European Journal of Haematology ISSN 0902-4441
CASE REPORT
Burkitt lymphoma⁄leukaemia transformed from a precursor B cell: clinical and molecular aspects Rocio Hassan1, Fabricio Felisbino1, Claudio Gustavo Stefanoff1, Virginia Pires1, Claudete E. Klumb2, Jane Dobbin2, He´ctor N. Seua´nez3,4, Ilana Zalcberg Renault1 1
Bone Marrow Transplantation Centre (CEMO); 2Hematology Service and; 3Genetics Division, CPQ, Instituto Nacional de Caˆncer (INCA); 4Genetics Department, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Abstract Burkitt lymphoma ⁄ leukaemia (BL ⁄ L) is a heterogeneous disease with respect to epidemiological patterns and cell origin. The occurrence of BL ⁄ L with an immature phenotype raises the question whether this phenotype might be a consequence of early B-cell transformation or, alternatively, a secondary feature of transformed, mature B cells. It also poses important clinical questions regarding diagnosis and therapeutic procedures. Here we describe the case of a 4-yr-old child with BL ⁄ L and FAB L3 morphology, with phenotypic and genotypic characteristics of a CD10+ precursor B-cell acute lymphoid leukaemia (ALL) associated with t(8;14)(q24;q32). Molecular analysis showed expression of RAG1 and RAG2 and an unmutated VDJCl immunoglobulin rearrangement coinciding with a lack of AICDA expression, indicating an immature B-cell origin. His clinical response suggested that FAB L3 ALL with MYC rearrangement and an aberrant precursor B-cell phenotype is clinically similar to BL ⁄ L. Moreover, short, intensive chemotherapeutic protocols seemed to be beneficial. This case also allowed us to refine the description of cellular and molecular variants of BL ⁄ L regarding the cell origin and pathogenesis of this biologically heterogeneous disease. Key words Burkitt lymphoma ⁄ leukaemia; precursor B; AICDA; somatic hypermutation Correspondence Rocio Hassan, Instituto Nacional de Caˆncer – INCA, Bone Marrow Transplant Centre (CEMO), Prac¸a da Cruz Vermelha 23, 6th Floor, CEP 20230-130, Rio de Janeiro, RJ, Brazil. Tel: +55 21 2506 6506; Fax: +55 21 2506 6217; e-mail:
[email protected] Accepted for publication 23 October 2007
The World Health Organization (WHO) classification of leukaemias and lymphomas recognizes three acute lymphoid leukaemia (ALL) subtypes according to the origin of the transformed cell progenitor: precursor B-, precursor T- and B-cell ALL (1). In clinical practice, differential diagnosis between precursor B-cell ALL and B-cell ALL is based on the morphological (FAB L3) characteristics and expression of surface immunoglobulin (sIg) in the latter condition (2). Classically, FAB L3 B-cell ALL is characterised by the presence of a translocation, mainly t(8;14) or less frequently t(2;8) or t(8;22) (3) involving the MYC oncogene, located at 8q24, and one immunoglobulin gene. Accurate diagnosis is critical for prognosis because B-cell ALL shows an unfavourable response to conventional ALL chemotherapy and requires more intensive and shorter protocols (4, 5). ª 2008 The Authors Journal compilation 80 (265–270) ª 2008 Blackwell Munksgaard
doi:10.1111/j.1600-0609.2007.00992.x
The WHO classification also considers FAB L3 ALL and Burkitt lymphoma (BL) as equivalent entities under the common denomination of Burkitt lymphoma ⁄ leukaemia (BL ⁄ L) (1). Cell origin in BL is however controversial because different maturation stages and pathogenic pathways have been proposed for the endemic (eBL) and sporadic (sBL) subtypes (6, 7). Clarification of this point is crucial because the original compartment of a leukaemia ⁄ lymphoma accounts for specific pathogenic mechanisms, clinical course and biological behaviour. In fact, the maturation stage and cell origin of a BL ⁄ L might be revealed by investigating immunoglobulin (Ig) development involving VDJ recombination and somatic hypermutation (SH) (8, 9). In this paper, we report a case of BL ⁄ L with a FAB L3 morphology with phenotype and genotype characteristic
265
Burkitt lymphoma with immature genotype
of CD10+ precursor B-cell ALL associated with t(8;14)(q24;q32). Diagnosis, pathogenesis and the cell origin of this rare BL ⁄ L variant are discussed. Patient and methods Case report
A 4-yr-old male was referred to the Instituto Nacional de Caˆncer, Rio de Janeiro, Brazil, in November 2004, with a 2-month history of lumbar pain, weight loss
Hassan et al.
and an extradural, paraspinal tumour (T10–L1). His histopathology report was inconclusive. Laboratory tests showed leucocyte count of 32 400 ⁄ mL (55% blasts), 45 000 ⁄ mL platelets, 12.6 g ⁄ dL haemoglobin, 34% haematocrit, 9.5 mg ⁄ dL uric acid, and 14 990 U ⁄ L lactate dehydrogenase. Viral serology was negative. Abdominal tomography showed a 4-cm retrogastric mass and confluent lymph nodes in the paraand interaortic spaces associated with moderate ascitis. Bone marrow (BM) aspirates showed 100% lymphoid blasts, with vacuolated, basophilic cytoplasm, irregular
A
B
C
D
Figure 1 (A) Bone marrow cells showing FAB L3 characteristics. Cytospin preparation; May–Gru¨nwald–Giemsa staining. Magnification = 100·. (B–D) FISH images of interphase nuclei counterstained with DAPI. Tumour cell with t(8;14) detected with IGH (green), MYC (red) and chromosome 8 centromere (cen-8, aqua) probes. Two derived translocation products with adjacent MYC ⁄ IGH signals are indicated by arrows (B). Hybridisation pattern with IGH ‘break apart’ probes. Arrows show two split signals (translocated allele) (C). Tumour nuclei hybridised with BCL2 (red) and IGH (green) probes showing a normal BCL2 arrangement (D).
266
ª 2008 The Authors Journal compilation 80 (265–270) ª 2008 Blackwell Munksgaard
Hassan et al.
nuclei and FAB L3 morphology (Fig. 1A). Histopatological reassessment of the tumour tissue revealed proliferation of lymphoid blasts expressing TdT but not CD20, a finding that required a differential diagnosis with lymphoblastic lymphoma. Detection of t(8;14)(q24;q32) and high expression of the Ki67 antigen (>95%) confirmed BL ⁄ L. Following initial cytoreduction therapy, tumour lysis syndrome was diagnosed and treated, and the patient subsequently underwent a modified ALL-BFM 95 protocol. At present, 24 months after the end of treatment, the patient is in haematological and clinical remission. Cellular and molecular methods
Unseparated BM cells were incubated with a select panel of monoclonal antibodies (anti- CD45, CD34, HLA-DR, TdT, CD19, CD10, CD22, CD20, CD38, IgM; T-cell markers CD7, CD2, CD5, CD4, CD8; myeloid markers MPO, CD33, CD13, CD14, CD15) and analysed by flow cytometry with CellQuest software (Beckton-Dickinson, San Jose, CA, USA). Intracytoplasmic TdT, CD22 and cIg staining followed permeabilisation with FACS lysis solution (Beckton-Dickinson) and 0.5% Tween 20. Antigenic expression below 20% was considered negative. Antibodies were purchased from Becton-Dickinson except for anti-TdT (Dako, Glostrup, Denmark). Fluorescence in situ hybridisation (FISH) was performed with LSI MYC ⁄ IGH CEP 8, LSI IGH VH ⁄ CH (break apart) and LSI BCL2 ⁄ IGH probes (Vysis-Abbott, Des Plaines, IL, USA). Briefly, cytological preparations were pre-treated with RNAse A (100 lg ⁄ mL; 1 h at 37C) and pepsin (0.1 mg ⁄ mL – 0.01 m HCl; 10 min at 37C). Slides were subsequently fixed, dehydrated and denatured in 70% formamide for 5 min at 73C and hybridised with the probe for 16 h at 37C in an automated hybridiser (Hybrite, Vysis). Post-hybridisation washes were carried out following the manufacturer¢s recommendations. Analysis was performed with an Olympus X-60 epifluorescence microscope with a monochromatic charge-coupled device (CCD) camera (Photometrics, Tucson, AZ, USA) and QUIPS software (Vysis). Immunoglobulin heavy chain (IGH) rearrangements were amplified with a specific set of six forward primers for each VH1 ⁄ 7 family leader. One reverse, consensus JH primer was used with genomic DNA, and another reverse primer, annealing at a constant region (l, c, e, a), with cDNA (10). Sequences were compared with germline data, available at the V-BASE (http:// www.mrc-cpe.cam.uk), with the MacVector 10.0 software (Accelrys Inc., San Diego, CA, USA). Total RNA was extracted from mononuclear cells following the TRIzol protocol (Invitrogen, Carlsbad, CA,
ª 2008 The Authors Journal compilation 80 (265–270) ª 2008 Blackwell Munksgaard
Burkitt lymphoma with immature genotype
USA), and 1 lg was retro-transcribed by random priming with SuperScriptTM reverse transcriptase (Invitrogen). Expression of RAG1 and RAG2 was investigated by reverse transcriptase-polymerase chain reaction (RTPCR; 35 cycles, annealing 60C 1 min, 1.5 mm MgCl2) with primers RAG1 – ex1 ACACACTTTGCCTTCTCTTTGGTATT ⁄ RAG1 – ex2 TCTCACCCGGAACAGCTTAAA and RAG2 – ex1 TTCCCCAAGTGC TGACAATTAA ⁄ RAG2 – ex2 TTTGGGCCAGCCTTTTTG, respectively. BCL2 expression was studied by RTPCR, as described (11). AICDA and BCL6 expression was investigated by real-time RT-PCR with specific primer sets and Taqman probes (100 and 250 nm, respectively; Applied Biosystems, Assays-on-Demand Gene Expression systems), with a 7700 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) following standard (40 cycles) of thermal amplification. Quantitative estimations were performed twice according to the DDCt method. Normalisation of AICDA expression was carried out by GAPDH amplification using a predeveloped TaqMan Control Reagent (Applied Biosystems). Epstein–Barr virus (EBV) status was determined by RNA in situ hybridisation and PCR, as previously described (12). Results
Immunophenotyping showed a CD10+ precursor B-cell ALL profile, expressing HLA-DR, CD45, TdT, CD19, CD10, cCD22, sCD22 and CD38 but lacking expression of CD34, CD20, cytoplasmic Ig, sIg, T- and myeloid-cell markers. Fluorescence in situ hybridisation revealed two MYC ⁄ IGH fusions, indicating presence of t(8;14) (Fig. 1B). Altogether, the MYC probe showed three signals, one with a remarkably small size and intensity, presumably comprising a small MYC remnant resulting from a breakpoint at a far 5¢ site from the coding region. Hybridisation with ‘break apart’ probes was compatible with a rearrangement involving a single IGH allele (Fig. 1C). BCL2 ⁄ IGH translocations or any other major BCL2 rearrangement were not detected (Fig. 1D). Tumour cells did not contain EBV genomes. PCR assays confirmed a monoallelic IGH rearrangement expressing a VDJCl transcript; flow cytometry indicated that this transcript had not been translated to cytoplasmic Ig. Sequence analysis identified a VH2-05 ⁄ D727 ⁄ JH1c rearrangement; VH2 showing 100% homology with germline configuration. Analysis of the FR4 region showed a, frameshift, single base (G) deletion, probably accounting for unproductivity (Fig. 2). Leukaemic cells expressed RAG1 ⁄ 2 but not BCL2, BCL6 or AICDA (Fig. 3).
267
Burkitt lymphoma with immature genotype
Hassan et al.
Figure 2 Deduced amino acid sequence of the complementarity determining region 3 (CDR3) and adjacent regions of the VDJ rearrangement. The sequence on top represents the closest reported germline VH gene (VH2-05). Dots indicate identity. Dashed line above delimits the CDR3 region; solid line shows an identified D7-27 gene segment. The framework 4 (FR4) sequence, from amino acid position 103 (W), showed a frameshift, G deletion in codon 106. Sequence data were obtained from four independent sequencing reactions.
A
B
C
Figure 3 (A) Real-time PCR quantitation of AICDA expression by the DDCt method, using GAPDH as endogenous control. T, threshold. Calibrator: cDNA from peripheral blood mononuclear cells, used to estimate the physiological (quiescent status) expression levels. NTC, non-template control. The Burkitt lymphoma Ramos cell line was used as a positive control. (B) Real-time PCR quantitation of BCL6 expression. T, threshold. Calibrator: cDNA from Granta 519 cell line. Several Burkitt lymphoma patients were used as positive controls. (C) Expression of RAG1 and BCL2 genes by RT-PCR. Agarose 2% stained with ethidium bromide. Lane 1, positive control (cell lines REH for RAG1 and Karpas 422 for BCL2; lane 2, patient with t(8;14) and precursor B cell phenotype; lanes 3 and 4, surface immunoglobulin-expressing Burkitt lymphoma cases (100% and 87.8% VH germline homology, respectively; both expressing AICDA, one of them expressing BCL2, data not shown); lane 5, negative control, myeloid cell line K562; lane 6, PCR control (without DNA). RT-PCR for GAPDH expression was used as amplification control.
Discussion Clinical–biological and diagnostic aspects
Although the leukaemic BL form represents only 1–2% of paediatric ALL, accurate diagnosis is crucial for clinical management (13). In this patient, diagnosis was problematic because the haematological profile showed typical BL ⁄ L features while histopathology was inconclusive because of atypical morphology, TdT expression and lack of CD20 expression. Blast cells exhibited FAB L3 morphology and typical t(8;14) but their immunophenotype corresponded to a precursor B-cell ALL. Usually, FAB L3 blasts with MYC translocations show a mature B-cell phenotype including positivity for CD20, sIg and clonal Ig light chain, with TdT and RAG negativity (13). This is why this patient, like 11 others reviewed by Komrokji et al. (14), showed an exceptional phenotypic pattern.
268
Our estimates, based on a previous report of 5280 ALL patients (5) indicated that these patients must account for one of 1000 ALLs and 5% of FAB L3 ALLs. In these rare cases of FAB L3, precursor B-cell ALL with MYC rearrangement, as in the case described herein, clinical response was apparently related to MYC deregulation rather than cell phenotype. Thus, in BL ⁄ L, the presence of MYC translocation, irrespectively of cell phenotype, might be associated with a favourable response to short, intensive chemotherapeutic protocols. Cell origin and pathogenesis
Burkitt lymphoma is characterized by a germinal centre (GC) immunophenotype, expression of the B-cell receptor (BCR) like most peripheral B-cell lymphomas, and presence of SH in VH and VL genes and AICDA expression
ª 2008 The Authors Journal compilation 80 (265–270) ª 2008 Blackwell Munksgaard
Hassan et al.
(8, 9, 14, 15). Furthermore, classic FAB L3 ALL, despite BM commitment, also shows mutated V genes (16). Until now, only one case of BL expressing an unmutated BCR coincident with lack of AICDA expression has been reported (17), presumably derived from a naı¨ ve B cell and originated before the activation of affinity maturation processes. In our case, the immature phenotype associated with (i) expression of key genes involved in VDJ recombination, (ii) ummutated VH status and (iii) lack of AICDA expression, supported the proposition of precursor B-cell origin. The leukaemic cells of this patient expressed a mature, albeit unproductive VDJCl transcript, while the other IGH allele was disrupted by t(8;14), deterring the production of a functional BCR. Transformation might have resulted from apoptotic rescue of a non-functional B-cell progenitor, which also counteracted the apoptotic effect resulting from acute MYC expression. In this patient, BCL2 was not rearranged or overexpressed, although in three of 11 cases (14), translocations involving MYC coexisted with t(14;18). However, precursor-B ALLs carrying t(14;18) apparently belong to a different group of leukaemias with an immature phenotype coexisting with a mature immunomolecular profile (18, 19). In this group, with SH patterns similar to follicular lymphoma (19), the immature phenotype represents a secondary trait. The molecular mechanisms of t(8;14) are apparently different between eBL and sBL (20) because in eBL, some translocations may arise consequent to recombinase errors during VDJ rearrangements while others may occur during SH, while in sBL, translocations presumably occur by SH and class-switch errors (20–22). In this patient, t(8;14) must have occurred during precursor Bcell development, when VDJ recombinase machinery was active, as indicated by RAG1, RAG2 and TdT expression, probably involving breakage and non-homologous recombination associated with VDJ recombination errors. To our knowledge, this is the first case of BL ⁄ L of precursor B-cell origin confirmed by immunomolecular methods. This provides some clue to the question whether FAB L3 ALL with MYC rearrangement and aberrant, precursor B-cell phenotype might be clinically similar to BL ⁄ L, and whether this condition should be treated with short, intensive chemotherapeutic protocols. This case also allowed us to refine the description of cellular and molecular variants of BL ⁄ L, with respect to the cell origin and pathogenesis of this biologically heterogeneous disease. Acknowledgements
This work was supported by CNPq Grant 478264-20038, Brazil and SwissBridge Foundation, Switzerland.
ª 2008 The Authors Journal compilation 80 (265–270) ª 2008 Blackwell Munksgaard
Burkitt lymphoma with immature genotype
References 1. Jaffe ES, Harris NL, Stein H, Vardiman JW, eds. World Health Organization classification of tumors, pathology and genetics of haemopoietic and lymphoid tissues. Lyon: IARC Press, 2001. 2. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C. Proposals for the classification of the acute leukemias (FAB cooperative group). Br J Haematol 1976;33:451–8. 3. Hecht JL, Aster JC. Molecular biology of Burkitt’s lymphoma. J Clin Oncol 2000;18:3707–21. 4. Bowman WP, Shuster JJ, Cook B, et al. Improved survival for children with B cell acute lymphoblastic leukemia and stage IV small non-cleaved cell lymphoma: a Pediatric Oncology Group study. J Clin Oncol 1996;14:1252–61. 5. Navid F, Mosijczuk AD, Head DR, et al. Acute lymphoblastic leukemia with the (8;14)(q24;q32) translocation and FAB-L3 morphology associated with a B-precursor immunophenotype: the Pediatric Oncology Group experience. Leukemia 1999;13:135–41. 6. Magrath IT. The pathogenesis of Burkitt lymphoma. Adv Can Res 1990;55:133–270. 7. Gutierrez MI, Hamdy N, Bhatia K, Bornkamm G, Lenoir G, Epelman S. Geographic variation in t(8;14) chromosomal breakpoint location and EBV association in Burkitt’s lymphoma. Int J Pediatr Hematol Oncol 1999;6:161–8. 8. Ku¨ppers R, Klein U, Hansmann ML, Rajewsky K. Cellular origin of human B-cell lymphomas. N Engl J Med 1999;341:1520–9. 9. Stevenson FK, Sahota S, Zhu D, Ottensmeier C, Chapman C, Oscier D, Hamblin T. Insight into the origin and clonal history of B-cell tumours as revealed by analysis of immunoglobulin variable region genes. Immunol Rev 1998;162:247–59. 10. Thompsett AR, Ellison DW, Stevenson FK, Zhu D. VH gene sequences from primary central nervous system lymphomas indicate derivation from highly mutated germinal center B cell with ongoing mutational activity. Blood 1999;94:1738–46. 11. Marone M, Mozzetti S, De Ritis D, Pierelli L, Scambia G. Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample. Biol Proced Online 2001;3:19–25. 12. Hassan R, White LR, Stefanoff CG, de Oliveira DE, Felisbino FE, Klumb CE, Bacchi CE, Seua´nez HN, Zalcberg IR. Epstein-Barr virus (EBV) detection and typing by PCR: a contribution to diagnostic screening of EBVpositive Burkitt’s lymphoma. Diagn Pathol 2006;1:17. 13. Willman CL. Acute Leukemias: a paradigm for the integration of new technologies in diagnosis and classification. Mod Pathol 1999;12:218–28. 14. Komrokji R, Lancet J, Felgar R, Wang N, Bennett JM. Burkitt’s leukemia with precursor B-cell immuno-
269
Burkitt lymphoma with immature genotype
15.
16.
17.
18.
270
phenotype and atypical morphology (atypical Burkitt’s leukemia ⁄ lymphoma): case report and review of the literature. Leukemia Res 2003;27:561–6. Chapman CJ, Wright D, Stevenson F. Insight into Burkitt’s lymphoma from immunoglobulin variable region gene analysis. Leuk Lymphoma 1998;30:257–68. van der Burg M, Barendregt BH, van Wering ER, Langerak AW, Szczepanski T, van Dongen JJ. The presence of somatic mutations in immunoglobulin genes of B cell acute lymphoblastic leukemia (ALL-L3) supports assignment as Burkitt’s leukemia-lymphoma rather than B-lineage ALL. Leukemia 2001;15:1141–3. Hardianti MS, Tatsumi E, Syampurnawati M, Furuta K, Saigo K, Kawano S, Kumagai S, Nakamura F, Matsuo Y. Expression of activation-induced cytidine deaminase (AID) in Burkitt lymphoma cells: Rare AID-negative cell lines with the unmutated rearranged VH gene. Leuk Lymphoma 2004;45:155–60. Karsan A, Gascoyne RD, Coupland RW, Shepherd JD, Phillips GL, Horsman DE. Combination of t(14;18) and a
Hassan et al.
19.
20.
21.
22.
Burkitt’s type translocation in B-cell malignancies. Leuk Lymphoma 1993;10:433–41. Hardianti MS, Tatsumi E, Syampurnawati M, et al. Presence of somatic hypermutation and activation-induced cytidine deaminase in acute lymphoblastic leukemia L2 with t(14;18)(q32;q21). Eur J Haematol 2005;74:11–9. Ku¨ppers R, Dalla-Favera R. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene 2001;20:5580–94. Haluska FG, Finver S, Tsujimoto Y, Croce CM. The t(8;14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V-D-J joining. Nature 1986;324:158–61. Pelicci PG, Knowles DM II, Magrath I, Dalla-Favera R. Chromosomal breakpoints and structural alterations of the c-myc locus differ in endemic and sporadic forms of Burkitt lymphoma. Proc Natl Acad Sci USA 1986;83:2984–8.
ª 2008 The Authors Journal compilation 80 (265–270) ª 2008 Blackwell Munksgaard
