data not shown). Ligand production is also occurring; ELISA analysis of conditionedmedia derived from EOC cells revealed that all 3 cell lines expressed and secreted high levels of VEGF-A. Within 48 hr, SKOV3 cells secreted approximately 460 pg/ml/104 cells, whereas Caov3 and OVCAR3 cells secreted 45 and 145 pg/ml VEGF-A per 104 cells, respectively (Fig. 1a). As KDR was shown to mediate VEGF survival pathways in ovarian granulosa cells,36 we focused on this receptor for further analysis. Western blot analysis as well as immunofluorescence studies using a monoclonal antibody directed against KDR, revealed that the receptor is expressed at protein level in all 3 cell lines. KDR was readily detected when cells were grown both in adherent conditions as well as under anchorage-free conditions (Fig. 1 Panels b and c, and Fig. 2a). The coexpression of both KDR and its ligand VEGF-A suggests a possible autocrine activation of KDR in these cells. To examine this possibility we evaluated the phosphorylation status of KDR in EOC cells using a monoclonal antibody that specifically detects KDR proteins only when phosphorylated at tyrosine 1175. The phosphorylation of this tyrosine residue was shown to mediate cell proliferation, migration and survival of endothelial cells [reviewed in Ref. 9]. All experiments were performed under serum-free conditions, so that the only VEGF-A source could have been the EOC cells themselves. Western blot analysis revealed that KDR is constitutively phosphorylated in the 3 cell lines when grown under adherent conditions. There were differences in the phosphorylation levels between the cells, with OVCAR3 showing the highest level of KDR autophosphorylation (Fig. 1b). Phosphorylation of KDR was also detected in cells grown in detachment from the ECM. As shown in Figure 1c, KDR was constitutively phosphorylated in cells grown as 3-dimensional spheroids in vitro and when cells were grown as ascites in mice, demonstrating that this signaling loop is also active in vivo (Fig. 1c). By contrast, colorectal cancer cell line DLD-1 does not express detectable phospho- or native KDR, further supporting the specificity of the antibodies used in this study (Fig. 1c). Next, we examined KDR phosphorylation in intact cells. Immunofluorescence analysis demonstrated that KDR is constitutively phosphorylated in these cells when grown either in adhesion (Fig. 2b) or in detachment from ECM (Fig. 3a). Phosphorylated KDR

FIGURE 1 – EOC cell lines coexpress VEGF-A and its receptor KDR. (a) ELISA analysis of secreted VEGF-A in 48 hr conditionedmedia derived from EOC cells. Values are expressed as pg /ml / 10,000 cells and are the mean 6 SD of values from 3 independent experiments performed in triplicates. (b) Adherent cultures of EOC cells were serum-starved for 24 hr. Cell lysates were prepared and the phosphorylation of KDR as well as the amount of immunoprecipitated receptor were determined as described in the material and methods section. (c) Adherent cultures of DLD-1 human colorectal cancer cells were exposed to serum-free conditions for 24 hr. OVCAR3 cells were grown as multicellular spheroids for 24 hr in serum-free media in agarose coated multiwell plates (suspension in vitro), or collected from ascites fluid generated from intraperitoneally implantation of OVCAR3 cells (suspension in vivo). Cell lysates were prepared and the phosphorylation of KDR as well as the amount of immunoprecipitated receptor were determined.

was detected on the cell membrane, in the cytosol and in the nucleus of the cells. When cells were grown in the absence of substrate adhesion, nuclear staining of phospho-KDR was evident only in viable, nonapoptotic cells that contain nuclei with regular noncondensed and nonfragmented morphology (Fig. 3a). These data demonstrated that KDR is constitutively activated in the 3 EOC cell lines. The constitutive phosphorylation of KDR could have resulted either from an autocrine stimulation of the receptor or from intrinsic activating mutation(s) in the receptor, as was previously demonstrated for other RTKs in different human pathologies.39–41 Specifically, an activating mutation was reported in the kinase domain of KDR in tumor tissues of Juvenile Hemangioma patients.42 To address this possibility, the tyrosine kinase domain of KDR was amplified using RT-PCR. Sequencing of the amplification products revealed that there are no mutations in the receptor in the 3 EOC cell lines (data not shown). Taken together these findings suggest that KDR is constitutively activated in an autocrine manner in the EOC cells lines. To examine the possible role of VEGF-A/KDR autocrine loop in protecting EOC cells from anoikis, sparse cultures of EOC cells

556

SHER ET AL.

FIGURE 2 – (a) KDR protein is expressed in human EOC cell cultures under both adherent and ECM-detached conditions. EOC cells grown in serum free conditions on cover-slips (adherent culture) or on poly-HEMA coated plates (suspension culture) were fixed and stained for KDR expression, using a monoclonal antibody directed against KDR (red). DAPI was used for DNA (nucleus) counterstaining (blue). Scale bar: 100 lm. (b) KDR is constitutively activated in human EOC cells. EOC cells were grown on cover slips in serum free conditions and fixed with 4% PFA. Cells were stained for phosphorylated KDR (p-KDR; green) and nuclei were counterstained with DAPI (blue). Insert: Merged image of negative control of secondary antibody alone and DAPI nuclear counterstaining. Scale bar: 100 lm.

were grown under suspension conditions, in the absence or presence of reagents that specifically block KDR activation. Immunofluorescence and western blot analysis were used to verify KDR inhibition by these reagents. Cells were then analyzed for apoptosis-related DNA degradation, using the TUNEL assay. Two types of VEGF-A/KDR blocking reagents were used in our study—a human VEGF-A neutralizing antibody and cell-permeable chemical inhibitors. The VEGF neutralizing antibody was produced in goats immunized with recombinant human VEGF-A containing 165 amino acid residues (rhVEGF165). This antibody was selected for its ability to specifically neutralize the biological activity of rhVEGF165 and recombinant human VEGF-A containing 121 amino acid residues (rhVEGF121; R&D Systems product information). This antibody has been successfully used to inhibit VEGF-A induced angiogenesis of human umbilical vein endothelial (HUVEC) cells43 as well as the mitogenic activity of VEGF-A in these cells (R&D Systems product information). In the present study, we used the antibody at a concentration of 10 lg/ml, which was shown to completely block the mitogenic activity of 10 ng/ml

FIGURE 3 – (a) EOC cells were grown for 24 hr on poly-HEMA coated plates, in the presence of the following reagents: 10 lg/ml VEGF-A neutralizing antibody (VEGF-Ab); 10 lg/ml control IgG (IgG); 0.1 lM KDR inhibitor-I (KDR InhI) or an equal volume of DMSO. Cells were harvested using a cytospin, fixed with 4% PFA and stained for phospho-KDR (red) or nuclear DNA (DAPI; blue). Merged images of both staining are shown for DMSO-treated cells (DMSO-merged) in upper row. Insert: Merged image of negative control of secondary antibody alone and DAPI nuclear counterstaining. Scale bar: 100 lm. (b) Serum-starved OVCAR3 cells were incubated with ZM323881 inhibitor or an equal volume of DMSO for 24 hr. KDR phosphorylation level was determined as described in the legend to Figure 1 and densitometry analysis was done using Image J software (NIH).

VEGF-A in HUVEC cells (R&D Systems product information). In addition we examined the effect of treating the cells with 2 structurally unrelated inhibitors of KDR: KDR Inh-I and ZM323881. KDR Inh-I is a cell-permeable inhibitor that was shown to potently inhibit tyrosine kinase activity of KDR (IC50 5 0.07 lM). This inhibitor is highly selective with only a weak inhibitory effect (IC50 > 100 lM) on other RTKs such as platelet-derived growth factor receptor (PDGFR), Epithelial growth factor receptor (EGFR), HER-2 and Insulin-like growth factor-1 receptor.44 KDR Inh-I was shown to efficiently inhibit KDR signaling in leukemia cells as well as in TF1 progenitor cells overexpressing KDR.45,46 ZM323881 is an anilinoquinazoline that was shown to efficiently inhibit KDR tyrosine kinase activity in vitro with IC50 < 2 nM. It is highly selective (IC50>50 lM) compared to other RTKs including, VEGFR1, PDGFR, fibroblast growth factor receptor 1, EGFR

VEGF-A/KDR PROTECTS EOC CELLS FROM ANOIKIS

557

FIGURE 5 – Blocking KDR activation does not induce apoptosis in EOC cells when grown in adherent cultures. EOC cells were grown on cover-slips and treated for 24 hr with 0.1 lM KDR inhibitor-I (KDR InhI) or an equal volume of DMSO (DMSO-I), or 10 nM ZM323881 or an equal volume of DMSO (DMSO-II), or 10 lg/ml VEGF-A neutralizing antibody (VEGF Ab) or control IgG (IgG). Following fixation, apoptotic cells were detected by TUNEL staining and the percentage of TUNEL-positive nuclei for each treatment was calculated as described in material and methods. Results are shown as mean 6 SD and were statistically analyzed by a two-tailed student’s t test (n 5 3). FIGURE 4 – KDR activation protects EOC cells from anoikis. (a) Caov3 cells were grown for 24 hr on poly-HEMA coated plates, under serum free conditions, in the absence (a) or presence of DMSO (b) or 10 lg/ml control IgG (c) or 10 lg/ml VEGF-A neutralizing antibody (d) or 0.1 lM KDR inhibitor-I (e) or combination of 10 lg/ml VEGFA neutralizing antibody and 0.1 lM KDR inhibitor-I (f). Following cytocentrifugation and fixation, apoptotic cells were detected by TUNEL staining (green) as described under material and methods and nuclei were counterstained with DAPI (blue). Scale bar: 100 lm. (b) Quantification of TUNEL positive nuclei in cells cultured as described for (a). The percentage of TUNEL-positive nuclei for each treatment was calculated as described in material and methods. Results are shown as mean 6 SD and were statistically analyzed by ANOVA, *p < 0.01, **p < 0.001 vs. appropriate control (n 5 4).

and HER-2.47 ZM323881 was shown to inhibit the mitogenic activity of VEGF in HUVEC cells and efficiently blocked VEGFinduced membrane extension, cell migration and tube formation by human aortic endothelial cells.47,48 In addition this reagent was shown to inhibit KDR-mediated proliferation of neural stem cells.49 As shown in Figure 3, Panel a, addition of either VEGF-A neutralizing antibody or KDR inhibitor I to single cell suspension cultures of the 3 EOC cell lines, nearly abolished phospho-KDR staining. In OVCAR3 cells treated with ZM323881 a 6-fold reduction in KDR phosphorylation was detected (Fig. 3b). These results confirmed the ability of these reagents to efficiently block the VEGF-A/KDR loop in these cells. Next, we examined the effect of this blockade on the survival of EOC cells when grown under anchorage-free conditions. When single-cell suspensions of Caov3 cells were incubated for 24 hr on poly-HEMA coated plates, about 17% of cells stained positive for TUNEL (Fig. 4a). By contrast, in cultures treated with 0.1 lM KDR Inh-I nearly 35% of the nuclei were TUNEL positive (p < 0.001). Similarly, addition of VEGFA neutralizing antibody resulted in about 2-fold increase in apoptosis compared to cultures treated with control IgG. Treating the cells with both VEGF-A/KDR blocking reagents did not result in synergistic or additive effects (Fig. 4). Comparable results were obtained using ZM323881. Thus, addition of 2 nM ZM323881 resulted in a 2-fold increase in the percent of apoptotic cells com-

pared to carrier only. DMSO treated cultures demonstrated an average of 16% 6 1.0% apoptotic cells, compared to 32% 6 4.8% in ZM323881 treated cultures (p < 0.01; N 5 6; data not shown). Treatment of the 2 other EOC cell lines with VEGF-A/KDR blocking reagents resulted in similar increase of apoptosis when cell were grown in single cell suspensions. Thus, treating OVCAR3 cells with VEGF-A/KDR blocking reagents increased the percent of apoptotic cells from 9 to nearly 18%, whereas in SKOV3 cells, the percent of apoptotic cells increased from 7 to nearly 14% (Fig. 4b). In the experiments described earlier, the cells were exposed to 2 different stress-stimuli: growth in detachment from ECM in combination with serum depravation. To differentiate between these 2 stresses, EOC cells were grown as adherent monolayer cultures under serum-free conditions and treated for 24 hr with VEGF-A/ KDR blocking reagents. As shown in Figure 5, TUNEL staining revealed that blocking VEGF-A/KDR loop in all EOC cell lines grown in monolayers did not induce cell apoptosis. In SKOV3 cells approximately 2% of the cells underwent apoptosis both in control cultures and in cultures treated with VEGF-A/KDR blocking reagents. In OVCAR3 and Caov3 cells, the percent of TUNEL positive nuclei varied between 2 and 10% when cells were exposed to the different agents. However, there was no significant difference in percent of apoptosis between cells treated with VEGF-A/KDR blocking reagents and cells exposed to the appropriate control treatments (p > 0.1 for all samples). Similar results were obtained using Alamarblue viability assay. In this assay, an oxidized (blue) form of Alamarblue indicator is added to the cell culture. As only viable cells are able to reduce Alamrblue to its reduced (red) form, quantification of this conversion enables the assessment of cell viability.50–52 Serum-starved EOC cells were grown in monolayers and treated with VEGF-A/ KDR blocking reagents for 24 hr. As shown in Table I, in all EOC cell lines the amount of Alamarblue reduction in the wells of treated cells reached over 90% of that in the untreated cells. Moreover, no significant difference was found in the amount of reduction between cells treated with the different VEGF-A/KDR blocking reagents and cells exposed to the appropriate control agents

558

SHER ET AL. TABLE I – EOC CELL VIABILITY IN MONOLAYER CULTURES AS DETERMINED WITH ALAMARBLUE COLOURIMETRIC ASSAY

DMSO IgG VEGF Ab KDR Inh I Inh 1 Antibody

Caov3

OVCAR3

SKOV3

91.86 6 11.09 96.35 6 7.69 97.48 6 7.45 99.10 6 10.63 99.89 6 1.92

91.63 6 7.10 96.81 6 5.73 102.6 6 5.36 85.27 6 5.68 90.15 6 2.12

89.36 6 7.98 92.52 6 8.18 96.97 6 7.49 90.38 6 5.99 96.32 6 6.50

EOC cells were grown in 96-well dishes and serum-starved for 24 hr in the absence (control) or presence of DMSO or 10 lg/ml control IgG (IgG), 10 lg/ml VEGF-A neutralizing antibody (VEGF Ab), 0.1 lM KDR inhibitor-I (KDR Inh-I) or 10 lg/ml VEGF-A neutralizing antibody and 0.1 lM KDR inhibitor-I (Inh 1 antibody). Alamarblue assay was used to determine cell viability. Results are shown as percent difference in reduction between treated and control, untreated cells (mean 6 SD) and were statistically analyzed by ANOVA, vs. appropriate controls (n 5 8). p value was >0.1 for all samples.

(p > 0.1). These results suggest that blocking VEGF-A/KDR autocrine loop in EOC cells grown in adhesion does not affect cell viability and underscore the distinct role of VEGF-A/KDR loop in protecting EOC cells from anoikis. Discussion EOC patients are often diagnosed at advanced stage, which is characterized by pelvic and abdominal carcinomatosis and massive ascites. To survive in ascites, EOC cells must acquire anoikis resistance. In the present study, we report the existence of a functional autocrine loop of VEGF-A/KDR in ovarian carcinoma cell lines and suggest that this loop is involved in protecting the cells from anoikis. Here we show that both the KDR receptor and its main ligand VEGF-A are highly expressed at the protein level in EOC cells. Importantly, KDR was found to be constitutively phosphorylated in these cells, both when they are grown in adhesion and in anchorage-free conditions in vitro and in vivo. To the best of our knowledge this is the 1st demonstration of phosphorylated KDR in ovarian carcinoma cells. Addition of 2 structurally different KDR inhibitors as well as a VEGF-A neutralizing antibody abolished KDR autophosphorylation. These reagents significantly increased apoptosis when EOC cells were detached from ECM but not when cells were grown under adherent conditions. These findings suggest that a VEGF-A/KDR autocrine loop is involved in protecting EOC cells from anoikis. Similar to our data, VEGF-A was shown to inhibit apoptosis of human microvascular endothelial cells when they are grown in detachment from ECM53 further supporting the role of VEGF-A in conferring anoikis resistance. In several in vivo studies of ovarian cancer, VEGF/KDR blocking agents were shown to significantly inhibit tumor growth, enhance apoptosis in the tumor tissues and suppress ascites formation. This was mostly attributed to the ability of these reagents to inhibit angiogenesis and reduce vascular permeability.18–25 Our study suggests that the ability of these agents to suppress ascites formation may have resulted not only from the inhibition of VEGFinduced endothelial cell responses but also directly from inducing apoptosis of the ovarian cancer cells in ascites. Blocking VEGF-A/KDR signaling in serum-deprived EOC monolayers did not affect cell viability, as determined by Alamarblue and TUNEL assays. These data suggest that the VEGFA/KDR autocrine loop plays a distinct role in promoting EOC cell survival only when cells are detached from the ECM. In accordance to our findings, others have reported that VEGF-A/KDR blocking reagents do not cause growth arrest in EOC cells when cultured under adhesive conditions.21,34,54 However, our western blotting and immunofluorescence analysis demonstrated that KDR is phosphorylated when cells are grown in adherent monolayers, suggesting that KDR activation may have a different function when cells are attached to the ECM. Studies in Caov3 as well as

other EOC cell lines (DOV13, OVCA429 and COC1) indicated that VEGF signaling is involved in cell migration and invasion through the activation of matrix metalloproteinases,55–57 further supporting the notion that VEGF plays multiple roles in EOC pathobiology. VEGF-A ELISA analysis revealed that significant amounts of VEGF-A are secreted by EOC cells. As the VEGF-A neutralizing antibody used in this study acts externally (by neutralizing soluble ligand), the findings that it could abolish KDR autophosphorylation suggest that KDR is stimulated by an external autocrine loop: VEGF secreted by the cells subsequently binds to cell surface KDR, leading to its autophosphorylation and activation. In contrast, the 2 KDR inhibitors used in this study act intracellularly. Our data on treating the cells with either internal inhibitors or the neutralizing antibody equally blocked KDR phosphorylation and resulted in a similar increase in apoptotis of EOC cells, suggest that the external VEGF-A/KDR autocrine loop is essential in promoting cell survival. Our findings that no synergistic or additive effect was produced when both treatments were combined support this conclusion. Because of the nature of the KDR inhibitors employed, we cannot rule out the possibility that other isoforms of VEGF besides VEGF-A (for example, VEGF-C or D)6,7 may also play a role in EOC survival under suspension conditions, as there is evidence that heterodimers of VEGF receptors may signal through VEGF-A independent pathways.9 However, our findings that treating the cells either with the VEGF-A neutralizing antibody or with KDR inhibitors resulted in a nearly equal increase in cell apoptosis suggest that VEGF-A is probably the main ligand that induces KDR-mediated anoikis resistance in these cells. Treating the cells for 24 hr with VEGF-A/KDR blocking reagents resulted in a 2-fold increase in cell apoptosis. Prolonging the treatment time to 48 hr did not further increase the percent of apoptotic cells compared to control (data not shown), suggesting that other survival-promoting pathways may be involved in protecting cells from anoikis. Several studies demonstrated that BclXL, which is over expressed in ovarian cancer, can promote resistance to anoikis in EOC cell lines.58,59 The RAB25 small GTPase and the neurotrophic tyrosine kinase receptor TrkB were also found to be involved in preventing anoikis in EOC cells.60,61 In addition, lysophosphatidic acid (LPA), which exists in large amounts in EOC ascites, was shown to protect SKOV3 cells from anoikis and over-expression of the LPA negative regulator Edg-2 in A2780 ovarian cancer cells increased cell sensitivity to anoikis.62,63 It is noteworthy that LPA induces the expression of several cytokines and growth factors including VEGF.63,64 Furthermore, LPA-induced migration and invasion of DOV13 ovarian cancer cell line in vitro was mediated by KDR activation.55 It remains to be determined whether the ability of LPA to promote anoikis resistance in EOC cell is also mediated by induction of the VEGF-A/KDR loop. Interestingly, a large portion of phosphorylated KDR was nuclear, both when the cells were grown in adhesion and in anchorage-free conditions. A recent study by Blazquez et al.65 demonstrated the accumulation of phosphorylated KDR in the nuclei of different neoplastic cells, and this accumulation increased upon hypoxia treatment and VEGF stimulation. Moreover, studies on hematopoietic stem cells and acute leukemia cells suggest that localization of KDR in the nucleus reflects an active autocrine stimulatory loop in the cells and is involved in maintaining cell survival, further supporting our findings.45,66 In leukemia cells, blocking KDR activation led to inhibition of nuclear factor jB, mitogen activated protein kinase and the PI3K/AKT pathways.45 Accumulating evidence suggest that the PI3K/AKT pathway plays a central role in anoikis resistance in ovarian cancer. Several components of the PI3K/AKT signaling pathway were shown to be either amplified or mutated in EOC tumors and AKT is constitutively active in the 3 cell lines used in the present study, as well as in ovarian cancer patients.67–70 The anoikis resistance conferred by both RAB25 and TrkB was found to be associated with activation of the PI3K/AKT pathway.60,61 Moreover, inhibition of PI3K

559

VEGF-A/KDR PROTECTS EOC CELLS FROM ANOIKIS

in OVCAR3 cells using a specific inhibitor (LY294002) in vivo resulted in complete blockade of ascites formation as well as inhibition of tumor growth by inducing cell apoptosis.71 In adherent HUVEC cells, cell survival is mediated by activation of the PI3K/ AKT pathway, following KDR phosphorylation on residue Tyr1175.72,73 It remains to be elucidated whether the PI3K/AKT pathway also mediates the anoikis resistance conferred by the VEGF-A/KDR loop in EOC cells. RT-PCR analysis suggested that in addition to KDR, VEGFR1, neuropilin-1 and neuropilin-2 are also expressed at least at the message level in these EOC cells (data not shown). Other studies demonstrated protein expression of these receptors in ovarian carcinoma tumor cells35,74,75 but their roles were not determined. VEGFR1 was shown to support growth and survival of human breast carcinoma cells76 and neuropilin-1 was shown to be involved in prevention of apoptosis of breast cancer cells, independently from KDR.77 However, our findings suggest that a nearly equal percent of the cells underwent apoptosis when treated either with the VEGF-A neutralizing antibody or with KDR specific inhibitors suggest that KDR is probably the primary receptor that mediates VEGF-A survival response in these cells. In the present study, we have demonstrated a possible role of an autocrine VEGF-A/KDR loop in protecting EOC cells from anoi-

kis. As EOC spreads as cells that detach from primary tumors to ascites, our results suggest that treatment of ovarian carcinoma with specific VEGF-A/KDR inhibitory agents [e.g., bevacizumab; VEGF Trap78] or reagents that interfere with VEGF expression in EOC cells [e.g., atrasentan79] would have a double effect on suppression of malignants ascites: An indirect effect via reduction of vasculature in the primary tumor and decreasing vascular permeability, as well as a direct effect by eliminating the VEGF-A/KDR mediated survival pathway of the cancer cells in ascites. The combined outcome of such blockade in a clinical setting may be reduction in malignant ascetic dissemination, reduced tumor burden, delayed tumor progression and potentially enhanced patient survival. Acknowledgements The authors thank Mrs. Kanwal Minhas and Ms. Lindsay Quayle for technical assistance, and Dr. Siranoush Shahrzad and Ms. Kristen Lacombe for help in manuscript preparation. This study was supported by grants to B.L.C. from the Canadian Cancer Society/National Cancer Institute of Canada and the Ontario Institute for Cancer Research. I.S. is the recipient of a postdoctoral fellowship award from the Canadian Institutes of Health Research.

References 1. 2. 3.

4.

5. 6.

7.

8. 9. 10. 11. 12.

13. 14.

15.

Cannistra SA. Cancer of the ovary. N Engl J Med 1993;329:1550–9. Perez RP, Godwin AK, Hamilton TC, Ozols RF. Ovarian cancer biology. Semin Oncol 1991;18:186–204. Burleson KM, Casey RC, Skubitz KM, Pambuccian SE, Oegema TR, Jr, Skubitz AP. Ovarian carcinoma ascites spheroids adhere to extracellular matrix components and mesothelial cell monolayers. Gynecol Oncol 2004;93:170–81. Abu-Jawdeh GM, Faix JD, Niloff J, Tognazzi K, Manseau E, Dvorak HF, Brown LF. Strong expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in ovarian borderline and malignant neoplasms. Lab Invest 1996;74: 1105–15. Fujimoto J, Sakaguchi H, Hirose R, Ichigo S, Tamaya T. Biologic implications of the expression of vascular endothelial growth factor subtypes in ovarian carcinoma. Cancer 1998;83:2528–33. Yokoyama Y, Charnock-Jones DS, Licence D, Yanaihara A, Hastings JM, Holland CM, Emoto M, Umemoto M, Sakamoto T, Sato S, Mizunuma H, Smith SK. Vascular endothelial growth factor-D is an independent prognostic factor in epithelial ovarian carcinoma. Br J Cancer 2003;88:237–44. Nishida N, Yano H, Komai K, Nishida T, Kamura T, Kojiro M. Vascular endothelial growth factor C and vascular endothelial growth factor receptor 2 are related closely to the prognosis of patients with ovarian carcinoma. Cancer 2004;101:1364–74. Robinson CJ, Stringer SE. The splice variants of vascular endothelial growth factor (VEGF) and their receptors. J Cell Sci 2001;114:853– 65. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptor signalling—in control of vascular function. Nat Rev Mol Cell Biol 2006;7:359–71. Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endocr Rev 1997;18:4–25. Su JL, Yen CJ, Chen PS, Chuang SE, Hong CC, Kuo IH, Chen HY, Hung MC, Kuo ML. The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer 2007;96:541–5. McClure N, Healy DL, Rogers PA, Sullivan J, Beaton L, Haning RV, Jr, Connolly DT, Robertson DM. Vascular endothelial growth factor as capillary permeability agent in ovarian hyperstimulation syndrome. Lancet 1994;344:235–6. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF. Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science 1983;219:983–5. Nagy JA, Masse EM, Herzberg KT, Meyers MS, Yeo KT, Yeo TK, Sioussat TM, Dvorak HF. Pathogenesis of ascites tumor growth: vascular permeability factor, vascular hyperpermeability, and ascites fluid accumulation. Cancer Res 1995;55:360–8. Nagy JA, Morgan ES, Herzberg KT, Manseau EJ, Dvorak AM, Dvorak HF. Pathogenesis of ascites tumor growth: angiogenesis, vascular remodeling, and stroma formation in the peritoneal lining. Cancer Res 1995;55:376–85.

16. Zebrowski BK, Liu W, Ramirez K, Akagi Y, Mills GB, Ellis LM. Markedly elevated levels of vascular endothelial growth factor in malignant ascites. Ann Surg Oncol 1999;6:373–8. 17. Rudlowski C, Pickart AK, Fuhljahn C, Friepoertner T, Schlehe B, Biesterfeld S, Schroeder W. Prognostic significance of vascular endothelial growth factor expression in ovarian cancer patients: a longterm follow-up. Int J Gynecol Cancer 2006;16 (Suppl 1):183–9. 18. Mesiano S, Ferrara N, Jaffe RB. Role of vascular endothelial growth factor in ovarian cancer: inhibition of ascites formation by immunoneutralization. Am J Pathol 1998;153:1249–56. 19. Xu L, Yoneda J, Herrera C, Wood J, Killion JJ, Fidler IJ. Inhibition of malignant ascites and growth of human ovarian carcinoma by oral administration of a potent inhibitor of the vascular endothelial growth factor receptor tyrosine kinases. Int J Oncol 2000;16:445–54. 20. Yukita A, Asano M, Okamoto T, Mizutani S, Suzuki H. Suppression of ascites formation and re-accumulation associated with human ovarian cancer by an anti-VPF monoclonal antibody in vivo. Anticancer Res 2000;20:155–60. 21. Hasumi Y, Mizukami H, Urabe M, Kohno T, Takeuchi K, Kume A, Momoeda M, Yoshikawa H, Tsuruo T, Shibuya M, Taketani Y, Ozawa K. Soluble FLT-1 expression suppresses carcinomatous ascites in nude mice bearing ovarian cancer. Cancer Res 2002;62:2019–23. 22. Hu L, Hofmann J, Zaloudek C, Ferrara N, Hamilton T, Jaffe RB. Vascular endothelial growth factor immunoneutralization plus paclitaxel markedly reduces tumor burden and ascites in athymic mouse model of ovarian cancer. Am J Pathol 2002;161:1917–24. 23. Byrne AT, Ross L, Holash J, Nakanishi M, Hu L, Hofmann JI, Yancopoulos GD, Jaffe RB. Vascular endothelial growth factor-trap decreases tumor burden, inhibits ascites, and causes dramatic vascular remodeling in an ovarian cancer model. Clin Cancer Res 2003;9: 5721–8. 24. Hu L, Hofmann J, Holash J, Yancopoulos GD, Sood AK, Jaffe RB. Vascular endothelial growth factor trap combined with paclitaxel strikingly inhibits tumor and ascites, prolonging survival in a human ovarian cancer model. Clin Cancer Res 2005;11:6966–71. 25. Pourgholami MH, Yan Cai Z, Lu Y, Wang L, Morris DL. Albendazole: a potent inhibitor of vascular endothelial growth factor and malignant ascites formation in OVCAR-3 tumor-bearing nude mice. Clin Cancer Res 2006;12:1928–35. 26. Burger RA, Sill MW, Monk BJ, Greer BE, Sorosky JL. Phase II trial of bevacizumab in persistent or recurrent epithelial ovarian cancer or primary peritoneal cancer: a gynecologic oncology group study. J Clin Oncol 2007;25:5165–71. 27. Cannistra SA, Matulonis UA, Penson RT, Hambleton J, Dupont J, Mackey H, Douglas J, Burger RA, Armstrong D, Wenham R, McGuire W. Phase II study of bevacizumab in patients with platinumresistant ovarian cancer or peritoneal serous cancer. J Clin Oncol 2007;25:5180–6. 28. Garcia AA, Hirte H, Fleming G, Yang D, Tsao-Wei DD, Roman L, Groshen S, Swenson S, Markland F, Gandara D, Scudder S, Morgan R.

560

29. 30. 31. 32. 33. 34.

35. 36.

37.

38. 39. 40.

41.

42.

43. 44.

45. 46.

47.

48.

49. 50. 51.

SHER ET AL.

Phase II clinical trial of bevacizumab and low-dose metronomic oral cyclophosphamide in recurrent ovarian cancer: a trial of the California, Chicago and Princess Margaret Hospital phase II consortia. J Clin Oncol 2008;26:76–82. Frisch SM, Ruoslahti E. Integrins and anoikis. Curr Opin Cell Biol 1997;9:701–6. Meredith JE, Jr, Schwartz MA. Integrins, adhesion and apoptosis. Trends Cell Biol 1997;7:146–50. Valentinis B, Morrione A, Peruzzi F, Prisco M, Reiss K, Baserga R. Anti-apoptotic signaling of the IGF-I receptor in fibroblasts following loss of matrix adhesion. Oncogene 1999;18:1827–36. Bates RC, Buret A, van Helden DF, Horton MA, Burns GF. Apoptosis induced by inhibition of intercellular contact. J Cell Biol 1994; 125:403–15. McGill G, Shimamura A, Bates RC, Savage RE, Fisher DE. Loss of matrix adhesion triggers rapid transformation-selective apoptosis in fibroblasts. J Cell Biol 1997;138:901–11. Boocock CA, Charnock-Jones DS, Sharkey AM, McLaren J, Barker PJ, Wright KA, Twentyman PR, Smith SK. Expression of vascular endothelial growth factor and its receptors flt and KDR in ovarian carcinoma. J Natl Cancer Inst 1995;87:506–16. Inan S, Vatansever S, Celik-Ozenci C, Sanci M, Dicle N, Demir R. Immunolocalizations of VEGF, its receptors flt-1, KDR and TGF-b’s in epithelial ovarian tumors. Histol Histopathol 2006;21:1055–64. Greenaway J, Connor K, Pedersen HG, Coomber BL, LaMarre J, Petrik J. Vascular endothelial growth factor and its receptor. Flk-1/KDR, are cytoprotective in the extravascular compartment of the ovarian follicle. Endocrinology 2004;145:2896–905. St Croix B, Sheehan C, Rak JW, Flørenes VA, Slingerland JM, Kerbel RS. E-cadherin-dependent growth suppression is mediated by the cyclin-dependent kinase inhibitor p27(KIP1). J Cell Biol 1998;142: 557–71. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 1992;68:869–77. Tsujimura T, Kanakura Y, Kitamura Y. Mechanisms of constitutive activation of c-kit receptor tyrosine kinase. Leukemia 1997;11:396–8. Yamamoto Y, Kiyoi H, Nakano Y, Suzuki R, Kodera Y, Miyawaki S, Asou N, Kuriyama K, Yagasaki F, Shimazaki C, Akiyama H, Saito K, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood 2001;97:2434–9. Meshinchi S, Stirewalt DL, Alonzo TA, Zhang Q, Sweetser DA, Woods WG, Bernstein ID, Arceci RJ, Radich JP. Activating mutations of RTK/ras signal transduction pathway in pediatric acute myeloid leukemia. Blood 2003;102:1474–9. Walter JW, North PE, Waner M, Mizeracki A, Blei F, Walker JW, Reinisch JF, Marchuk DA. Somatic mutation of vascular endothelial growth factor receptors in juvenile hemangioma. Genes Chromosomes Cancer 2002;33:295–303. Burns PA, Wilson DJ. Angiogenesis mediated by metabolites is dependent on vascular endothelial growth factor (VEGF). Angiogenesis 2003;6:73–7. Sun L, Tran N, Tang F, App H, Hirth P, McMahon G, Tang C. Synthesis and biological evaluations of 3-substituted indolin-2-ones: a novel class of tyrosine kinase inhibitors that exhibit selectivity toward particular receptor tyrosine kinases. J Med Chem 1998;41:2588–603. Santos SC, Dias S. Internal and external autocrine VEGF/KDR loops regulate survival of subsets of acute leukemia through distinct signaling pathways. Blood 2004;103:3883–9. Coppola S, Narciso L, Feccia T, Bonci D, Calabro` L, Morsilli O, Gabbianelli M, De Maria R, Testa U, Peschle C. Enforced expression of KDR receptor promotes proliferation, survival and megakaryocytic differentiation of TF1 progenitor cell line. Cell Death Differ 2006; 13:61–74. Whittles CE, Pocock TM, Wedge SR, Kendrew J, Hennequin LF, Harper SJ, Bates DO. ZM323881, a novel inhibitor of vascular endothelial growth factor-receptor-2 tyrosine kinase activity. Microcirculation 2002;9:513–22. Endo A, Fukuhara S, Masuda M, Ohmori T, Mochizuki N. Selective inhibition of vascular endothelial growth factor receptor-2 (VEGFR2) identifies a central role for VEGFR-2 in human aortic endothelial cell responses to VEGF. J Recept Signal Transduct Res 2003;23:239– 54. Xiao Z, Kong Y, Yang S, Li M, Wen J, Li L. Upregulation of Flk-1 by bFGF via the ERK pathway is essential for VEGF-mediated promotion of neural stem cell proliferation. Cell Res 2007;17:73–9. Nakayama GR, Caton MC, Nova MP, Parandoosh Z. Assessment of the alamar blue assay for cellular growth and viability in vitro. J Immunol Methods 1997;204:205–8. Voytik-Harbin SL, Brightman AO, Waisner B, Lamar CH, Badylak SF. Application and evaluation of the alamarblue assay for cell growth and survival of fibroblasts. In Vitro Cell Dev Biol Anim 1998;34:239–46.

52. Gloeckner H, Jonuleit T, Lemke HD. Monitoring of cell viability and cell growth in a hollow-fiber bioreactor by use of the dye alamar blue. J Immunol Methods 2001;252:131–8. 53. Solovey A, Gui L, Ramakrishnan S, Steinberg MH, Hebbel RP. Sickle cell anemia as a possible state of enhanced anti-apoptotic tone: survival effect of vascular endothelial growth factor on circulating and unanchored endothelial cells. Blood 1999;93:3824–30. 54. Wu Y, Li ZY, Zhao X, Kan B, Wei YQ. Inhibition of ovarian tumor growth by gene therapy with recombinant soluble vascular endothelial growth factor receptor 2. Hum Gene Ther 2006;17:941–8. 55. So J, Wang FQ, Navari J, Schreher J, Fishman DA. LPA-induced epithelial ovarian cancer (EOC) in vitro invasion and migration are mediated by VEGF receptor-2 (VEGF-R2). Gynecol Oncol 2005;97: 870–8. 56. Wang FQ, So J, Reierstad S, Fishman DA. Vascular endothelial growth factor-regulated ovarian cancer invasion and migration involves expression and activation of matrix metalloproteinases. Int J Cancer 2006;118:879–88. 57. Zhang A, Meng L, Wang Q, Xi L, Chen G, Wang S, Zhou J, Lu Y, Ma D. Enhanced in vitro invasiveness of ovarian cancer cells through up-regulation of VEGF and induction of MMP-2. Oncol Rep 2006; 15:831–6. 58. Frankel A, Rosen K, Filmus J, Kerbel RS. Induction of anoikis and suppression of human ovarian tumor growth in vivo by down-regulation of Bcl-X(L). Cancer Res 2001;61:4837–41. 59. Dodier P, Pich!e A. Bcl-X(L) is functionally non-equivalent for the regulation of growth and survival in human ovarian cancer cells. Gynecol Oncol 2006;100:254–63. 60. Cheng KW, Lahad JP, Kuo WL, Lapuk A, Yamada K, Auersperg N, Liu J, Smith-McCune K, Lu KH, Fishman D, Gray JW, Mills GB. The RAB25 small GTPase determines aggressiveness of ovarian and breast cancers. Nat Med 2004;10:1251–6. 61. Yu X, Liu L, Cai B, He Y, Wan X. Suppression of anoikis by the neurotrophic receptor TrkB in human ovarian cancer. Cancer Sci 2008; 99:543–52. 62. Furui T, LaPushin R, Mao M, Khan H, Watt SR, Watt MA, Lu Y, Fang X, Tsutsui S, Siddik ZH, Bast RC, Mills GB. Overexpression of edg-2/vzg-1 induces apoptosis and anoikis in ovarian cancer cells in a lysophosphatidic acid-independent manner. Clin Cancer Res 1999;5: 4308–18. 63. Fang X, Gaudette D, Furui T, Mao M, Estrella V, Eder A, Pustilnik T, Sasagawa T, Lapushin R, Yu S, Jaffe RB, Wiener JR, et al. Lysophospholipid growth factors in the initiation, progression, metastases, and management of ovarian cancer. Ann NY Acad Sci 2000;905:188–208. 64. Hu YL, Tee MK, Goetzl EJ, Auersperg N, Mills GB, Ferrara N, Jaffe RB. Lysophosphatidic acid induction of vascular endothelial growth factor expression in human ovarian cancer cells. J Natl Cancer Inst 2001;93:762–8. 65. Blazquez C, Cook N, Micklem K, Harris AL, Gatter KC, Pezzella F. Phosphorylated KDR can be located in the nucleus of neoplastic cells. Cell Res 2006;16:93–8. 66. Gerber HP, Malik AK, Solar GP, Sherman D, Liang XH, Meng G, Hong K, Marsters JC, Ferrara N. VEGF regulates haematopoietic stem cell survival by an internal autocrine loop mechanism. Nature 2002;417:954–8. 67. Shayesteh L, Lu Y, Kuo WL, Baldocchi R, Godfrey T, Collins C, Pinkel D, Powell B, Mills GB, Gray JW. PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet 1999;21:99–102. 68. Yuan ZQ, Sun M, Feldman RI, Wang G, Ma X, Jiang C, Coppola D, Nicosia SV, Cheng JQ. Frequent activation of AKT2 and induction of apoptosis by inhibition of phosphoinositide-3-OH kinase/Akt pathway in human ovarian cancer. Oncogene 2000;19:2324–30. 69. Philp AJ, Campbell IG, Leet C, Vincan E, Rockman SP, Whitehead RH, Thomas RJ, Phillips WA. The phosphatidylinositol 30 -kinase p85a gene is an oncogene in human ovarian and colon tumors. Cancer Res 2001;61:7426–9. 70. Altomare DA, Wang HQ, Skele KL, De Rienzo A, Klein-Szanto AJ, Godwin AK, Testa JR. AKT and mTOR phosphorylation is frequently detected in ovarian cancer and can be targeted to disrupt ovarian tumor cell growth. Oncogene 2004;23:5853–7. 71. Hu L, Zaloudek C, Mills GB, Gray J, Jaffe RB. In vivo and in vitro ovarian carcinoma growth inhibition by a phosphatidylinositol 3-kinase inhibitor (LY294002). Clin Cancer Res 2000;6:880–6. 72. Fujio Y, Walsh K. Akt mediates cytoprotection of endothelial cells by vascular endothelial growth factor in an anchorage-dependent manner. J Biol Chem 1999;274:16349–54. 73. Dayanir V, Meyer RD, Lashkari K, Rahimi N. Identification of tyrosine residues in vascular endothelial growth factor receptor-2/FLK-1 involved in activation of phosphatidylinositol 3-kinase and cell proliferation. J Biol Chem 2001;276:17686–92. 74. Chen H, Ye D, Xie X, Chen B, Lu W. VEGF, VEGFRs expressions and activated. STATs in ovarian epithelial carcinoma. Gynecol Oncol 2004;94:630–5.

VEGF-A/KDR PROTECTS EOC CELLS FROM ANOIKIS

75. Osada R, Horiuchi A, Kikuchi N, Ohira S, Ota M, Katsuyama Y, Konishi I. Expression of semaphorins, vascular endothelial growth factor, and their common receptor neuropilins and alleic loss of semaphorin locus in epithelial ovarian neoplasms: increased ratio of vascular endothelial growth factor to semaphorin is a poor prognostic factor in ovarian carcinomas. Hum Pathol 2006;37:1414–25. 76. Wu Y, Hooper AT, Zhong Z, Witte L, Bohlen P, Rafii S, Hicklin DJ. The vascular endothelial growth factor receptor (VEGFR-1) supports growth and survival of human breast carcinoma. Int J Cancer 2006; 119:1519–29.

561

77. Barr MP, Byrne AM, Duffy AM, Condron CM, Devocelle M, Harriott P, Bouchier-Hayes DJ, Harmey JH. A peptide corresponding to the neuropilin-1-binding site on VEGF(165) induces apoptosis of neuropilin-1-expressing breast tumour cells. Br J Cancer 2005;92:328–33. 78. Frumovitz M, Sood AK. Vascular endothelial growth factor (VEGF) pathway as a therapeutic target in gynecologic malignancies. Gynecol Oncol 2007;104:768–78. 79. Rosano` L, Spinella F, Salani D, Di Castro V, Venuti A, Nicotra MR, Natali PG, Bagnato A. Therapeutic targeting of the endothelin a receptor in human ovarian carcinoma. Cancer Res 2003;63:2447–53.